ID: 965579105

View in Genome Browser
Species Human (GRCh38)
Location 3:170248002-170248024
Sequence CTGCATATCCAGAGGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 266}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965579101_965579105 28 Left 965579101 3:170247951-170247973 CCTTTACAGTAAGGGAGTACAGT 0: 1
1: 0
2: 0
3: 9
4: 94
Right 965579105 3:170248002-170248024 CTGCATATCCAGAGGCAGGATGG 0: 1
1: 0
2: 0
3: 22
4: 266
965579100_965579105 29 Left 965579100 3:170247950-170247972 CCCTTTACAGTAAGGGAGTACAG 0: 1
1: 0
2: 0
3: 9
4: 111
Right 965579105 3:170248002-170248024 CTGCATATCCAGAGGCAGGATGG 0: 1
1: 0
2: 0
3: 22
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965579105 Original CRISPR CTGCATATCCAGAGGCAGGA TGG Intronic