ID: 965579105

View in Genome Browser
Species Human (GRCh38)
Location 3:170248002-170248024
Sequence CTGCATATCCAGAGGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 266}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965579100_965579105 29 Left 965579100 3:170247950-170247972 CCCTTTACAGTAAGGGAGTACAG 0: 1
1: 0
2: 0
3: 9
4: 111
Right 965579105 3:170248002-170248024 CTGCATATCCAGAGGCAGGATGG 0: 1
1: 0
2: 0
3: 22
4: 266
965579101_965579105 28 Left 965579101 3:170247951-170247973 CCTTTACAGTAAGGGAGTACAGT 0: 1
1: 0
2: 0
3: 9
4: 94
Right 965579105 3:170248002-170248024 CTGCATATCCAGAGGCAGGATGG 0: 1
1: 0
2: 0
3: 22
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965579105 Original CRISPR CTGCATATCCAGAGGCAGGA TGG Intronic
901040027 1:6358239-6358261 CTGCATCTCCAGAAGAGGGAAGG + Intronic
901733158 1:11295013-11295035 CTGCCCACCCCGAGGCAGGAAGG - Intronic
901941735 1:12667452-12667474 CTGCATTTCCTAAGGCAGTAAGG + Intergenic
903668591 1:25022494-25022516 CGGCATTTCCGGAGGCAGGCCGG - Intergenic
903684871 1:25123639-25123661 CTGCTTATCCACAGGGAGGAGGG - Intergenic
903714373 1:25353180-25353202 CTTCTTATCCAGAGCCTGGAAGG + Intronic
904489460 1:30849532-30849554 CTGCTGTTCGAGAGGCAGGAAGG - Intergenic
904617865 1:31759746-31759768 CTGGCTATACACAGGCAGGAGGG - Intronic
904622010 1:31781424-31781446 CTGCACGTCCAGAGGAGGGAGGG + Intergenic
904698710 1:32345632-32345654 CTGCCTGTGCAAAGGCAGGAAGG - Intergenic
905470791 1:38190230-38190252 CTGACTATGCAGATGCAGGAAGG - Intergenic
905863579 1:41365332-41365354 CTGCATTCCCAAAGGCAGGGAGG + Intronic
905900573 1:41579776-41579798 CTCCGCATCCTGAGGCAGGAAGG - Exonic
906817384 1:48893000-48893022 CTGCATATACACAGACAGAAAGG + Intronic
907277300 1:53323946-53323968 CTGAATACCAAGAGGCTGGAAGG - Intronic
907454929 1:54569381-54569403 CTGCAAATCCAAAGGCTGGCTGG - Intronic
907814822 1:57908262-57908284 CATCATAGCCAAAGGCAGGAGGG - Intronic
908313974 1:62914695-62914717 CAGCAAGTCCTGAGGCAGGATGG + Intergenic
908496053 1:64696075-64696097 GTGGAAATCCAGAGGTAGGATGG - Intergenic
910126859 1:83852029-83852051 TTCCATATCAAGAGGCAGCATGG + Intergenic
911829016 1:102526510-102526532 ATGCATGTCCAGAGGAAGAATGG + Intergenic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
916005722 1:160658348-160658370 CTTCATATCTAGGGGCAAGAAGG + Intergenic
916189697 1:162166998-162167020 CAGAATACCCAGAGGCAGCAGGG - Intronic
916349917 1:163837374-163837396 TTCCATATTCAGAGACAGGAAGG + Intergenic
916839998 1:168590265-168590287 CTTCATAGCCAAAGGCAGGCGGG + Intergenic
918240801 1:182618389-182618411 TTGCATCTCCAGAGGCAGTGGGG + Intergenic
919649114 1:200128084-200128106 CTGCATATACTGAGGGATGACGG - Intronic
920173819 1:204087926-204087948 CTGCAGATCCACAGCCAGGTGGG - Intronic
920527988 1:206683007-206683029 CTGCCTTTTCAGAGGCAGCAAGG - Intronic
920859551 1:209694300-209694322 CTGCATCTCCAGAGTTAGTACGG - Intronic
921213754 1:212920633-212920655 CGGCTCATCCAGAGGAAGGATGG - Intergenic
922728241 1:227936046-227936068 CTGCATAACAAGATGCAGGAAGG - Intronic
923280836 1:232441617-232441639 CTGGGTCTCCAGATGCAGGAGGG - Intronic
924800900 1:247329282-247329304 CTGGATCTCCCGGGGCAGGATGG + Exonic
1063279195 10:4606874-4606896 CTTCATATCCAGAAGAAAGAGGG + Intergenic
1063910303 10:10822197-10822219 CTGCATCCCCAGAGCCTGGAAGG + Intergenic
1064024543 10:11836662-11836684 CTGTATATCCTGACACAGGAAGG + Intronic
1064262824 10:13799572-13799594 GGGCATTTTCAGAGGCAGGAAGG - Intronic
1064947478 10:20806972-20806994 CTGCATCTACAGAACCAGGAAGG + Intronic
1065969077 10:30791571-30791593 CTAGATGTCCAGAGGCAGGCAGG - Intergenic
1068006223 10:51394512-51394534 CTGGATTTTAAGAGGCAGGAGGG + Intronic
1069112668 10:64466050-64466072 CTGAATATTTAGAGGCAAGAAGG + Intergenic
1069755607 10:70772829-70772851 CTGTTTCTCCAGAGACAGGAGGG - Intronic
1070167519 10:73909920-73909942 CTGCTTATCCTCAGGCAGGAAGG + Intronic
1075777062 10:124995962-124995984 CTGCAGATCCAGGGCCTGGAGGG + Intronic
1076142711 10:128092635-128092657 CTGCATCTCCCGAGCCAGGGTGG + Intergenic
1076590344 10:131578213-131578235 CTGCAGAACAAGAGGAAGGATGG - Intergenic
1077526295 11:3067741-3067763 CTGTATACCCAGTGCCAGGAGGG + Intergenic
1078016062 11:7616063-7616085 CTGCATGACCAGTGTCAGGAAGG + Intronic
1079250455 11:18783221-18783243 CTGCTTATCATGAGGCAGGGAGG - Intronic
1081233887 11:40621638-40621660 CTGAATTTCAAGATGCAGGAGGG + Intronic
1081423820 11:42903241-42903263 CGACATATACAGAGGCATGATGG - Intergenic
1081779957 11:45703384-45703406 CAACATTTCCAGAGGCAGGTGGG + Intergenic
1084084729 11:66849794-66849816 CTGCAGATCCAGGGGAGGGAGGG + Exonic
1084480465 11:69416974-69416996 GGCCACATCCAGAGGCAGGAAGG + Intergenic
1085686723 11:78630091-78630113 ATGAATATCCAGGGGCAAGAAGG - Intergenic
1085880457 11:80462243-80462265 CAGCACACCCAGGGGCAGGAGGG + Intergenic
1086296521 11:85373636-85373658 CTGCAATTCAAGAGGCAGGCAGG + Intronic
1088425904 11:109702110-109702132 GTGTATATCCAGTGACAGGATGG - Intergenic
1088709216 11:112491635-112491657 CTGCATTTCCTGAAGCAGGGAGG + Intergenic
1089302466 11:117506970-117506992 CTGCATTTCTAGCGGGAGGAAGG - Intronic
1090514759 11:127412797-127412819 CTGCATCTGCACTGGCAGGACGG + Intergenic
1091230893 11:133987374-133987396 CTCCCTATCCAGGGGCCGGAGGG - Intergenic
1091961404 12:4698148-4698170 CGGCACATCCAGAGACAGCATGG - Intronic
1092092809 12:5817762-5817784 CTGCATTTCCAGTTGCTGGATGG - Intronic
1092139423 12:6172506-6172528 CTGAAGTTCCAGAGGGAGGAAGG + Intergenic
1093441615 12:19204109-19204131 CTCCATGTTAAGAGGCAGGAGGG + Intronic
1095454652 12:42370272-42370294 CTGCAAATGCTGAGGCAGGTAGG + Intronic
1096862882 12:54542591-54542613 CAGCATGTCCAGGGTCAGGAAGG - Exonic
1097247866 12:57616473-57616495 CTGTTTATCCAGTGGCAAGAGGG - Exonic
1100882221 12:99031617-99031639 CTGCATTCCCAGATGGAGGAAGG - Intronic
1101416478 12:104513037-104513059 CTGCATACCTAGACTCAGGAGGG - Intronic
1101805336 12:108058426-108058448 CTGCATAGCAGGAGGCAGGCAGG + Intergenic
1102416033 12:112763720-112763742 CTGAATTTCAAGAGGGAGGAGGG + Intronic
1102563742 12:113780982-113781004 GTGCATATGCAGGGGAAGGAAGG - Intergenic
1103041641 12:117700644-117700666 AAGCACATACAGAGGCAGGAAGG - Intronic
1104795048 12:131511473-131511495 CTGTCTATTCAGAGACAGGACGG - Intergenic
1106253072 13:27998012-27998034 CTGCCTTTCCAGGGGCAGGCAGG + Intergenic
1106462224 13:29981169-29981191 CTGCAGCTGCAGAGGCTGGATGG - Intergenic
1106529763 13:30578816-30578838 CTGCATATGCAAAGTCAGGGAGG - Intronic
1107277259 13:38690517-38690539 CTGGCTATCAACAGGCAGGATGG - Exonic
1109252672 13:60039236-60039258 TTACATATCCAGAGCCAAGAGGG + Intronic
1109983215 13:69938548-69938570 CTCCATATCCAGAGGGATAATGG - Intronic
1112560675 13:100510925-100510947 CTGCACCTCCAAAGGAAGGACGG + Intronic
1113591723 13:111506228-111506250 CTCCAGATGCAAAGGCAGGAGGG - Intergenic
1118690376 14:68333089-68333111 CAGTATATGCAGAGGCAGAAAGG - Intronic
1118857134 14:69632367-69632389 CTGCATTTACTGAGGGAGGAGGG - Intronic
1119290663 14:73492318-73492340 CTGCACTGCCAGAGGCAGTATGG - Exonic
1119858739 14:77921597-77921619 CAGCATAGACAGAGACAGGAGGG - Intronic
1121031489 14:90662219-90662241 CTGCAGATTCAGAGGCTGGCAGG - Intronic
1121520076 14:94580135-94580157 CTGGGTATCCAGAAGCAGGCAGG - Intronic
1122147452 14:99700130-99700152 CTGCCTGGCCAGAGGCAGTAGGG + Intronic
1122782538 14:104149738-104149760 CTGCACAGCAGGAGGCAGGAAGG - Intronic
1122836085 14:104431784-104431806 CTGCAGCTCCAGAAGCAGGAGGG + Intergenic
1122925272 14:104896453-104896475 CTTCATGTCCAGGGGCAGGCGGG - Exonic
1123112625 14:105880343-105880365 CTGCATCCCCAGAGCCGGGATGG + Intergenic
1123882848 15:24691462-24691484 CTTCATATCCAGTGGTAAGAAGG - Intergenic
1124046688 15:26156916-26156938 CTTCATATCCAGAGCAGGGATGG - Intergenic
1125678850 15:41517972-41517994 CTCCATCTTCAGAGGAAGGAAGG - Intronic
1126350878 15:47743711-47743733 CAGCACATCCAAAGGCAGAAAGG + Intronic
1126773775 15:52082377-52082399 CTGGATATGCAGCGGCAGAAAGG - Intergenic
1127507381 15:59610290-59610312 CTGCTTATTCACAGGAAGGAAGG - Intronic
1128563621 15:68684630-68684652 CTGCATATGCAGGGGCGGGAGGG - Intronic
1129771676 15:78206886-78206908 CTGCAATTCAAGGGGCAGGAAGG - Intronic
1129951838 15:79598948-79598970 CTGCATTTTGAGAGACAGGAAGG + Intergenic
1129976539 15:79826952-79826974 CTGTATATATAGTGGCAGGAAGG - Intergenic
1130067709 15:80618493-80618515 CTGCATGGTCAGAGGCACGAAGG - Intergenic
1131657570 15:94477482-94477504 CTATAAATCCAGAGGAAGGAGGG + Intronic
1133076445 16:3284090-3284112 CTGGATCTCCTGGGGCAGGATGG - Exonic
1133090793 16:3402291-3402313 CTGGATCTCCGGGGGCAGGATGG - Exonic
1133234281 16:4380570-4380592 CTACCTAGGCAGAGGCAGGAGGG + Intronic
1135673486 16:24394425-24394447 CTGCATATTCAGCAGCAGCAGGG - Intergenic
1137845000 16:51678370-51678392 ATGGATAATCAGAGGCAGGAGGG - Intergenic
1138295510 16:55881873-55881895 CTGCATAACCAGAGGTAAGGTGG + Intronic
1138347100 16:56326746-56326768 CTCCATGGGCAGAGGCAGGAGGG + Intronic
1139491485 16:67288409-67288431 GGGCCTAGCCAGAGGCAGGAGGG + Intronic
1139912641 16:70407609-70407631 CTGCATCTCCTGAGGATGGAAGG - Intronic
1141454826 16:84134195-84134217 CAGCATATCCAGCAGCAGGAGGG - Intronic
1141712991 16:85710710-85710732 CAGCATATGCAAAGGCACGAAGG - Intronic
1141879464 16:86848146-86848168 CTCCAGATTCAGAGGCAGGCAGG - Intergenic
1142368778 16:89666123-89666145 CTGGAAAACCAGAGGCATGAGGG + Intronic
1142867520 17:2799760-2799782 CTCCCTCTCCAGAGGCAGAAAGG - Intronic
1142954648 17:3513384-3513406 CTGGATATCCTGGGGGAGGAGGG - Exonic
1143563482 17:7708484-7708506 GTGCCTAACCAGAGGCATGAAGG + Exonic
1143857504 17:9863096-9863118 CTGCAGGTCCAGTGACAGGAGGG - Intronic
1144106691 17:11992536-11992558 CTGGATCTCCCCAGGCAGGATGG + Exonic
1146369614 17:32257269-32257291 CTGCATGTACTAAGGCAGGAAGG - Intergenic
1147399959 17:40174769-40174791 CTGCCCACCCAGAGGCAGGCTGG - Intergenic
1147440701 17:40445576-40445598 CTCCCTACCCAGGGGCAGGAAGG - Intronic
1147988965 17:44321885-44321907 CTGCATGTGTAGAGGCAGGGAGG - Intronic
1148798262 17:50207899-50207921 CCACATATGCAAAGGCAGGAGGG + Intergenic
1149085530 17:52710649-52710671 CTGCCTATAGAGAGGCAGGTGGG + Intergenic
1149143833 17:53466034-53466056 ATGCATAAACAGAGGAAGGAAGG + Intergenic
1150941249 17:69696934-69696956 CTCAATATCCAGAGGCAGAAAGG - Intergenic
1151732422 17:75919455-75919477 CTGCTCTTACAGAGGCAGGAGGG - Intronic
1151966535 17:77434467-77434489 CTGCAGACTCAGAGGCAGTACGG - Intronic
1152451259 17:80381924-80381946 CTGCTTGCCCAGAGGCTGGAAGG + Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153750663 18:8226907-8226929 CCTCATCTCCAAAGGCAGGAAGG + Intronic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1158391416 18:57048529-57048551 CTGCCTATGCTGATGCAGGAAGG + Intergenic
1159580997 18:70234697-70234719 GAAAATATCCAGAGGCAGGATGG - Intergenic
1159583423 18:70260749-70260771 CTGCAGGTCCACAGGCAGGAAGG + Intergenic
1160326304 18:77952225-77952247 CTCCATATACAGAGGCTGGTGGG - Intergenic
1160722143 19:602441-602463 CTGCATTTCCAGAGGAAGTGGGG - Intronic
1160747148 19:717344-717366 CTGCCGATCCAGAGACAGGAAGG - Intronic
1160855065 19:1213466-1213488 AGGCCAATCCAGAGGCAGGAAGG - Intronic
1161296294 19:3522245-3522267 ATGCACAGCCCGAGGCAGGAAGG - Intronic
1161667995 19:5588671-5588693 CGGCAAATCCAGAGCCAGAAAGG + Intronic
1161711432 19:5850828-5850850 CTCCAGAGCCTGAGGCAGGAGGG + Intronic
1161776370 19:6264404-6264426 CTGCCTATCCACAGGCCTGAAGG - Intronic
1162230612 19:9262836-9262858 CTGCATGTCCAGGAGCAGTATGG - Intergenic
1162490662 19:10989426-10989448 CTGAACTTCCAGAGGCAGGTGGG + Exonic
1164629924 19:29755249-29755271 CTCCACAGGCAGAGGCAGGAGGG + Intergenic
1165386558 19:35513591-35513613 CTGCAGACCCAGAGGGAGGGAGG - Exonic
1165474613 19:36023354-36023376 ATGGAGACCCAGAGGCAGGAAGG - Intronic
1167305775 19:48708503-48708525 CTGGTTTTCCTGAGGCAGGAGGG + Intergenic
1168254839 19:55159642-55159664 CTCCAAATCCGGAGGGAGGATGG + Intronic
925132237 2:1502202-1502224 CTGCATAACGGGATGCAGGAGGG + Intronic
925260444 2:2524168-2524190 CTGCAGAGCCAGGGCCAGGAGGG - Intergenic
925568711 2:5285862-5285884 TTGCAAATCCTGAGGCAGGAGGG + Intergenic
927715913 2:25352734-25352756 CTGCTTCTCCAGAGGGAAGAGGG + Intergenic
928194139 2:29202156-29202178 GTGAACAGCCAGAGGCAGGAAGG - Intronic
929312850 2:40445698-40445720 CTGCATGTCCAGGGGAAGAAAGG + Intronic
930003176 2:46874958-46874980 CTGGATAAACTGAGGCAGGAAGG + Intergenic
930599146 2:53423885-53423907 CTGCAGCTCCAGTGGCAGTAGGG + Intergenic
930981625 2:57532635-57532657 CAGCATATCCTCAGGCAGAAAGG - Intergenic
932021564 2:68092850-68092872 CAGCAAATCCAGAGGCACGGAGG - Intronic
932432259 2:71683098-71683120 TTGCAAATCCAGAGGAAGGGAGG + Intronic
932881480 2:75506150-75506172 CTAAATATCCAAAGGCAGGAAGG - Intronic
935717377 2:105951141-105951163 CTACAGATTCAGAGGCAGCAGGG + Intergenic
937904528 2:127046391-127046413 CTGCGGATCCAGAGGGAGGGAGG - Intergenic
940827220 2:158426430-158426452 TTGCATATTCAGATGTAGGAAGG + Intronic
946082146 2:217130351-217130373 CTCCATTTCCAGAGGACGGAGGG + Intergenic
946508621 2:220329387-220329409 CTGGATATCTATAGGCAGAATGG - Intergenic
947580627 2:231314859-231314881 CTGGATATTCATATGCAGGAGGG - Intronic
1169332765 20:4729744-4729766 ATGCATTCCCAGAGGCATGAGGG - Intergenic
1172462624 20:35131661-35131683 CTTCTTATCCTGAAGCAGGATGG + Exonic
1173495079 20:43513047-43513069 CTGAATCCCCAGAGGGAGGAGGG + Intronic
1176075271 20:63245440-63245462 CTGCAGGTCCCCAGGCAGGAGGG - Intronic
1176914191 21:14605085-14605107 CTTCAAATACAGAGGCAGCAAGG + Intronic
1179923088 21:44517763-44517785 CTGGATATCAGGAGGTAGGAGGG - Exonic
1180161981 21:46002195-46002217 CTGCATAGCAAAGGGCAGGAAGG - Intronic
1180926120 22:19556165-19556187 CTGCAGGGCCAGAGGCAAGATGG - Intergenic
1181612815 22:24030238-24030260 GTGCATGTCCAGGGGCAGGCAGG + Intronic
1184168307 22:42743551-42743573 CTTCAGAGCCTGAGGCAGGAAGG + Intergenic
949733313 3:7140706-7140728 CTGGATATCCTGAGGAAGTACGG + Intronic
950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG + Intergenic
950501016 3:13363883-13363905 CTGATAATCCAGAGCCAGGAGGG + Intronic
953506512 3:43490993-43491015 ATGCATATTAAGAGGCAGAATGG + Intronic
953880941 3:46691000-46691022 CTGCAGAGAGAGAGGCAGGAAGG + Intronic
957189638 3:76990784-76990806 ATGCATATCAAGAGGCAAAACGG + Intronic
959298588 3:104570815-104570837 CTGCATATCCAATGACAGGTGGG - Intergenic
959324112 3:104914188-104914210 CTGAATAAGCAGAGGCAAGAAGG + Intergenic
961106074 3:124242752-124242774 CTGCATATCCACAGCCACCATGG - Intronic
961166199 3:124765531-124765553 CTGCACAGCCAAAGGCAGCAAGG - Intronic
961798298 3:129425467-129425489 CTGAAAACCCAGAGCCAGGAAGG - Intronic
964384667 3:156134930-156134952 TGGCATTTCAAGAGGCAGGATGG + Intronic
965440666 3:168709436-168709458 CTGCCCATGTAGAGGCAGGAAGG + Intergenic
965579105 3:170248002-170248024 CTGCATATCCAGAGGCAGGATGG + Intronic
965624092 3:170669854-170669876 TTGCAGATCCAGAGGCAGCATGG - Intronic
967283864 3:187849921-187849943 GAGCATATTCAAAGGCAGGAAGG - Intergenic
968576281 4:1367716-1367738 CTGCTTCTCCAGGGGCAGGCAGG + Intronic
968653579 4:1769392-1769414 CTGCCTTTCCAGAGGCAAGGGGG - Intergenic
972339887 4:38142961-38142983 CTGGATATGGAGAGGCAGGCAGG - Intergenic
974098606 4:57392591-57392613 CTGCATATTAAGAGGCAAAATGG + Intergenic
974593844 4:63991133-63991155 CTGGAGATCCAGAGGAGGGAGGG + Intergenic
977773520 4:100889302-100889324 CTGAAAATCCTGAGGCTGGAAGG + Intergenic
979495139 4:121374972-121374994 CGGCACAGCCAGAGGGAGGATGG - Intronic
982418439 4:155164778-155164800 CTGCATTTCCAGGAGCAGAATGG + Intergenic
985509549 5:305081-305103 CTGCAGCTCCAGGGGCAGGCAGG + Intronic
985738726 5:1601810-1601832 CTGCAGCTCCAGGGGCAGGCAGG - Intergenic
986220643 5:5765845-5765867 CTGCATACCCAGACTCACGAAGG - Intergenic
986503489 5:8426074-8426096 CTACATCCCCAGTGGCAGGAGGG + Intergenic
986801942 5:11269780-11269802 CTGCATATTCTGAGGGGGGAGGG - Intronic
987188912 5:15453042-15453064 CAGCATATCCATAGACAGGGTGG + Intergenic
990682257 5:58258189-58258211 CTGCATTTACTGAGGCAGGGTGG + Intergenic
995808988 5:116084382-116084404 CTGCAGATGCAGATACAGGAGGG + Intergenic
999122001 5:149216945-149216967 TTTCATTTCCATAGGCAGGAGGG + Exonic
1001708134 5:173756856-173756878 CTGCATTACCAGAGTCAGGTGGG - Intergenic
1001804448 5:174571241-174571263 CTGCAAATCCTGAGGCAAGAAGG - Intergenic
1001956408 5:175850930-175850952 CTGAGGAACCAGAGGCAGGAGGG + Intronic
1002917426 6:1540587-1540609 CTGCATACCCAGGGGCAGGGTGG - Intergenic
1003136167 6:3436121-3436143 CTGGAAGTCCAGAGACAGGACGG - Intronic
1003665926 6:8111348-8111370 CTGCACAGCCAAATGCAGGAAGG - Intergenic
1004254541 6:14050826-14050848 CTCCAAATCCAGAGGCATGATGG + Intergenic
1004469231 6:15914154-15914176 GTGCATACCCAGAAGCAGAATGG - Intergenic
1007403061 6:41615586-41615608 CAGCTAATCCAGAGGGAGGAGGG + Intergenic
1007836320 6:44676691-44676713 CTGAGTCTGCAGAGGCAGGAGGG + Intergenic
1008555218 6:52666907-52666929 CTACCTCTCCAGAGGCAGGAGGG - Intergenic
1009562368 6:65263791-65263813 CTTGATAGGCAGAGGCAGGACGG + Intronic
1013088395 6:106876067-106876089 CTGCATCTCCTGAGGCTGCACGG + Intergenic
1013811962 6:114054939-114054961 CTTCAAATTCAGGGGCAGGAGGG - Intergenic
1015431098 6:133131157-133131179 TTGCACACCCAGTGGCAGGAAGG - Intergenic
1016852505 6:148635531-148635553 GTGCTGACCCAGAGGCAGGAAGG + Intergenic
1021825591 7:24547560-24547582 AGGCAAATCCTGAGGCAGGAAGG + Intergenic
1023567407 7:41537283-41537305 CTGAATTTCCATAGGCAAGAGGG - Intergenic
1025638858 7:63349284-63349306 CTGCAGATCCTGAGGAAGGAGGG - Intergenic
1025643841 7:63398808-63398830 CTGCAGATCCTGAGGAAGGAGGG + Intergenic
1025713437 7:63931837-63931859 CTGCAAATCCTGAGAAAGGAAGG + Intergenic
1026931167 7:74223790-74223812 CTGCCCAGCCAGAGGCAGGCTGG + Intronic
1028560573 7:92170365-92170387 CTAAATATCCAGATACAGGAAGG + Intronic
1028667574 7:93364298-93364320 CTGCATGTCTAGGGGCAGGGTGG - Intergenic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030523125 7:110622562-110622584 CTGCAAGTCCAGAGGCAGTATGG + Intergenic
1032306816 7:130741796-130741818 CTGCCTTTACAGAGGGAGGAAGG - Intergenic
1033180840 7:139176309-139176331 CTGGATATCCATATGCAGTATGG + Intronic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1034256551 7:149727867-149727889 CTGAATGTCCACAGGCTGGAAGG - Intronic
1036650100 8:10636694-10636716 CTGCTAATCCAGCTGCAGGAGGG + Intronic
1037185413 8:16057059-16057081 AGGAATATCCAGAGGCAAGAGGG + Intergenic
1037670806 8:21013610-21013632 CACCTTATCCAGAGGAAGGAGGG - Intergenic
1037751193 8:21683448-21683470 CTTCATATCAAGATGCAGGAGGG + Intergenic
1037819611 8:22129349-22129371 CTGCATGTGGAGAGGCAGCATGG - Intronic
1038907779 8:31926338-31926360 CTGCTTATTCACAAGCAGGATGG - Intronic
1038976345 8:32700930-32700952 TTGAAGACCCAGAGGCAGGAGGG - Intronic
1039220084 8:35320718-35320740 CTGGACATCCAAAGGGAGGAGGG + Intronic
1039311883 8:36325224-36325246 TTGGATACACAGAGGCAGGATGG - Intergenic
1041207756 8:55515526-55515548 ATGAATATCCAGAGCCAGAATGG - Intronic
1041974795 8:63785209-63785231 CTGCATTTGGTGAGGCAGGAGGG + Intergenic
1043385696 8:79745617-79745639 CTGCATCTCCTGAGAAAGGAGGG + Intergenic
1044362952 8:91309967-91309989 ATGCATATTCAGAGGCAAAATGG - Intronic
1044571985 8:93730232-93730254 CTGCAAAAACAGAGGCAGCAAGG + Exonic
1047192812 8:122693676-122693698 CTGAACATAGAGAGGCAGGAAGG + Intergenic
1047351341 8:124077740-124077762 CTGCAATGTCAGAGGCAGGAGGG - Intronic
1047377649 8:124317808-124317830 CTGCATCTTCAGAGCCAGCAAGG - Intronic
1048316619 8:133367833-133367855 CTGGATTTCAAGAGGGAGGAAGG + Intergenic
1049741378 8:144242697-144242719 CTTCATAGGCAGAGGCCGGAGGG + Intronic
1051983570 9:23054848-23054870 CTGGATATCCAGATGCAAAAAGG + Intergenic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1056256143 9:84801285-84801307 CTGCCTAACCAGCGGCAGGTGGG + Intronic
1057479290 9:95431991-95432013 CTAGAAATTCAGAGGCAGGAAGG - Intergenic
1058518448 9:105797793-105797815 CTTAATATCCAGAGGCATAAAGG - Intergenic
1058899530 9:109430334-109430356 CTTCATATACAGGGGTAGGAGGG + Intronic
1059623063 9:116030088-116030110 CATCATATGCAAAGGCAGGAAGG - Intergenic
1060236991 9:121871560-121871582 GGGCAAAGCCAGAGGCAGGAGGG - Intronic
1061626131 9:131841779-131841801 GTGAAAAGCCAGAGGCAGGAGGG + Intergenic
1062034141 9:134375358-134375380 CTGCAATTCTGGAGGCAGGAAGG - Intronic
1188269163 X:28117232-28117254 CTGAAAATCCAGAGCCTGGAAGG - Intergenic
1188614672 X:32142993-32143015 ATGCAAATCCAGAGATAGGATGG - Intronic
1190533659 X:51406379-51406401 CTGAACATCCGGAGGCAAGACGG + Intergenic
1191638518 X:63404344-63404366 CTGCATATGCACTGGGAGGATGG - Intergenic
1192033479 X:67539873-67539895 CAGAATATGCAAAGGCAGGAAGG + Intergenic
1192214650 X:69150135-69150157 CTGCAGCTCCGGGGGCAGGAAGG + Intergenic
1195016363 X:100785588-100785610 CTGCATATGCAGAAGCAGACAGG - Intergenic
1199465403 X:148129933-148129955 CTAAATATCCAGAGGAAGGGAGG + Intergenic
1200247891 X:154535554-154535576 CTGCACATCCAGAGGGAGGGAGG + Intronic
1201349669 Y:13025849-13025871 CTGGAGTTCCAGAGGAAGGAAGG - Intergenic