ID: 965576963

View in Genome Browser
Species Human (GRCh38)
Location 3:170227309-170227331
Sequence CAGGCACATGATGCTGTCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965576959_965576963 28 Left 965576959 3:170227258-170227280 CCAGAGATCATTCAAACTGAGTT 0: 1
1: 0
2: 0
3: 10
4: 106
Right 965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG 0: 1
1: 0
2: 1
3: 10
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965576963 Original CRISPR CAGGCACATGATGCTGTCGT AGG Intronic
902134839 1:14296241-14296263 CAGGCAAATGCTGCAGTGGTGGG + Intergenic
902718123 1:18286686-18286708 CAGGCACAGCAGGCTGTCCTGGG + Intronic
905152705 1:35944325-35944347 CAGGCACAAGATGCTGTGCCTGG + Intronic
905724276 1:40235789-40235811 CAGGCACAAGATGCTGGTCTTGG + Exonic
906318791 1:44804260-44804282 CTGGTACATGCTGCTGTGGTGGG + Intronic
906514810 1:46432619-46432641 CAGGCTCACCATGCTGTCATAGG - Intergenic
912409346 1:109468841-109468863 CAGGGAAATGATGCAGTCTTGGG + Intronic
917964126 1:180167822-180167844 CAGGGACATGGTGCTATCTTTGG + Intronic
921106173 1:211981157-211981179 CTGGAACAAGATGCTGTCTTTGG - Exonic
921113603 1:212064305-212064327 CAGGCACAGGATGTTGTCAGTGG - Intronic
922053859 1:222021650-222021672 GAGGCCCATGATGCTGTCACAGG + Intergenic
923629428 1:235640169-235640191 CAGGCACATCATGCTTACGGTGG + Intronic
923965923 1:239139018-239139040 CAAGCACAGGATGTTGTGGTGGG + Intergenic
1063299723 10:4840637-4840659 CAGCCACATGAAGCTGCTGTGGG + Intronic
1065571347 10:27073305-27073327 CACGCACATCATGCTGTCGTGGG - Intronic
1075697088 10:124444505-124444527 CAGGCACATGCTGCTATGTTTGG - Intergenic
1076380306 10:130020788-130020810 CAGGAACACGAGGCTGTCATCGG + Intergenic
1077217788 11:1402231-1402253 CAGGCACAGCAGGCTGTGGTGGG + Intronic
1079401380 11:20108989-20109011 GAGACACAAGATGCTATCGTAGG + Intronic
1080051323 11:27861895-27861917 CAGTCACATGATGCTGACGAAGG + Intergenic
1080730099 11:34941825-34941847 CAGGACGATGATGCTGGCGTCGG + Intronic
1087577196 11:100004131-100004153 CAAGCACATGGTGCTCTTGTGGG + Intronic
1101079769 12:101171019-101171041 CAGGAGCAGGATGGTGTCGTGGG + Intronic
1101379412 12:104201539-104201561 CAGGAGCATGATGCTGTAGGAGG - Intergenic
1110871312 13:80455437-80455459 CAGGCACCTGCTGCTGTGCTGGG - Intergenic
1111337448 13:86841072-86841094 CAGGAACTTGGTGCTGTCGATGG + Intergenic
1111637878 13:90928907-90928929 CAGGCACATCCTACTGTCTTGGG + Intergenic
1111997101 13:95175938-95175960 CAGGCACCTGTTCCTGTGGTGGG - Intronic
1114530564 14:23392950-23392972 CAGGTCCATGATGCTCTCCTGGG + Exonic
1114535889 14:23422218-23422240 CAGGTCCATGATGCTCTCCTGGG + Exonic
1118524238 14:66621901-66621923 CAGGCACACAGTGCTGTCGGTGG + Intronic
1122393760 14:101408182-101408204 CAGGCAGATGAGGCTGGCGCAGG - Intergenic
1126496168 15:49293040-49293062 CAGGCACAGGATGGAGTCTTGGG + Intronic
1129825127 15:78629873-78629895 CAGCCACAGGACGCTGCCGTTGG + Exonic
1137628968 16:49928612-49928634 CATGCACGTGATGCTATCGTTGG - Intergenic
1138564010 16:57819325-57819347 CAGGCACATGATACTGTGCCTGG - Intronic
1140271943 16:73473937-73473959 CAAGCAAATAATGCTGTCATCGG - Intergenic
1141331218 16:83113058-83113080 CAGGCAGCTGATGCTATCGAAGG + Intronic
1148757776 17:49983285-49983307 TAGGCACATGATGGTTTCCTGGG + Intergenic
1149045972 17:52246052-52246074 CAGAAACATGATGCTGTCATCGG - Intergenic
1149460210 17:56822989-56823011 CAGGAACATGATGCTGACCTTGG - Intronic
1149867561 17:60159139-60159161 CAGGCACCTCATCCTGTCCTGGG - Intronic
1160403902 18:78631332-78631354 CAGGCACCTGATGGGGTCATGGG + Intergenic
1167149842 19:47702243-47702265 CAGGTTCAGGATGCTGTCGATGG - Exonic
926157762 2:10467005-10467027 TTGGCACATGCTGCAGTCGTAGG + Intergenic
931050380 2:58407313-58407335 CAGGCACATGCCGCTGTGCTCGG - Intergenic
935202673 2:100871471-100871493 CAGGCACATGCTGCTGTGCTTGG + Intronic
937209880 2:120261619-120261641 CATGCAAATGCTGCTGTCGAGGG - Intronic
944201005 2:197107390-197107412 CAGACACCAGATGCTGTCTTTGG + Intronic
946317542 2:218927391-218927413 CATTCACATGATGCAGCCGTGGG + Intergenic
948060347 2:235038876-235038898 CAGGTACATGATGTAGTGGTTGG + Intronic
948901884 2:240960376-240960398 GAGCCACATGATGGTGACGTGGG + Intronic
1168848996 20:963899-963921 CAGGCACACGAGGCTGCGGTGGG - Intronic
1170598914 20:17825959-17825981 CTGGCAAAAGATGCTGTCTTGGG + Intergenic
1176704360 21:10100995-10101017 CAGGCACATGGTGTTGTTGGTGG + Intergenic
1178496108 21:33087666-33087688 CAGGCACTTGAGGCTGCCTTTGG - Intergenic
1179124267 21:38577556-38577578 CAGGCTCCTGGTGCTCTCGTGGG + Intronic
1180075594 21:45459895-45459917 CAGGCACCCGTTGCTGTTGTGGG - Intronic
1181286499 22:21756234-21756256 CAGGCACATTATGCTATCTGTGG + Exonic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
950679377 3:14574453-14574475 CAGCCACCTGATGCTGCCTTTGG - Intergenic
951087999 3:18537487-18537509 CAGGCACATGCTGCTGGGCTCGG + Intergenic
951698386 3:25469349-25469371 CATGAACATGATGCTGTCTTTGG + Intronic
951943282 3:28105673-28105695 CTGGCATATGATGCTGTGATTGG + Intergenic
953349296 3:42202627-42202649 CAGGGACATGATGCTCTCAGTGG - Exonic
954103856 3:48398541-48398563 CTTGCACAGGATGCTGTCTTTGG + Intronic
955350145 3:58187709-58187731 CACTCACTTGAGGCTGTCGTTGG - Intergenic
960447680 3:117767493-117767515 CAGTCACATGATTCTATCCTTGG - Intergenic
960608949 3:119537186-119537208 GAGACACATGAAGCTGTGGTTGG + Exonic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
965823490 3:172708224-172708246 TAGGCAGCTGATGCTGTCTTAGG + Intronic
971252333 4:24983855-24983877 CAGGCAATTGATGCTGGCTTGGG - Intergenic
973323236 4:48831224-48831246 CAGTCGCCTGCTGCTGTCGTCGG + Exonic
975592069 4:76010816-76010838 CAGGGAAATGATGCTGGCCTGGG - Intergenic
980376572 4:131957329-131957351 CAGGCACATGGTGCTGTTGGTGG + Intergenic
985236354 4:187879246-187879268 CAGGCACATTTTGCAGTAGTGGG - Intergenic
996545283 5:124671612-124671634 CAGGCACATCATACTGTCCTGGG + Intronic
996596803 5:125212652-125212674 CAGGCACATCATTCTGTCAATGG - Intergenic
997642863 5:135460883-135460905 CAGCCCCATGCTGCTGTCCTTGG - Intergenic
999658562 5:153834659-153834681 CTGGCACATGATGCTGTGATGGG + Intergenic
1002100722 5:176856280-176856302 CTGGCACATGCTGCTCTTGTAGG - Intronic
1003080283 6:3016015-3016037 CAGGCACATGATGCTCAAGGGGG - Intronic
1004616116 6:17291019-17291041 CTGTCACAAGAGGCTGTCGTGGG - Intronic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1007041934 6:38730345-38730367 CAGGCACAAGATGCTGAGATAGG - Intronic
1009312831 6:62177044-62177066 CAAGCACATGATACTGACATAGG - Intronic
1010047525 6:71463701-71463723 CAGAGACATGATTCTGTCATTGG + Intergenic
1010865216 6:80967939-80967961 CAGGCTCATGATGCTGGTGATGG - Intergenic
1014041652 6:116834141-116834163 CAGGCACATGAAGTTGTTGGTGG - Intergenic
1018842044 6:167524350-167524372 CAGGCTCTTCATCCTGTCGTTGG - Intergenic
1022686005 7:32597096-32597118 CAGGCACATGATGCTCGAGGGGG - Intergenic
1023138565 7:37078073-37078095 CAGGCCCATGATGCTTTCAGAGG + Intronic
1023585534 7:41725879-41725901 CAGACACATGACACTGTAGTTGG - Intergenic
1035238855 7:157517304-157517326 CAGACACCTGAGGCTATCGTGGG - Intergenic
1035595689 8:855595-855617 CAGGCACCTGAAGCTTACGTGGG - Intergenic
1042040675 8:64585670-64585692 CTGGCACATGCTGCAGTCTTAGG - Intergenic
1042261052 8:66859519-66859541 GAGGCAGATGATGCATTCGTTGG + Exonic
1053641621 9:40088011-40088033 CAGGCACATGGTGTTGTTGGTGG + Intergenic
1053764514 9:41377453-41377475 CAGGCACATGGTGTTGTTGGTGG - Intergenic
1054322509 9:63685400-63685422 CAGGCACATGGTGTTGTTGGTGG + Intergenic
1054543130 9:66288630-66288652 CAGGCACATGGTGTTGTTGGTGG - Intergenic
1062388948 9:136326603-136326625 AAGGCCCAGGATGCTGTCGGGGG + Intergenic
1062564557 9:137158456-137158478 CAGGTTCATGATGCTGTAGTTGG - Exonic
1062565101 9:137160833-137160855 CAGGCAGACGATGCTGACGGTGG + Intronic
1202789397 9_KI270719v1_random:71097-71119 CAGGCACATGGTGTTGTTGGTGG + Intergenic
1185874059 X:3687854-3687876 GAGGAACACGATGCTGTCCTTGG - Intronic
1187676689 X:21723345-21723367 CACCCACAGGATGCTGTCCTTGG + Intronic
1192529912 X:71875079-71875101 CAGGCACTTTCTGGTGTCGTGGG - Intergenic
1200834367 Y:7718351-7718373 CTGGCACATTATGCTGAGGTGGG - Intergenic