ID: 965596887

View in Genome Browser
Species Human (GRCh38)
Location 3:170419185-170419207
Sequence CAGCTCATCCAGCTTGCGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 130}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965596887_965596897 11 Left 965596887 3:170419185-170419207 CCTGCCGCAAGCTGGATGAGCTG 0: 1
1: 0
2: 2
3: 17
4: 130
Right 965596897 3:170419219-170419241 GCTGTGGGCCGACTGCGTCATGG 0: 1
1: 0
2: 0
3: 4
4: 55
965596887_965596894 -5 Left 965596887 3:170419185-170419207 CCTGCCGCAAGCTGGATGAGCTG 0: 1
1: 0
2: 2
3: 17
4: 130
Right 965596894 3:170419203-170419225 AGCTGGGCTCCAAGGGGCTGTGG 0: 1
1: 0
2: 5
3: 70
4: 527
965596887_965596898 17 Left 965596887 3:170419185-170419207 CCTGCCGCAAGCTGGATGAGCTG 0: 1
1: 0
2: 2
3: 17
4: 130
Right 965596898 3:170419225-170419247 GGCCGACTGCGTCATGGCCACGG 0: 1
1: 0
2: 0
3: 4
4: 74
965596887_965596899 18 Left 965596887 3:170419185-170419207 CCTGCCGCAAGCTGGATGAGCTG 0: 1
1: 0
2: 2
3: 17
4: 130
Right 965596899 3:170419226-170419248 GCCGACTGCGTCATGGCCACGGG 0: 1
1: 0
2: 1
3: 2
4: 44
965596887_965596895 -4 Left 965596887 3:170419185-170419207 CCTGCCGCAAGCTGGATGAGCTG 0: 1
1: 0
2: 2
3: 17
4: 130
Right 965596895 3:170419204-170419226 GCTGGGCTCCAAGGGGCTGTGGG 0: 1
1: 0
2: 3
3: 30
4: 342
965596887_965596901 19 Left 965596887 3:170419185-170419207 CCTGCCGCAAGCTGGATGAGCTG 0: 1
1: 0
2: 2
3: 17
4: 130
Right 965596901 3:170419227-170419249 CCGACTGCGTCATGGCCACGGGG 0: 1
1: 0
2: 0
3: 3
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965596887 Original CRISPR CAGCTCATCCAGCTTGCGGC AGG (reversed) Exonic
912557258 1:110525177-110525199 CCCCTCATCCAGCCTGAGGCAGG + Intergenic
915456035 1:156041501-156041523 CAGATGATCCAGCTTTTGGCTGG - Exonic
915527851 1:156487184-156487206 CAGCTCCCCCAGCATGAGGCGGG - Intronic
915832133 1:159140961-159140983 AAGCTCATCCAGCTTGCTGCTGG + Intronic
918728233 1:187953653-187953675 CTGGTCATCCAGCTTGCAGACGG - Intergenic
919926163 1:202192964-202192986 CAGCTCAGCCACCCTGAGGCTGG - Intergenic
920085241 1:203410807-203410829 CAGTTGAACCAGCTTGGGGCTGG + Intergenic
920203784 1:204276917-204276939 CAGCTCATCCTGCTTGGATCCGG - Intronic
922346889 1:224703822-224703844 CAGCTCATTCAGCCCGCAGCAGG + Intronic
924918011 1:248593759-248593781 CCGATCATACAGCATGCGGCTGG - Exonic
1067162621 10:43840211-43840233 CAGCTCAATCAGGTTGGGGCTGG - Intergenic
1067281782 10:44878899-44878921 CAGCTCAGCCAGGCTGAGGCAGG - Intergenic
1069600995 10:69708042-69708064 CAGCTCCTCCAACTTGCAGGTGG + Intergenic
1069627084 10:69875010-69875032 CAGCTAACCCAGTTTGCAGCGGG - Intronic
1069724404 10:70567869-70567891 CAGCTCTTCCAGCTGGGGACTGG + Exonic
1070090661 10:73282084-73282106 CAACTCATCCATATTGAGGCTGG + Intronic
1070594221 10:77821166-77821188 CAGCTCATCCACCTTCTGGGAGG + Exonic
1072132311 10:92507235-92507257 GAGCTCATGCAGCTTCAGGCAGG + Intronic
1075221577 10:120589454-120589476 CAGCGCACCCAGCTTGCCTCTGG + Exonic
1077739844 11:4833619-4833641 CAGCTCAACAGGCTTGCAGCAGG - Intronic
1077843733 11:6002376-6002398 CAGCTCTACCAGTTTGTGGCAGG - Exonic
1079493947 11:21019760-21019782 CAGCTCATCCTGCTTGGCCCTGG - Intronic
1081568509 11:44275438-44275460 CAGCTCCTCCAGCTGGTAGCTGG + Exonic
1081829143 11:46091755-46091777 CAAGTCATCCAGCTTGAAGCTGG - Intronic
1083664113 11:64265433-64265455 CAGGCCATCCAGCAGGCGGCGGG - Exonic
1083671239 11:64300871-64300893 CAGTTCCTCCGGCTTGTGGCTGG - Exonic
1083906066 11:65671623-65671645 CAGGTCTTCCAGCTTGCAGATGG + Intergenic
1083950639 11:65953713-65953735 CAGCTCCTCCAGCTTGCGCTGGG - Exonic
1092366502 12:7881249-7881271 CAGCTCCCTCAGCTTGCGGGAGG + Intronic
1096532779 12:52252395-52252417 CAGCTCGGCCAGCTTGCAGCGGG + Intronic
1096537935 12:52287236-52287258 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096540836 12:52306124-52306146 CAGCTCGGCCAACTTGCAGCGGG - Exonic
1096542534 12:52316027-52316049 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096547411 12:52350177-52350199 CAGCTCAGCCAGCTTGCAGTGGG - Intergenic
1096549400 12:52362385-52362407 CAGCTCAGCCAGCTTGCAGCGGG + Exonic
1096574868 12:52546420-52546442 CAGCTCGTCCAGCTTGGCCCGGG + Exonic
1096578273 12:52568303-52568325 CAGCTCATCCAGCTTGGCCTGGG + Exonic
1096581389 12:52587765-52587787 CAGCTCATCCAGCTTGGCCCGGG + Exonic
1096584440 12:52610749-52610771 CAGCTCATCCAGCTTGGCCCTGG + Exonic
1096786400 12:54019357-54019379 CCGCGGATCCAGCCTGCGGCAGG + Intronic
1101119195 12:101561729-101561751 CTGCTCATCAAGCTTGTGGCTGG + Intergenic
1102950681 12:117028681-117028703 CAGCTCTACCAGCTTGCTACTGG - Intronic
1104225410 12:126827916-126827938 CAGCTCATTCGGCTTGCTGTGGG - Intergenic
1109925047 13:69126408-69126430 CAGCTCAGGCAGCTTCAGGCTGG + Intergenic
1110577118 13:77070307-77070329 AAGCTCATCCAACCTGCAGCCGG + Intronic
1113321131 13:109233412-109233434 CAGCTCCACCAGCTTCTGGCAGG - Intergenic
1113606644 13:111612606-111612628 CAGCTCATCGAGTTTCTGGCGGG + Intronic
1119211485 14:72835558-72835580 CAGTTTCTCCAGCTTGCAGCAGG + Intronic
1202922115 14_KI270723v1_random:35770-35792 GAGCTCATCCAGCTGCAGGCTGG - Intergenic
1202922814 14_KI270724v1_random:1843-1865 GAGCTCATCCAGCTGCAGGCTGG + Intergenic
1124090927 15:26599293-26599315 CAGCTCCTCCAGCTTGAGCTGGG + Intronic
1125501199 15:40241184-40241206 CAGGTCATCCACCCTGCAGCAGG - Intronic
1125729218 15:41883351-41883373 CAGCTCCTCCAGCTGGTGGGAGG + Exonic
1132865257 16:2090048-2090070 CAGCCCATCCAGCTGGCTGGAGG + Exonic
1132940535 16:2505032-2505054 CAGCTCATCCAGATTCTTGCTGG + Intronic
1135557999 16:23453156-23453178 CAGCGCACTCAGTTTGCGGCTGG + Exonic
1137697103 16:50468696-50468718 CATCACATCCGGCATGCGGCAGG - Intergenic
1139243663 16:65419835-65419857 CAACTCATCCAGCTTGGGTTGGG + Intergenic
1139576644 16:67846556-67846578 CAGCTGGGCCAGCTTGGGGCCGG + Intronic
1141276380 16:82592330-82592352 CAGCTCATCAAACTTGCACCAGG + Intergenic
1141675028 16:85513323-85513345 CAGCTCAGCCACTTTGCAGCTGG + Intergenic
1141917378 16:87108752-87108774 CAGCCCAGCCAGCTTGCTGCAGG + Intronic
1143723058 17:8827172-8827194 CATCTCAGCCAGCTTGTGGATGG + Exonic
1143730828 17:8881789-8881811 CAGCTCCTCCTGCTTCCGGCAGG + Exonic
1147577255 17:41609949-41609971 GAGCTCATCCAGCTTCAGCCAGG - Exonic
1147597173 17:41724720-41724742 CAGCTTGTCCGGCTGGCGGCAGG + Exonic
1148114870 17:45169682-45169704 CAGCTCCTCCACCTGGCGGCAGG - Exonic
1148957680 17:51367001-51367023 CATCTCACCCAGGTTGTGGCTGG - Intergenic
1151690143 17:75678922-75678944 CAGCTCAACCCACTTGTGGCCGG - Intronic
1151866380 17:76806099-76806121 CAGCTCCCTCAGCTTGCGGGAGG + Intergenic
1152011544 17:77721897-77721919 CAGTGCCTCCAGCTTGGGGCTGG - Intergenic
1152199620 17:78937770-78937792 CAGGTCACCCAGCTGGCGGTAGG - Intergenic
1157538098 18:48475891-48475913 CTGCTCATCCACCCTGCAGCTGG - Intergenic
1160946693 19:1647072-1647094 CAGCCCCTCCAGCTTCCTGCCGG - Intronic
1161076866 19:2290052-2290074 CGGCCCATCCACCTTGCGGAAGG + Exonic
1161154782 19:2726974-2726996 CAGCTCATCTAGCCTGAGTCTGG + Intronic
1164478765 19:28595335-28595357 CAGATCTTACAGCTTGGGGCTGG + Intergenic
1165143762 19:33718785-33718807 CAGCTCAGCCAGCATGAGGCTGG + Intronic
1166391338 19:42410490-42410512 CAGCTCGGCCAGGTTGTGGCTGG + Exonic
1166523858 19:43498958-43498980 CAGCTCGTCCAGCTCACGGGGGG + Intronic
1166863863 19:45824647-45824669 CTGCTCTTCCAGTTTGCAGCAGG - Intronic
924982699 2:237468-237490 CAGCTCCTCCAGATTCCTGCAGG - Intronic
926303918 2:11623775-11623797 CAGCTACTCCAGCCTGAGGCAGG + Intronic
927677297 2:25115384-25115406 CAGCTCAACCCGCTTGCGACAGG - Intronic
937222962 2:120352690-120352712 CAGCACAGCCAGCTGGTGGCAGG + Intergenic
942192419 2:173483282-173483304 CAGCTGATCTAGCCTGAGGCTGG + Intergenic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
948501938 2:238401686-238401708 CTGCTCATCCTGCTTGCTGCTGG - Intergenic
948994982 2:241573455-241573477 CAGCTCTTCCAGCTTCAGCCAGG - Exonic
1173863078 20:46297037-46297059 CAACTCAGCCAGCTTCAGGCTGG - Intronic
1175561386 20:59933556-59933578 CTGCTCAACCTGCCTGCGGCAGG + Exonic
1175671023 20:60902969-60902991 CAGCTCATCCTCCATGCAGCTGG + Intergenic
1175671039 20:60903056-60903078 CAGCTCATCCTCCATGCAGCTGG + Intergenic
1175671054 20:60903143-60903165 CAGCTCATCCTCCATGCAGCTGG + Intergenic
1176013987 20:62919050-62919072 AAGCTCCACCAGCTTGCGGCAGG + Intronic
1179576355 21:42310720-42310742 CTGGTCATCCAGCTGGTGGCAGG + Intergenic
1181029590 22:20143376-20143398 CAGCTCCTACAGCCTGCAGCAGG + Exonic
1181513664 22:23399942-23399964 CAGCTCCTACAGCCTGCAGCAGG - Intergenic
1183186848 22:36296778-36296800 CAGCCCTTCCTGCTTGCTGCTGG - Intronic
1184341627 22:43889410-43889432 CAGCTCATGCAGGTTGGGGGAGG + Exonic
953828244 3:46272692-46272714 CAGCTCACCCAGCTGGCTGAGGG - Intergenic
957217986 3:77346648-77346670 TAGCTCATCCAGGTTGTTGCAGG + Intronic
957966175 3:87324309-87324331 CAGCTCATACAGCTTGGTGTTGG - Intergenic
958675456 3:97264434-97264456 TAGCTCCTCCAGCTGGCAGCAGG + Intronic
960059376 3:113304418-113304440 TAGCTCATCCAGTTTGGGTCAGG + Intronic
963732292 3:148986030-148986052 CAGATGATCCAGCTTTTGGCTGG - Intergenic
964351343 3:155806279-155806301 GAGCTCCTCCGGCTGGCGGCAGG + Intronic
965596887 3:170419185-170419207 CAGCTCATCCAGCTTGCGGCAGG - Exonic
965731006 3:171772658-171772680 CAGCTCATCCAGCTTTCGCTTGG - Intronic
966939273 3:184735179-184735201 CAGCCCAACCAGCTGGCGGATGG - Intergenic
969696421 4:8737677-8737699 CAGCTCTGCCTGCTGGCGGCTGG + Intergenic
970062175 4:12046935-12046957 CACCTCACCCATCTTGCAGCTGG - Intergenic
970613689 4:17747990-17748012 CAGCTCCTCCAGGCTGAGGCAGG + Intronic
977470747 4:97438475-97438497 CAGCTCCCTCAGCTTGCGGCAGG - Intronic
978761120 4:112357239-112357261 CAGATCATCCAGCATCTGGCAGG + Intronic
985686213 5:1283073-1283095 CAGCACATCCAGCTCACCGCAGG + Intronic
985686228 5:1283134-1283156 CAGCACATCCAGCTCACAGCAGG + Intronic
985686269 5:1283316-1283338 CAGCACATCCAGCTCACTGCAGG + Intronic
985686282 5:1283377-1283399 CAGCACATCCAGCTCACAGCAGG + Intronic
985686431 5:1283991-1284013 CAGCACATCCAGCTCACAGCAGG + Intronic
985686445 5:1284052-1284074 CAGCACATCCAGCTCACAGCAGG + Intronic
992564770 5:77986341-77986363 CAGCTTATCTTCCTTGCGGCAGG - Intergenic
993165128 5:84343508-84343530 CAGCTCATCCATATTTGGGCAGG + Intronic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
1006906743 6:37538014-37538036 CAGCTCATCCTGCATGCTACAGG - Intergenic
1011795439 6:90947496-90947518 CACCTCCTCCAGCCTGGGGCAGG - Intergenic
1017382713 6:153848709-153848731 CAGCTCCTCCTGCTTGCAGGGGG - Intergenic
1019090742 6:169530686-169530708 CAGCTCAGCCTTCTTGAGGCCGG + Intronic
1019473603 7:1233583-1233605 CAGCTCCTCCAGCTGCCAGCCGG - Exonic
1019489894 7:1307410-1307432 AAGCTCATCCCCCTTGCAGCAGG - Intergenic
1022482630 7:30753836-30753858 CAGCTCCTCCCGGTTGCGGTCGG - Exonic
1024443812 7:49453666-49453688 CAGCTCCCTCAGCTTGCGGGAGG + Intergenic
1027422096 7:78026730-78026752 CAGGGCATCCAGCTTCAGGCTGG + Intronic
1027778479 7:82494881-82494903 CAGATCATCAAGCTTTTGGCTGG + Intergenic
1029789438 7:102827193-102827215 CAGCTCAGCTAGCTTGCTGGAGG + Intronic
1030354883 7:108530960-108530982 CAGTTTATCCAGCTTCCTGCTGG + Intronic
1034410277 7:150937596-150937618 CATCCCATCCAGCCTGCAGCAGG + Intergenic
1034445964 7:151114621-151114643 CAACTCCTCCACCTCGCGGCCGG - Intronic
1035316855 7:158001937-158001959 CAGCTTGGCCAGCTTCCGGCTGG - Intronic
1039839033 8:41280468-41280490 CAGGGCATTCAGCTTGAGGCCGG - Intronic
1042146678 8:65736992-65737014 CACCTCATCCAGGCTGAGGCAGG - Intronic
1042469029 8:69161977-69161999 CAGCACATCCTGCTTGCCCCAGG + Intergenic
1043120593 8:76318137-76318159 CAGCTCATCCACATTACGGACGG - Intergenic
1044055542 8:87565679-87565701 CAGCTCTTCAAGCTTGAAGCTGG + Intronic
1049322302 8:142003024-142003046 CAGCTCAGCCAGCCTCCAGCAGG - Intergenic
1049724495 8:144139300-144139322 AAGCTCATCCAGGTTGGTGCAGG + Exonic
1053409202 9:37904628-37904650 AAGCTCAGACAGCTTGCGGGGGG + Intronic
1057834902 9:98436662-98436684 CAGCTCATTTAGCTTGCTGGGGG - Intronic
1059434330 9:114267108-114267130 CAGCTTAGCCAGCGTGAGGCGGG - Intronic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic