ID: 965572652

View in Genome Browser
Species Human (GRCh38)
Location 3:170187177-170187199
Sequence ATCATTGACCACCCTACACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965572649_965572652 14 Left 965572649 3:170187140-170187162 CCAGCCTTTTACAGAAAAAGTTT No data
Right 965572652 3:170187177-170187199 ATCATTGACCACCCTACACTGGG No data
965572648_965572652 30 Left 965572648 3:170187124-170187146 CCGCATGTGGCTCTATCCAGCCT No data
Right 965572652 3:170187177-170187199 ATCATTGACCACCCTACACTGGG No data
965572650_965572652 10 Left 965572650 3:170187144-170187166 CCTTTTACAGAAAAAGTTTGCTG 0: 94
1: 326
2: 686
3: 1112
4: 1448
Right 965572652 3:170187177-170187199 ATCATTGACCACCCTACACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965572652 Original CRISPR ATCATTGACCACCCTACACT GGG Intergenic
No off target data available for this crispr