ID: 965576959

View in Genome Browser
Species Human (GRCh38)
Location 3:170227258-170227280
Sequence AACTCAGTTTGAATGATCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965576959_965576960 9 Left 965576959 3:170227258-170227280 CCAGAGATCATTCAAACTGAGTT 0: 1
1: 0
2: 0
3: 10
4: 106
Right 965576960 3:170227290-170227312 TTGTTGAACGTCCGTAATCCAGG 0: 1
1: 0
2: 0
3: 2
4: 44
965576959_965576963 28 Left 965576959 3:170227258-170227280 CCAGAGATCATTCAAACTGAGTT 0: 1
1: 0
2: 0
3: 10
4: 106
Right 965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG 0: 1
1: 0
2: 1
3: 10
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965576959 Original CRISPR AACTCAGTTTGAATGATCTC TGG (reversed) Intronic
903593628 1:24477405-24477427 AACTCAGGTCTTATGATCTCTGG + Intergenic
908990017 1:70075790-70075812 AATTCAGTTTGAAAAATCTCAGG - Intronic
912318830 1:108691942-108691964 ATCTCAGTTTTAAGGTTCTCTGG - Intergenic
914413816 1:147458680-147458702 AACCCAGTTTGAAGGCTCTAGGG - Intergenic
916567844 1:165997213-165997235 GGCTCTGTTTGTATGATCTCAGG + Intergenic
917728508 1:177850657-177850679 AAGTCAGATTGATTGATTTCTGG + Intergenic
921254946 1:213330614-213330636 AACTGAGTTAGTATGATCACTGG + Intergenic
922985264 1:229861433-229861455 ATCTCAGTTTAAATGATCTTTGG + Intergenic
1066134660 10:32432924-32432946 AATTCAGTGGGATTGATCTCTGG - Intergenic
1074792662 10:116906677-116906699 AACTCAGTTTCACTGTTTTCAGG + Exonic
1080984758 11:37448929-37448951 TATTCAGTCTGAATTATCTCAGG + Intergenic
1081010712 11:37808422-37808444 AACTCAGATTGAGTGAACTGAGG - Intergenic
1082192520 11:49264568-49264590 AATACAATTTAAATGATCTCAGG + Intergenic
1084458319 11:69281865-69281887 AACTCTGTGTGAGTGACCTCTGG + Intergenic
1086673598 11:89576403-89576425 AATACAATTTAAATGATCTCAGG - Intergenic
1092809193 12:12256407-12256429 AACTTAGTTGGAAGGATCACCGG + Intronic
1095107490 12:38252843-38252865 GACTCAGTTTGAATTTTCTCTGG - Intergenic
1097323623 12:58251942-58251964 AACTGAGAGTGAATGATTTCTGG + Intergenic
1102113315 12:110381640-110381662 AACTCTGTTAGAATAATCTGGGG - Intronic
1102724364 12:115046489-115046511 ACCTAAGTTTGAATGACCTTAGG - Intergenic
1103510864 12:121473082-121473104 ATCTCATTTTGAATAATCTTTGG - Intronic
1105706111 13:22968302-22968324 GACTCAGTCTGAATGATACCAGG - Intergenic
1107589848 13:41891692-41891714 AACTCAGCTTTATTGATTTCTGG - Intronic
1108740078 13:53328027-53328049 AATTCAGTTAGAAAGATGTCAGG - Intergenic
1112133010 13:96544256-96544278 AACGTACTTTGAATGCTCTCTGG - Intronic
1114737951 14:25062456-25062478 AACTGATTTTGACTGTTCTCAGG + Intergenic
1115229529 14:31144827-31144849 AACTCAGTTAGAGTCATCTTGGG - Exonic
1117945960 14:61021512-61021534 AGCTCTGTTTGAATGTTTTCAGG - Intronic
1118193045 14:63597640-63597662 AAATTAGTTTGAAAGATATCTGG - Exonic
1119599400 14:75964971-75964993 AACTCAGCCTTGATGATCTCTGG - Intronic
1121165962 14:91800036-91800058 ATCTCAGTTGGTATGCTCTCAGG - Intronic
1128830714 15:70765756-70765778 AACACAGATGGAATGATCTGAGG + Intergenic
1130794715 15:87196001-87196023 AGCTGAGTTGGAATAATCTCTGG - Intergenic
1133667513 16:7983690-7983712 TACTCAGATTGAATGATTTGAGG + Intergenic
1135375023 16:21938652-21938674 AATTCAGTTTTAATGATCTTGGG - Intergenic
1135375852 16:21946637-21946659 AATTCAGTTTTAATGATCTTGGG - Intergenic
1136638345 16:31540253-31540275 AACCCAGGTTGAAGGATCACCGG + Intergenic
1137288490 16:47035909-47035931 AACTCATTTATAATGATTTCTGG - Intergenic
1143933189 17:10452917-10452939 AATTTAGCTTGAAGGATCTCTGG - Exonic
1146558064 17:33844074-33844096 AACTCATTTTCAATAAGCTCTGG + Intronic
1155034426 18:22013387-22013409 AACACAGTTTTAATGACCTGCGG - Intergenic
1156508543 18:37615544-37615566 AACTCAGATAGAATAATCTGTGG + Intergenic
1158334766 18:56404220-56404242 CACTCAGTTTGAAGGAACTGAGG + Intergenic
1159733128 18:72056648-72056670 GACTCAGTTTGAATGTTCAAAGG + Intergenic
1159737038 18:72113060-72113082 AAATCAGTTTTATGGATCTCTGG - Intergenic
1166176787 19:41078875-41078897 CACTCAGTTTAAATGAGATCTGG - Intergenic
1166639542 19:44483832-44483854 AATTCAGTTTAAATGATTACAGG - Intronic
933180809 2:79224824-79224846 AATTAAGTTTGACTGTTCTCGGG + Intronic
933479135 2:82833042-82833064 TACTCAGACTGCATGATCTCTGG - Intergenic
935521251 2:104107843-104107865 AACTCAGTTTTAAGGATGTTGGG + Intergenic
936756977 2:115726067-115726089 ACCTCAGTTAGAAAGTTCTCAGG - Intronic
939916159 2:148046435-148046457 TACTCAGTTTGAAAGACCTCAGG - Intronic
944056941 2:195532147-195532169 AACTCTGTTTGAATGCTCTATGG - Intergenic
944238635 2:197464293-197464315 AACTCAGTTTTAAAAATCTTTGG - Intronic
948371292 2:237490853-237490875 AACAGAGTTTGAATGCTCCCAGG + Intronic
1184096482 22:42318963-42318985 AACACAGCTGGAGTGATCTCAGG - Intronic
955181889 3:56680097-56680119 TACCCAGTTTGAATAATCTAAGG - Intronic
957376632 3:79367264-79367286 GACTCAGTTTGAATGGAATCAGG + Intronic
959988982 3:112609880-112609902 GAATCATTTTGAATGATCTAAGG + Intronic
962025212 3:131540671-131540693 AACTCAGTATGAAGAATGTCAGG + Intronic
965275688 3:166678832-166678854 AACTCATTGTAAATGATATCAGG + Intergenic
965576959 3:170227258-170227280 AACTCAGTTTGAATGATCTCTGG - Intronic
965727126 3:171729874-171729896 AACTCAGTATTATTGATCTGTGG + Intronic
965893492 3:173544599-173544621 CATTGAGTTTGAATGATCTGTGG + Intronic
966132264 3:176654466-176654488 ACCTCAGTTTGAATTATCTTTGG + Intergenic
966574906 3:181489758-181489780 AACTCAGATGGAATAATCTAGGG + Intergenic
973993100 4:56431453-56431475 AACTGATTTGTAATGATCTCAGG - Intronic
977485904 4:97645978-97646000 AACTGAGTGAGAGTGATCTCTGG - Intronic
977635202 4:99289985-99290007 AACTCAGTTTAAAGGCTCTGAGG - Intronic
977786759 4:101044237-101044259 AAAAGAGTTTTAATGATCTCTGG - Intronic
978889282 4:113803526-113803548 AAATAAGTTTAAATGATCTGAGG + Intergenic
982355591 4:154464402-154464424 AGGTTAGTTAGAATGATCTCTGG - Intronic
982355852 4:154467105-154467127 AGATTAGTTGGAATGATCTCTGG - Intronic
983405949 4:167330160-167330182 TACTTAGTTTGTAGGATCTCAGG + Intergenic
983801748 4:171939578-171939600 AACACAGTTTGCATGATTTGGGG - Intronic
984093051 4:175398806-175398828 AACTAAGTGTGATTAATCTCTGG + Intergenic
984256094 4:177391773-177391795 GGTTCAGTTTGAATTATCTCTGG + Intergenic
984532835 4:180938279-180938301 AACATACTTTGAATGAACTCTGG + Intergenic
986041269 5:3996248-3996270 AACCTAGTTTGAATAATCACAGG - Intergenic
992269544 5:75051613-75051635 AACTGACTTTGAATGACCTATGG - Intergenic
994221366 5:97198857-97198879 ATCTTGGTTTGAATCATCTCAGG + Intergenic
994411636 5:99413871-99413893 AACTCAGTTGGGATGCTATCAGG - Intergenic
994482190 5:100351379-100351401 AACTCAGTTGGGATGCTATCAGG + Intergenic
1000378554 5:160607546-160607568 TACTAAGTTTGGATGATCTTGGG - Intronic
1002154117 5:177262128-177262150 AAATAAGTTTAAATGGTCTCTGG + Intronic
1003820459 6:9890633-9890655 AACTCAATTTTAATCATCACAGG - Intronic
1010455990 6:76056132-76056154 GACCCAGTTTGATTTATCTCAGG + Intronic
1011963200 6:93117459-93117481 AACTCAATTTGAATGATACCAGG + Intergenic
1014476176 6:121874606-121874628 ATTTCAGTTTCACTGATCTCTGG + Intergenic
1015083644 6:129260166-129260188 GACTGACTTAGAATGATCTCTGG - Intronic
1017290182 6:152726879-152726901 AACTCAGAATGAAGAATCTCTGG + Intergenic
1017307021 6:152930347-152930369 TACTCAGTTTAAATAATCCCAGG - Intergenic
1022538263 7:31111689-31111711 CACTCAGTTTCCATGATCCCTGG - Intergenic
1031172313 7:118307884-118307906 AACTATGTTTGAATGGTATCAGG + Intergenic
1032649879 7:133866661-133866683 AACTCATTTTGATTCATCGCTGG + Intronic
1033177970 7:139143944-139143966 AAATGAGTTTAAATGATCTAAGG - Intronic
1033826640 7:145199134-145199156 AACACAGTTTCAGTGATCACTGG - Intergenic
1033924925 7:146446057-146446079 AACTTAGTAAGAATGATCTACGG - Intronic
1035044925 7:155957470-155957492 TACACAGTTTGAAGGATCACAGG + Intergenic
1038142178 8:24858063-24858085 AACTCATTTTGAGTTTTCTCTGG - Intergenic
1042172511 8:66005801-66005823 AACTCAGTTTGCATTTTCTTGGG - Intergenic
1046536976 8:115527474-115527496 AACTCAGTATGAAAGATGTTGGG - Intronic
1046591309 8:116210478-116210500 ACCTCAGGTTGAATGAACTGAGG - Intergenic
1047698484 8:127427213-127427235 AACTCAGTTTGAATGACTCCAGG - Intergenic
1050948438 9:11557260-11557282 ATCTCAGTGTGAATGATTTTTGG + Intergenic
1051744510 9:20282314-20282336 AACTCTTTTTCATTGATCTCTGG + Intergenic
1053093419 9:35301605-35301627 AACTAAGTTTGAAGGTTCACTGG - Intronic
1055157298 9:73080093-73080115 AATTCAGATTGAATTATCACGGG - Intronic
1060161966 9:121372163-121372185 AACTCAGTTTTAAAGTTTTCTGG + Intergenic
1060871925 9:127049712-127049734 AATTCAGTCTGATTCATCTCAGG + Intronic
1188759833 X:34013771-34013793 AACTAAGTGTCCATGATCTCAGG - Intergenic
1189433910 X:40973985-40974007 AAAAGAGTTTTAATGATCTCAGG + Intergenic
1190894173 X:54600096-54600118 CATTCAGTTTGAATTATTTCTGG + Intergenic
1191199600 X:57765188-57765210 GACATAGTTTGAATGCTCTCTGG + Intergenic
1195240597 X:102947951-102947973 AACTCAGTTTTAAGGATTTTGGG + Intergenic
1199219071 X:145296318-145296340 AAGTCAGCTGGAGTGATCTCAGG - Intergenic
1201613534 Y:15869688-15869710 AAGTCAAGTTGAATGAACTCAGG + Intergenic