ID: 965598335

View in Genome Browser
Species Human (GRCh38)
Location 3:170430102-170430124
Sequence CAGCCCTAAACCTCAAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 821
Summary {0: 1, 1: 0, 2: 12, 3: 69, 4: 739}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965598335_965598338 27 Left 965598335 3:170430102-170430124 CCCACTTTTGAGGTTTAGGGCTG 0: 1
1: 0
2: 12
3: 69
4: 739
Right 965598338 3:170430152-170430174 AAATCTACAGTAGTTCTCTCTGG 0: 1
1: 0
2: 0
3: 12
4: 158
965598335_965598337 3 Left 965598335 3:170430102-170430124 CCCACTTTTGAGGTTTAGGGCTG 0: 1
1: 0
2: 12
3: 69
4: 739
Right 965598337 3:170430128-170430150 AAGTAGATTGTGTATTGCTACGG 0: 1
1: 0
2: 1
3: 19
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965598335 Original CRISPR CAGCCCTAAACCTCAAAAGT GGG (reversed) Intronic
900724907 1:4209778-4209800 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
901478783 1:9509560-9509582 AGTCCCCAAACCTCAAAAGTAGG - Intergenic
901833851 1:11910923-11910945 GGTCCCAAAACCTCAAAAGTAGG + Intergenic
901920441 1:12532503-12532525 AGTCCCCAAACCTCAAAAGTAGG + Intergenic
902179684 1:14678438-14678460 AGTCCCAAAACCTCAAAAGTAGG - Intronic
902868623 1:19298315-19298337 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
903315066 1:22496918-22496940 AGTCCCAAAACCTCAAAAGTAGG + Intronic
903538566 1:24083440-24083462 AGTCCCAAAACCTCAAAAGTAGG - Intronic
903868079 1:26412559-26412581 CAGTCCCAAACCTCCAAAGATGG - Intronic
905262298 1:36728429-36728451 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
905536099 1:38723040-38723062 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
906872718 1:49502231-49502253 AGTCCCAAAACCTCAAAAGTAGG - Intronic
907571897 1:55491517-55491539 AGTCCCCAAACCTCAAAAGTAGG + Intergenic
907864305 1:58384659-58384681 AGTCCCAAAACCTCAAAAGTAGG + Intronic
908326375 1:63027834-63027856 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
908346401 1:63237914-63237936 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
909100750 1:71344998-71345020 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
909190104 1:72540258-72540280 GGTCCCCAAACCTCAAAAGTAGG + Intergenic
909215261 1:72878512-72878534 AGTCCCCAAACCTCAAAAGTAGG - Intergenic
909877568 1:80828322-80828344 CTTCCCAAAACTTCAAAAGTAGG - Intergenic
909924168 1:81419062-81419084 CAGAACTAAAGCTCAAAAGTAGG + Intronic
910280328 1:85493441-85493463 CAGTACTAAACTTCAATAGTTGG - Intronic
910581809 1:88836536-88836558 AAACCCTAGACCTCAAAAGATGG - Intergenic
910725122 1:90329466-90329488 AGTCCCCAAACCTCAAAAGTAGG - Intergenic
911291881 1:96066202-96066224 GAGTCCCAAAGCTCAAAAGTAGG - Intergenic
911307415 1:96247692-96247714 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
911403702 1:97408972-97408994 AGTCCCAAAACCTCAAAAGTAGG - Intronic
911876963 1:103178655-103178677 CAGCCATAAAAATCAAAATTTGG - Intergenic
911970284 1:104426104-104426126 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
912119767 1:106455881-106455903 AGTCCCCAAACCTCAAAAGTAGG + Intergenic
912231876 1:107803279-107803301 CAGCCTTAAAAATGAAAAGTTGG - Intronic
914945589 1:152062719-152062741 AAGCCCTAAACCTCAGGATTTGG - Intergenic
915785142 1:158602799-158602821 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
917288518 1:173446845-173446867 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
918714868 1:187773085-187773107 GGTCCCAAAACCTCAAAAGTAGG + Intergenic
918814688 1:189167819-189167841 AGCCCCAAAACCTCAAAAGTAGG - Intergenic
918895474 1:190337675-190337697 AGTCCCAAAACCTCAAAAGTAGG - Intronic
919134681 1:193492800-193492822 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
919195687 1:194282550-194282572 CAGCCTTATACTTCTAAAGTTGG - Intergenic
919317900 1:195998699-195998721 CATCCCCAAACCTCAAAAGTAGG - Intergenic
921081658 1:211743655-211743677 CAGCCCTATTCCTCATGAGTTGG - Exonic
921940022 1:220829662-220829684 AGTCCCCAAACCTCAAAAGTAGG + Intergenic
922019034 1:221685308-221685330 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
922442876 1:225671016-225671038 AATCCCAAAACCTCAAAAGTAGG - Intergenic
922543258 1:226434858-226434880 GAGCACTAAACCTCAAGTGTGGG - Intergenic
922651378 1:227342023-227342045 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
923029787 1:230239400-230239422 AGTCCCAAAACCTCAAAAGTGGG + Intronic
923825384 1:237494223-237494245 AGTCCCAAAACCTCAAAAGTAGG + Intronic
923839546 1:237653715-237653737 AGTCCCAAAACCTCAAAAGTAGG + Intronic
923864423 1:237924105-237924127 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
923957593 1:239040414-239040436 GCGTCCAAAACCTCAAAAGTGGG - Intergenic
924306880 1:242698655-242698677 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1063175270 10:3544998-3545020 AATCTCAAAACCTCAAAAGTAGG + Intergenic
1063262916 10:4410372-4410394 AGTCCCAAAACCTCAAAAGTTGG - Intergenic
1063457788 10:6196474-6196496 GGTCCCAAAACCTCAAAAGTGGG + Intronic
1063525403 10:6779802-6779824 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1064020337 10:11804369-11804391 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1064329106 10:14377104-14377126 AGTCCCAAAACCTCAAAAGTAGG - Intronic
1064360887 10:14663175-14663197 AAACCCAAAATCTCAAAAGTAGG - Intronic
1064363686 10:14688272-14688294 AGTCCCAAAACCTCAAAAGTAGG - Intronic
1064883165 10:20080397-20080419 AACCCCCAAACCTCAAAAGTAGG + Intronic
1065252816 10:23834061-23834083 CAGCCAAAAACATCAACAGTAGG - Intronic
1065281696 10:24145658-24145680 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1065387373 10:25147131-25147153 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1066114516 10:32227732-32227754 CATCCCAAAACCTCAAAAGTAGG + Intergenic
1066551335 10:36561160-36561182 AGTCCCCAAACCTCAAAAGTAGG + Intergenic
1067167640 10:43878286-43878308 CAGCCCTATACCTGAAAGGAAGG - Intergenic
1067600638 10:47594096-47594118 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1068636812 10:59357073-59357095 AGTCCCAAAACCTCAAAAGTAGG - Intronic
1068713126 10:60155928-60155950 AATCCCAAAACCTCAAAAGTAGG - Intronic
1068834177 10:61534135-61534157 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1069096278 10:64263513-64263535 AATCCCAAAACCTCAAAAGTAGG + Intergenic
1069371973 10:67757719-67757741 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1069788195 10:71003217-71003239 AATCCCAAAACCCCAAAAGTAGG + Intergenic
1071183159 10:83010288-83010310 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1071251955 10:83827618-83827640 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1071262462 10:83933145-83933167 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1071374283 10:84986807-84986829 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1071458603 10:85870377-85870399 AGTCCCAAAACCTCAAAAGTAGG - Intronic
1071652172 10:87401968-87401990 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1073675669 10:105644529-105644551 AGTCCCTAAACCTCAAAAGTAGG - Intergenic
1073752965 10:106550639-106550661 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1074244506 10:111675427-111675449 GAGTTCAAAACCTCAAAAGTAGG - Intergenic
1075573955 10:123565035-123565057 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1075585917 10:123658140-123658162 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1075913960 10:126149813-126149835 AGTCCCAAAACCTCAAAAGTAGG - Intronic
1076360268 10:129883463-129883485 CTGCCTTAAAACTCAAAAGCAGG - Intronic
1076447092 10:130523777-130523799 TGCCCCAAAACCTCAAAAGTGGG - Intergenic
1077452388 11:2656271-2656293 CAGCCCCAAATCTCTAAAATGGG + Intronic
1077710065 11:4527228-4527250 AGTCCCCAAACCTCAAAAGTAGG - Intergenic
1077951139 11:6958736-6958758 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1078883258 11:15474571-15474593 AGTCCCAAAACCTCAAAAGTGGG + Intergenic
1079130563 11:17744682-17744704 CAGCCCTACACCATAGAAGTTGG - Intronic
1079210852 11:18459441-18459463 AGTCCCAAAACCTCAAAAGTAGG - Intronic
1079447863 11:20572746-20572768 AGTCCCCAAACCTCAAAAGTAGG + Intergenic
1079847991 11:25494605-25494627 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1080098947 11:28437156-28437178 AGTCCCCAAACCTCAAAAGTAGG - Intergenic
1080146389 11:28989442-28989464 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1080417333 11:32081023-32081045 AGTCCCCAAACCTCAAAAGTAGG - Intronic
1081052497 11:38361837-38361859 AGTCCCCAAACCTCAAAAGTCGG - Intergenic
1081323562 11:41719036-41719058 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1081379883 11:42401210-42401232 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1082919655 11:58479438-58479460 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1083914904 11:65735544-65735566 AGACCCAAAACCTCAAAAGTAGG - Intergenic
1085685186 11:78615265-78615287 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1085998149 11:81947414-81947436 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1086246732 11:84761739-84761761 TGTCCCAAAACCTCAAAAGTAGG - Intronic
1086248080 11:84779047-84779069 AGTCCCAAAACCTCAAAAGTAGG - Intronic
1086967075 11:93039963-93039985 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1087037712 11:93771680-93771702 ACTCCCAAAACCTCAAAAGTAGG - Intronic
1087415571 11:97851121-97851143 TGTCCCAAAACCTCAAAAGTAGG - Intergenic
1087429947 11:98041131-98041153 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1087464343 11:98486050-98486072 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1088097563 11:106117896-106117918 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1088205822 11:107391111-107391133 AGTCCCAAAACCTCAAAAGTAGG - Intronic
1088388591 11:109288662-109288684 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1088448922 11:109961914-109961936 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1089371010 11:117957630-117957652 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1089681129 11:120119557-120119579 CAGGCCCAGAGCTCAAAAGTAGG - Intronic
1090481210 11:127070323-127070345 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1091802278 12:3331885-3331907 AGTCCCGAAACCTCAAAAGTAGG + Intergenic
1093566959 12:20618303-20618325 CAGGGCTAAAACTCAAAAGAAGG - Intronic
1093776684 12:23083842-23083864 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1093964126 12:25307522-25307544 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1095150839 12:38795126-38795148 AATCCCAAAACCTCAAAAGTAGG - Intronic
1097058649 12:56266476-56266498 AGGCCCAAAACCTCAAAAGTAGG - Intergenic
1097554599 12:61121559-61121581 AGTCCCCAAACCTCAAAAGTAGG - Intergenic
1097581543 12:61463611-61463633 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1099203279 12:79700141-79700163 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1099400904 12:82203024-82203046 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1099697751 12:86043303-86043325 AAGTCCAAAACCTCAAAAGTAGG + Intronic
1099728247 12:86462619-86462641 GGTCCCAAAACCTCAAAAGTAGG + Intronic
1099821729 12:87719812-87719834 AGTCCCCAAACCTCAAAAGTAGG - Intergenic
1100094800 12:91020364-91020386 CATGCGTAGACCTCAAAAGTTGG - Intergenic
1100265017 12:92967332-92967354 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1100266598 12:92982528-92982550 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1100660443 12:96692528-96692550 CAGCACAAAACATTAAAAGTTGG - Intronic
1100890772 12:99123572-99123594 AGTCCCCAAACCTCAAAAGTAGG + Intronic
1101213737 12:102560563-102560585 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1101713865 12:107293402-107293424 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1102395816 12:112584961-112584983 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1102717860 12:114989766-114989788 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1102737471 12:115175514-115175536 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1102860425 12:116331437-116331459 AGTCCCAAAACCTCAAAAGTGGG + Intergenic
1103148642 12:118617618-118617640 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1103157029 12:118694425-118694447 TAGCCTTAAACTTCAAAATTGGG + Intergenic
1103395960 12:120607374-120607396 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1104185061 12:126422662-126422684 GAGTCCCAAACCTCAAAAGTAGG + Intergenic
1104365442 12:128172590-128172612 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1104370186 12:128217512-128217534 TGTCCCAAAACCTCAAAAGTAGG + Intergenic
1104548107 12:129730903-129730925 AGTCCCAAAACCTCAAAAGTAGG - Intronic
1105283180 13:18981743-18981765 GAGCCCTCATCCTCCAAAGTTGG - Intergenic
1105752851 13:23437409-23437431 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1106380928 13:29238406-29238428 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1106682831 13:32025810-32025832 CAGCCCCAAGCCTCAATATTAGG + Intergenic
1106820774 13:33462544-33462566 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1106862886 13:33930274-33930296 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1106899738 13:34342663-34342685 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1106911297 13:34465975-34465997 AATCCCAGAACCTCAAAAGTAGG - Intergenic
1106945274 13:34820624-34820646 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1107385570 13:39904885-39904907 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1107877661 13:44804904-44804926 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1108031084 13:46230458-46230480 AATCCCAAAACCTCAAAAGTAGG + Intronic
1108117586 13:47146467-47146489 GGTCCCAAAACCTCAAAAGTAGG + Intergenic
1108941593 13:55962914-55962936 AGACCCAAAACCTCAAAAGTAGG + Intergenic
1109462915 13:62687159-62687181 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1110084690 13:71363777-71363799 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1110215135 13:73017007-73017029 CAGCCCAAAATGTCAATAGTGGG - Intergenic
1110971818 13:81772690-81772712 CAGACACAAACCTCAAAAGCAGG - Intergenic
1111028382 13:82565177-82565199 AATCCCAAAACCTCAAAAGCAGG + Intergenic
1111218548 13:85176134-85176156 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1111441191 13:88284442-88284464 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1111558664 13:89914264-89914286 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1111695766 13:91621883-91621905 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1111786206 13:92789876-92789898 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1111958692 13:94785395-94785417 CACCCCTCAACCTGAAAATTAGG - Intergenic
1112109868 13:96284333-96284355 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1112206083 13:97324695-97324717 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1112524727 13:100134016-100134038 AGTCCCAAAACCTCAAAAGTAGG - Intronic
1112832480 13:103470918-103470940 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1112953416 13:105030780-105030802 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1113027592 13:105958085-105958107 AAGTCCCAAATCTCAAAAGTGGG + Intergenic
1113128985 13:107013550-107013572 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1113218673 13:108072800-108072822 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1114210970 14:20614315-20614337 GATCCCTAAACCTCTAAACTTGG + Intergenic
1114379858 14:22191122-22191144 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1115014283 14:28590914-28590936 AGTCCCCAAACCTCAAAAGTAGG - Intergenic
1115131033 14:30051993-30052015 TGTCCCAAAACCTCAAAAGTAGG - Intronic
1115143461 14:30199761-30199783 AGACCCCAAACCTCAAAAGTAGG - Intergenic
1115934624 14:38538022-38538044 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1115949969 14:38709999-38710021 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1115975881 14:38996429-38996451 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1116221484 14:42094306-42094328 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1116248732 14:42454779-42454801 AGTCCCAAAACCTCAAAAGTCGG - Intergenic
1116250367 14:42474267-42474289 AATCCCAAAACCTCAAAAGTAGG + Intergenic
1116414586 14:44665224-44665246 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1116531883 14:45981627-45981649 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1116665213 14:47766018-47766040 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1116901461 14:50365996-50366018 AGTCCCAAAACCTCAAAAGTAGG - Intronic
1117001710 14:51377096-51377118 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1117645072 14:57843102-57843124 AGTCCCCAAACCTCAAAAGTAGG - Intronic
1117860095 14:60081038-60081060 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1118058027 14:62102852-62102874 CAGCCGAAAACCTTAAAAATGGG - Exonic
1118305384 14:64650867-64650889 CTGCACTAACCCTCAAATGTGGG - Intergenic
1118449615 14:65888297-65888319 AGTCCCCAAACCTCAAAAGTAGG + Intergenic
1118466392 14:66034906-66034928 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1119132268 14:72184982-72185004 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1119676833 14:76562123-76562145 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1120187213 14:81406141-81406163 AGCCCCAAAACCTCAAAAGTAGG - Intronic
1120231835 14:81848690-81848712 AGACCCAAAACCTCAAAAGTAGG + Intergenic
1120356331 14:83438909-83438931 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1120654801 14:87177009-87177031 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1120759580 14:88273622-88273644 CAGCTCTAAATCCCAAAAGATGG - Intronic
1120821713 14:88917475-88917497 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1120847272 14:89137742-89137764 CACCCCTAAACCTCAAACTTGGG - Intronic
1121082547 14:91120001-91120023 AGTCCCAAAACCTCAAAAGTAGG - Intronic
1121197130 14:92084069-92084091 AGTCCCAAAACCTCAAAAGTAGG - Intronic
1121926516 14:97932151-97932173 AGTCCCCAAACCTCAAAAGTAGG + Intronic
1122378428 14:101284966-101284988 AGTCCCCAAACCTCAAAAGTAGG - Intergenic
1122459569 14:101884022-101884044 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1123917443 15:25046983-25047005 AGTCCCAAAACCTCAAAAGTCGG - Intergenic
1124546684 15:30634790-30634812 CAGACCTACACATAAAAAGTTGG - Intronic
1124711561 15:32016811-32016833 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1124780289 15:32624790-32624812 CAGACCTACACATAAAAAGTTGG - Intronic
1125423765 15:39529929-39529951 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1125451505 15:39812541-39812563 AGTCCCAAAACCTCAAAAGTAGG - Intronic
1126010902 15:44301575-44301597 CATCCCTAAGCCTCTAAAATAGG - Intronic
1126212668 15:46117720-46117742 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1126910709 15:53414437-53414459 CAGCCCCAAACCTTCAAGGTCGG - Intergenic
1128013858 15:64324593-64324615 AGTCCCAAAACCTCAAAAGTAGG - Intronic
1129924436 15:79350371-79350393 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1129976414 15:79826124-79826146 CAACCATAGACCTCCAAAGTGGG + Intergenic
1130066418 15:80608566-80608588 AGTCCCCAAACCTCAAAAGTAGG - Intergenic
1130391410 15:83458982-83459004 AGTCCCCAAACCTCAAAAGTAGG + Intronic
1130768596 15:86900159-86900181 GTCCCCAAAACCTCAAAAGTAGG - Intronic
1130973624 15:88755876-88755898 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1131525767 15:93151209-93151231 CAGCCCTAAAATTTAAAGGTTGG - Intergenic
1131600115 15:93838641-93838663 AATCCCAAAACCTCAAAAGTAGG + Intergenic
1131724339 15:95205532-95205554 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1131897857 15:97053431-97053453 AGTCCCCAAACCTCAAAAGTAGG + Intergenic
1131901816 15:97095773-97095795 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1131986653 15:98048827-98048849 TGTCCCAAAACCTCAAAAGTAGG - Intergenic
1133626411 16:7574442-7574464 GGTCCCAAAACCTCAAAAGTAGG + Intronic
1134350556 16:13434033-13434055 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1134504879 16:14796967-14796989 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1134570276 16:15284773-15284795 AATCCCAAAGCCTCAAAAGTAGG - Intergenic
1134575694 16:15331942-15331964 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1134726750 16:16424560-16424582 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1134732098 16:16471280-16471302 AATCCCAAAGCCTCAAAAGTAGG + Intergenic
1134940684 16:18287303-18287325 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1135380535 16:21992738-21992760 AGTCCCAAAACCTCAAAAGTTGG - Intronic
1135959519 16:26984200-26984222 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1137543412 16:49380173-49380195 CGTCCCAAAACCTCAAAAGTAGG - Intronic
1138748873 16:59394982-59395004 GGTCCCAAAACCTCAAAAGTAGG - Intergenic
1138750954 16:59420482-59420504 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1139217001 16:65135768-65135790 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1139292774 16:65873399-65873421 GATCCCCAAACCTCAAAAGTAGG + Intergenic
1139292781 16:65873429-65873451 AGTCCCCAAACCTCAAAAGTAGG + Intergenic
1139303458 16:65964057-65964079 CACCCCTAGGCCTCAATAGTAGG - Intergenic
1140658634 16:77165933-77165955 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1140710412 16:77672260-77672282 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1142313004 16:89324793-89324815 AGTCCCCAAACCTCAAAAGTCGG - Intronic
1143277930 17:5727562-5727584 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1144000099 17:11046013-11046035 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1144089565 17:11842530-11842552 GGTCCCAAAACCTCAAAAGTAGG + Intronic
1144154580 17:12486847-12486869 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1144155233 17:12493941-12493963 AATCCCAAAACCTCAAAAGCAGG - Intergenic
1144412385 17:15013658-15013680 GAGTCCCAAACCTCAAAAGTAGG - Intergenic
1147372800 17:40005077-40005099 CATCCCAAAACCTCAAAAGTAGG + Intergenic
1148952516 17:51326036-51326058 AGCCCCAAAACCTCAAAAGTAGG - Intergenic
1149095736 17:52838295-52838317 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1149397671 17:56261546-56261568 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1149637085 17:58179567-58179589 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1151368572 17:73632523-73632545 AGTCCCAAAACCTCAAAAGTAGG - Intronic
1153157733 18:2168057-2168079 CAGCCATAAAACTGAAAAATGGG + Intergenic
1153598687 18:6756701-6756723 GAGCCCAAAATCTCAAAAGTAGG + Intronic
1153684877 18:7535799-7535821 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1155589512 18:27410479-27410501 TGTCCCAAAACCTCAAAAGTAGG - Intergenic
1155646543 18:28085191-28085213 CAGCCATAAACTTAAAAAATGGG + Intronic
1156823025 18:41395496-41395518 GAGCCCTGCACCTGAAAAGTAGG - Intergenic
1157335639 18:46735216-46735238 AGTCCCCAAACCTCAAAAGTAGG - Intronic
1157654955 18:49376030-49376052 AGTCCCAAAACCTCAAAAGTAGG - Intronic
1157918912 18:51696307-51696329 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1158592043 18:58785971-58785993 CACCCCTAAACCTCAACACCCGG + Intergenic
1158816503 18:61103749-61103771 CATCCCCAAACCTCAAAAGTAGG - Intergenic
1158916553 18:62137315-62137337 AGTCCCAAAACCTCAAAAGTAGG - Intronic
1158946116 18:62448300-62448322 AGTCCCGAAACCTCAAAAGTAGG - Intergenic
1159136369 18:64341685-64341707 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1159704406 18:71668685-71668707 AGTCCCAAAACCTCAAAAGTGGG + Intergenic
1160092798 18:75842758-75842780 GAACACAAAACCTCAAAAGTAGG - Intergenic
1160246149 18:77161773-77161795 AGTCCCAAAACCTCAAAAGTCGG + Intergenic
1161362590 19:3859335-3859357 AGTCCCCAAACCTCAAAAGTCGG - Intronic
1164547763 19:29183404-29183426 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1164765063 19:30758340-30758362 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1164875565 19:31683533-31683555 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1164945428 19:32289155-32289177 GAGTCCCAAACCTCAAAAGTAGG - Intergenic
1166209412 19:41296579-41296601 TTGGCCTAAACCCCAAAAGTGGG + Intronic
1166973946 19:46592452-46592474 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1167030539 19:46956647-46956669 CAGCCCTCAACCAAAATAGTTGG - Intronic
925263642 2:2549150-2549172 AGTCCCAAAACCTCAAAAGTCGG + Intergenic
925471636 2:4168623-4168645 AGTCCCCAAACCTCAAAAGTAGG - Intergenic
925540020 2:4956816-4956838 AGTCCCAAAACCTCAAAAGTTGG + Intergenic
925604491 2:5644616-5644638 AGTCCCAAAACCTCAAAAGTTGG - Intergenic
925669444 2:6295209-6295231 CAGCCCACAACCTAAAAACTAGG + Intergenic
926283658 2:11470424-11470446 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
926390486 2:12386200-12386222 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
926839999 2:17069963-17069985 GAGTCCCAAGCCTCAAAAGTAGG + Intergenic
926841829 2:17089532-17089554 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
927349316 2:22089786-22089808 AATCCCAAAACCTCAAAAGTAGG - Intergenic
927617507 2:24613877-24613899 TACTCCTAAAACTCAAAAGTCGG - Intronic
928039073 2:27855456-27855478 TATTCCTAAACATCAAAAGTTGG - Intronic
928184811 2:29100980-29101002 AGTCCCAAAACCTCAAAAGTAGG + Intronic
928490187 2:31775291-31775313 AATCCCAAAATCTCAAAAGTAGG - Intergenic
928699394 2:33883390-33883412 GAGTCCAAAGCCTCAAAAGTAGG - Intergenic
928718994 2:34097623-34097645 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
928722377 2:34134551-34134573 CATACCTAACCCCCAAAAGTAGG + Intergenic
929333959 2:40717323-40717345 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
930997356 2:57736651-57736673 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
931088794 2:58863988-58864010 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
931707858 2:64962400-64962422 AGTCCCAAAACCTCAAAAGTTGG + Intergenic
932561469 2:72874970-72874992 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
932855363 2:75228148-75228170 AGTCCCCAAACCTCAAAAGTAGG + Intergenic
932859060 2:75269673-75269695 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
932957026 2:76364063-76364085 AATCCCAAAACCTCAAAAGTAGG - Intergenic
932975489 2:76595152-76595174 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
933008741 2:77029329-77029351 AGTCCCAAAACCTCAAAAGTAGG + Intronic
935526299 2:104171898-104171920 GAGTCCCCAACCTCAAAAGTAGG - Intergenic
935952060 2:108338937-108338959 CAGCCCTAGAATTCAAAGGTGGG + Intergenic
936940578 2:117879850-117879872 CGTCCCCAAACCTCAAAAGTAGG - Intergenic
937047718 2:118860790-118860812 CAGCCCTTCACCTATAAAGTGGG + Intergenic
937820086 2:126300778-126300800 AGCCCCAAAACCTCAAAAGTAGG + Intergenic
938574519 2:132591469-132591491 AGTCCCCAAACCTCAAAAGTAGG - Intronic
938769454 2:134488554-134488576 AGTCCCAAAACCTCAAAAGTAGG - Intronic
938997173 2:136692490-136692512 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
939181152 2:138803913-138803935 ATTCCCAAAACCTCAAAAGTAGG + Intergenic
939341196 2:140897834-140897856 AGTCCCAAAACCTCAAAAGTAGG - Intronic
939756348 2:146117029-146117051 AGTCCCTAAACCACAAAAGTAGG + Intergenic
940207806 2:151223355-151223377 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
940473615 2:154131820-154131842 AGTCCCAAAACCTCAAAAGTAGG + Intronic
940490273 2:154350519-154350541 AGTCCCCAAACCTCAAAAGTAGG - Intronic
941081113 2:161061580-161061602 AATCCCAAAACCTTAAAAGTAGG - Intergenic
941852118 2:170194795-170194817 AGTCCCAAAACCTCAAAAGTAGG + Intronic
942809025 2:179974669-179974691 CAGCCATTATCCTCAAAAGTGGG - Intronic
943006129 2:182390010-182390032 AATCCCAAAACCTCAAAGGTAGG - Intronic
943301695 2:186210979-186211001 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
943385554 2:187200501-187200523 GAGTCCTAAAACTCAAAAGAAGG + Intergenic
943451267 2:188044959-188044981 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
943832099 2:192476467-192476489 ATTCCCCAAACCTCAAAAGTGGG + Intergenic
943886559 2:193225476-193225498 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
943966221 2:194337191-194337213 ACTCCCAAAACCTCAAAAGTAGG - Intergenic
944336499 2:198541156-198541178 AGTCCCAAAACCTCAAAAGTAGG - Intronic
944421974 2:199541107-199541129 TAGCACAAAACTTCAAAAGTTGG + Intergenic
944632552 2:201642530-201642552 AACCTCTAATCCTCAAAAGTAGG + Intronic
944769811 2:202902698-202902720 AGTCCCAAAACCTCAAAAGTAGG - Intronic
945243355 2:207696900-207696922 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
945344867 2:208701518-208701540 AGTCCCAAAACCTCAAAAGTAGG + Intronic
945396472 2:209324812-209324834 CAGTCATAAACGTCACAAGTTGG + Intergenic
945594048 2:211769609-211769631 AGTCCCAAAACCTCAAAAGTAGG + Intronic
946656312 2:221951778-221951800 AATCCCAAAACCTCAAAAGTAGG - Intergenic
946790496 2:223296301-223296323 GAGTCCCAAAACTCAAAAGTAGG - Intergenic
946791282 2:223302764-223302786 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
947315009 2:228847355-228847377 AGTCCCAAAACCTCAAAAGTTGG - Intergenic
947439364 2:230104934-230104956 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
947921073 2:233874752-233874774 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
948348561 2:237319730-237319752 AGTCCCAAAACCTCAAAAGTGGG - Intergenic
948721060 2:239900205-239900227 AGTCCCAAAACCTCAAAAGTAGG - Intronic
1170474255 20:16699405-16699427 CAGCCCTAAAACTCAAGACTCGG + Intergenic
1170479840 20:16754812-16754834 AGTCCCAAAACCTCAAAAGTAGG - Intronic
1171252473 20:23659563-23659585 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1174094502 20:48077578-48077600 AGTCCCAAAACCTCAAAAGTTGG + Intergenic
1174164361 20:48574396-48574418 CAGCCCTAAAATTCAATATTTGG + Intergenic
1174748683 20:53089992-53090014 AATCCCTAAACCTCAAAAGTAGG + Intronic
1174794599 20:53511473-53511495 AGCCCCAAAACCTCAAAAGTAGG - Intergenic
1174956085 20:55100242-55100264 AGCCCCAAAACCTCAAAAGTAGG + Intergenic
1175029369 20:55937099-55937121 AGTCCCAAAACCTCAAAAGTGGG - Intergenic
1175625981 20:60488653-60488675 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1175848551 20:62073339-62073361 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1176276745 20:64276708-64276730 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1176895879 21:14377904-14377926 AGTCCCAAAACCTCAAAAGTAGG - Intronic
1177027535 21:15938192-15938214 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1177232480 21:18340419-18340441 AGTCCCCAAACCTCAAAAGTAGG - Intronic
1177378256 21:20302317-20302339 CGTCCCAAAACCTCAAAAGTAGG - Intergenic
1177395927 21:20536314-20536336 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1177461322 21:21414966-21414988 CAGCACTATATCTCAACAGTGGG + Intronic
1177581103 21:23022350-23022372 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1177606433 21:23384763-23384785 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1177655692 21:24013654-24013676 CGTTCCAAAACCTCAAAAGTAGG - Intergenic
1177724612 21:24950993-24951015 CAGCCCAAAGCCTCAAAACCAGG + Intergenic
1177884412 21:26731681-26731703 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1177940819 21:27409661-27409683 TGTCCCAAAACCTCAAAAGTAGG + Intergenic
1178053789 21:28776637-28776659 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1178057742 21:28818329-28818351 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1178159393 21:29894278-29894300 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1178192380 21:30299542-30299564 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1182813899 22:33140760-33140782 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1182962648 22:34490087-34490109 AATCCCCAAACCTCAAAAGTAGG + Intergenic
1184958445 22:47909242-47909264 CAGCCCCTAACCTCCAAAGCTGG - Intergenic
1185159161 22:49212544-49212566 CAGCCCCAAACCTGCAATGTGGG - Intergenic
949306010 3:2642126-2642148 AATCCCAAAACCTCAAAAGTAGG + Intronic
949372186 3:3347515-3347537 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
949412631 3:3782578-3782600 AGTCCCAAAACCTCAAAAGTAGG + Intronic
949633625 3:5957558-5957580 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
949637237 3:5996281-5996303 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
950209084 3:11104659-11104681 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
950588996 3:13921870-13921892 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
950908395 3:16560137-16560159 AACCCCAAAACCTCAAAAGTAGG - Intergenic
951059054 3:18183234-18183256 AGACCCAAAACCTCAAAAGTAGG - Intronic
951331668 3:21377008-21377030 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
952570750 3:34712860-34712882 ACTCCCAAAACCTCAAAAGTGGG - Intergenic
952642889 3:35619502-35619524 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
953770442 3:45775524-45775546 CAACCCTAAATCTCAAAACAAGG - Intronic
954177706 3:48857698-48857720 CAGCCTTCAGCCTCACAAGTTGG + Exonic
955489923 3:59471742-59471764 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
955499090 3:59566239-59566261 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
955978349 3:64499269-64499291 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
956004366 3:64762842-64762864 CAGACAGGAACCTCAAAAGTTGG + Intergenic
956314110 3:67914994-67915016 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
956388461 3:68746202-68746224 AGACCCAAAACCTCAAAAGTAGG - Intronic
956972841 3:74546700-74546722 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
957123928 3:76133563-76133585 GAGTCCCAAACCACAAAAGTAGG + Intronic
957396319 3:79643290-79643312 AGTCCCAAAACCTCAAAAGTAGG - Intronic
957453822 3:80415513-80415535 AGACCCAAAACCTCAAAAGTAGG + Intergenic
957546197 3:81640482-81640504 AGTCCCCAAACCTCAAAAGTAGG - Intronic
957628122 3:82680906-82680928 AGTCCCCAAACCTCAAAAGTGGG + Intergenic
957689722 3:83552544-83552566 AACCCCAAAACCTCAAAAGTGGG + Intergenic
957759718 3:84539330-84539352 AATCCTAAAACCTCAAAAGTAGG - Intergenic
958084380 3:88787561-88787583 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
958140813 3:89559881-89559903 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
958141277 3:89565159-89565181 AGTCCCCAAACCTCAAAAGTAGG - Intergenic
958220223 3:90662003-90662025 CAACCGTAGACCTCAAAAGGCGG + Intergenic
958485973 3:94709436-94709458 AAACTGTAAACCTCAAAAGTAGG + Intergenic
958586928 3:96099046-96099068 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
958806627 3:98818842-98818864 AGTCCCAAAACCTCAAAAGTAGG - Intronic
958829396 3:99068840-99068862 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
958879530 3:99653985-99654007 AGTCCCAAAACCTCAAAAGTAGG + Intronic
958994923 3:100893269-100893291 CGTCCCAAAACCTCAAAAGTAGG - Intronic
959080552 3:101796322-101796344 TAGCTCTAAACCTAAAAAGATGG + Intronic
959302870 3:104624668-104624690 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
959372153 3:105540473-105540495 CACCTCTAACCCTCAGAAGTAGG + Intronic
959696759 3:109256521-109256543 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
959846015 3:111034724-111034746 AAGTCCTAAACCTGAAAATTTGG - Intergenic
960318965 3:116210559-116210581 AGTCCCAAAACCTCAAAAGTAGG - Intronic
960574377 3:119215427-119215449 GGTCCCAAAACCTCAAAAGTAGG - Intronic
961030741 3:123601318-123601340 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
961256185 3:125555269-125555291 AGTCCCCAAACCTCAAAAGTAGG - Intronic
963660962 3:148128728-148128750 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
963661761 3:148135176-148135198 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
964175500 3:153822902-153822924 AGTCCCAAAACCTCAAAAGTGGG + Intergenic
964239779 3:154578144-154578166 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
964612620 3:158630411-158630433 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
965029084 3:163340645-163340667 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
965251239 3:166347506-166347528 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
965461028 3:168963618-168963640 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
965598335 3:170430102-170430124 CAGCCCTAAACCTCAAAAGTGGG - Intronic
965798369 3:172465843-172465865 AATCCCAAAACCTCAAAAGTAGG + Intergenic
966040786 3:175485469-175485491 AGTCCCAAAACCTCAAAAGTAGG + Intronic
966221612 3:177557078-177557100 GAGTCCCAAACCTCAAAAGTAGG - Intergenic
966262588 3:177997430-177997452 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
966287237 3:178312180-178312202 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
967742537 3:193018960-193018982 AATCCCAAAACCTCAAATGTAGG - Intergenic
967745243 3:193047689-193047711 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
967758366 3:193196201-193196223 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
967841439 3:194008088-194008110 AATCCCAAAACCTCAGAAGTCGG - Intergenic
969837992 4:9859079-9859101 AAGTCCAAAACCTCAAAAATAGG - Intronic
969983858 4:11186914-11186936 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
970052321 4:11928611-11928633 AGTCCCCAAACCTCAAAAGTAGG - Intergenic
970084626 4:12332997-12333019 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
970186434 4:13459228-13459250 AGTCCCAAAACCTCAAAAGTAGG - Intronic
970387704 4:15572795-15572817 AGTCCCAAAACCTCAAAAGTAGG + Intronic
970477379 4:16437376-16437398 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
970629102 4:17922023-17922045 AGTCCCAAAACCTCAAAAGTAGG - Intronic
970629696 4:17926585-17926607 AATCCCAGAACCTCAAAAGTAGG - Intronic
970706314 4:18807653-18807675 AGCCCCTGAACCTCAAAAGTGGG + Intergenic
970785777 4:19794259-19794281 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
971003233 4:22346119-22346141 AAGCCCTTCCCCTCAAAAGTTGG - Intronic
971189167 4:24410880-24410902 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
971565404 4:28133063-28133085 CGTCCCAAAACCTCAAAAGTAGG - Intergenic
971836336 4:31768009-31768031 AATCCCAAACCCTCAAAAGTAGG + Intergenic
971884811 4:32430788-32430810 AAAACCAAAACCTCAAAAGTAGG + Intergenic
972064772 4:34927918-34927940 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
972073790 4:35057339-35057361 AGTCCCCAAACCTCAAAAGTAGG - Intergenic
972117032 4:35649162-35649184 AATCCCAAAACCTCAAAAGTAGG - Intergenic
972178134 4:36432885-36432907 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
972786798 4:42333871-42333893 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
972898322 4:43651961-43651983 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
974424323 4:61721275-61721297 AGTCCCAAAACCTCAAAAGTAGG + Intronic
974467084 4:62271326-62271348 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
974474974 4:62366640-62366662 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
974478722 4:62418099-62418121 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
974564382 4:63564833-63564855 AATCCCAAAACCTCAAAAGTAGG - Intergenic
974588187 4:63908979-63909001 AAGCCCAAAATCTCAAAAGCAGG + Intergenic
974835414 4:67242880-67242902 AAGCCCTAAAACCAAAAAGTTGG + Intergenic
974853457 4:67430811-67430833 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
975024569 4:69532381-69532403 CATAACCAAACCTCAAAAGTGGG - Intergenic
975961926 4:79919692-79919714 AGTCCCAAAACCTCAAAAGTGGG - Intronic
976191300 4:82489532-82489554 CACCCCAAAACCTCAAATATTGG + Intronic
976759495 4:88533033-88533055 AGTCCCAAAACCTCAAAAGTAGG + Intronic
976788826 4:88854012-88854034 AGTCCCAAAACCTCAAAAGTAGG - Intronic
976801360 4:88995646-88995668 AGTCCCAAAACCTCAAAAGTAGG - Intronic
976889113 4:90023518-90023540 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
977001699 4:91512479-91512501 AGTCCCAAAACCTCAAAAGTAGG - Intronic
977026376 4:91823460-91823482 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
977758127 4:100698134-100698156 AGTCCCAAAACCTCAAAAGTAGG + Intronic
977947334 4:102928772-102928794 AGTCCCAAAACCTCAAAAGTAGG + Intronic
978044782 4:104113214-104113236 AATCCCAAAACCTCAAAAGTAGG + Intergenic
978079359 4:104573379-104573401 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
978241699 4:106524425-106524447 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
978842961 4:113236118-113236140 CATCCTTAATCCACAAAAGTTGG - Intronic
978968283 4:114769564-114769586 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
979160867 4:117459552-117459574 CGTCCCAAAACTTCAAAAGTAGG + Intergenic
979810195 4:125027199-125027221 AGTCCCCAAACCTCAAAAGTAGG - Intergenic
979898080 4:126186336-126186358 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
979918109 4:126464996-126465018 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
980740289 4:136941299-136941321 ACTCCCAAAACCTCAAAAGTAGG - Intergenic
981000356 4:139823320-139823342 CAGCCCTCCACCTCAAAGGCAGG + Intronic
981220369 4:142225333-142225355 AGCCCCAAAACCTCAAAAGTAGG - Intronic
981567463 4:146115885-146115907 CATCCCTAAACATAAAAAGTGGG - Intergenic
981743867 4:148032725-148032747 AGTCCCAAAACCTCAAAAGTAGG + Intronic
981878277 4:149576153-149576175 ACACCCTAAACCTGAAAAGTTGG - Intergenic
982222873 4:153139928-153139950 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
982597441 4:157404324-157404346 GAGTCCCAAACCTCAAAAGTAGG + Intergenic
982783318 4:159513732-159513754 AGCCCCAAAACCTCAAAAGTAGG + Intergenic
982839262 4:160161615-160161637 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
982894607 4:160902763-160902785 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
983367881 4:166817866-166817888 CAGCCCTAAAACACAAAATAAGG + Intronic
983459029 4:168004060-168004082 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
984436613 4:179718272-179718294 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
984860489 4:184233310-184233332 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
985798192 5:1980517-1980539 AATCCCAAAACCTCAAAAGTAGG - Intergenic
986036141 5:3942024-3942046 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
986098926 5:4587232-4587254 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
986427731 5:7651407-7651429 CATCCCAAAACCTCAAAAGTAGG + Intronic
986547284 5:8912306-8912328 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
986760702 5:10877223-10877245 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
986921167 5:12683644-12683666 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
986926035 5:12753435-12753457 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
986981038 5:13448300-13448322 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
987182020 5:15378059-15378081 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
987467910 5:18294626-18294648 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
987550432 5:19372910-19372932 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
987731156 5:21774423-21774445 AGTCCCAAAACCTCAAAAGTAGG - Intronic
987774554 5:22347494-22347516 CATCCCAAAACCTCAAAAGTAGG - Intronic
987796745 5:22638274-22638296 CATCCCAAAACCTCAAAAGTAGG + Intronic
987870383 5:23610321-23610343 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
987907375 5:24094278-24094300 GAGTCCCAAACCTCAAAAGTAGG + Intronic
988050046 5:26015832-26015854 AGCCCCAAAACCTCAAAAGTAGG - Intergenic
988102681 5:26702228-26702250 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
988185416 5:27854671-27854693 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
988248868 5:28727348-28727370 GAGTCCAGAACCTCAAAAGTAGG - Intergenic
988261368 5:28890308-28890330 AAAACCTCAACCTCAAAAGTAGG - Intergenic
988413688 5:30918554-30918576 AGTCCCAAAACCTCAAAAGTCGG + Intergenic
988655780 5:33210123-33210145 AGTCCCAAAACCTCAAAAGTCGG + Intergenic
988965783 5:36416398-36416420 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
988984126 5:36600237-36600259 CAGCTCTAAACCTGAAGAGTCGG - Intergenic
989201001 5:38763641-38763663 AATCCCAAAACCTCAAAAGTGGG - Intergenic
989263760 5:39448651-39448673 AGTCCCAAAACCTCAAAAGTAGG + Intronic
990099628 5:52165901-52165923 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
990245066 5:53856480-53856502 GGTCCCAAAACCTCAAAAGTAGG + Intergenic
990423946 5:55666514-55666536 CAGTCATAAGCCTGAAAAGTTGG + Intronic
990931069 5:61092951-61092973 AGTCCCAAAACCTCAAAAGTAGG + Intronic
991218189 5:64180932-64180954 GATCCCAAAACCTCAAAAGTAGG + Intronic
991579460 5:68139219-68139241 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
992550521 5:77855431-77855453 CAGCCCTAAACCTTACAAATTGG - Intronic
992641912 5:78775021-78775043 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
992846048 5:80749214-80749236 AATCCCAAAACCTCAAAAGTAGG + Intronic
993036437 5:82762558-82762580 AGTCCCCAAACCTCAAAAGTAGG - Intergenic
993572657 5:89561138-89561160 AATCCCAAAACCTCAAAAGTAGG + Intergenic
993636570 5:90351723-90351745 AAGTCCCAAACCTCAAAAATAGG - Intergenic
994018376 5:94994998-94995020 AGTCCCAAAACCTCAAAAGTAGG - Intronic
994051902 5:95371337-95371359 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
994549561 5:101213397-101213419 AATCCCAAAGCCTCAAAAGTAGG - Intergenic
994654192 5:102569480-102569502 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
994855879 5:105118361-105118383 AGTCCCCAAACCTCAAAAGTAGG - Intergenic
995291612 5:110462620-110462642 AGTCCCCAAACCTCAAAAGTAGG - Intronic
995457759 5:112369906-112369928 CAGACCTACACCTCAGAGGTGGG - Intronic
996313065 5:122128850-122128872 AAGCCCAAAACCTCAAAAGTAGG + Intergenic
996657590 5:125960091-125960113 AAACCCAAAACCTCAAAAGTAGG + Intergenic
996761917 5:126994810-126994832 AGTCCCAAAACCTCAAAAGTAGG + Intronic
997730472 5:136169071-136169093 AAGCCCAAAACCTCAAAAGTAGG + Intronic
998701362 5:144703509-144703531 AATCCCAAAACCTCAAAAGTAGG - Intergenic
998737164 5:145155337-145155359 AATCCCAAAACCTCAAAAGTAGG - Intergenic
999594959 5:153192722-153192744 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1000139648 5:158389738-158389760 AGTCCCCAAACCTCAAAAGTAGG + Intergenic
1000223150 5:159233638-159233660 AGTCCCCAAACCTCAAAAGTAGG + Intergenic
1000223722 5:159238050-159238072 AGACCCAAAACCTCAAAAGTAGG + Intergenic
1000604374 5:163312541-163312563 AATCCCCAAACCTCAAAAGTAGG - Intergenic
1004316472 6:14592461-14592483 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1005115374 6:22330038-22330060 TAGCCCTAATCCTTTAAAGTGGG + Intergenic
1005265665 6:24109725-24109747 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1005527946 6:26669903-26669925 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1005542851 6:26831772-26831794 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1006067759 6:31474716-31474738 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1006242635 6:32698558-32698580 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1007294049 6:40807813-40807835 AGTCCCCAAACCTCAAAAGTAGG - Intergenic
1007959810 6:45948409-45948431 CTTCCCTCAACCTCTAAAGTAGG + Intronic
1008079042 6:47175832-47175854 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1008198309 6:48553725-48553747 AATCCCAAAACCTCAAAAGTAGG + Intergenic
1008260410 6:49359466-49359488 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1008390634 6:50947492-50947514 AGCCCCAAAACCTCAAAAGTAGG + Intergenic
1008562621 6:52737158-52737180 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1009013666 6:57873938-57873960 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1009531218 6:64818523-64818545 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1009660477 6:66605272-66605294 ACTCCCAAAACCTCAAAAGTGGG + Intergenic
1009881448 6:69571237-69571259 AGTCCCCAAACCTCAAAAGTAGG - Intergenic
1009970193 6:70617119-70617141 GCTCCCAAAACCTCAAAAGTAGG - Intergenic
1010705243 6:79101144-79101166 AATCCCAAAACCTCAAAAGCAGG + Intergenic
1010922373 6:81699060-81699082 CAGACATAAACCTCAAAAAGAGG - Intronic
1010937851 6:81883210-81883232 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1011026352 6:82873515-82873537 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1011645966 6:89458441-89458463 AATCCCAAAACCTCAAAAGTAGG + Intronic
1011752312 6:90465605-90465627 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1012108539 6:95197544-95197566 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1012227746 6:96724301-96724323 AATCCCAAAACTTCAAAAGTAGG + Intergenic
1012577364 6:100819500-100819522 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1012750814 6:103161233-103161255 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1013699670 6:112750108-112750130 CAGTCCCAAACCTCAAAAGTAGG + Intergenic
1014113951 6:117651899-117651921 AGCCCCAAAACCTCAAAAGTAGG + Intergenic
1014160065 6:118157534-118157556 AATCCCAAAACTTCAAAAGTAGG + Intronic
1014328961 6:120035763-120035785 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1014334821 6:120120149-120120171 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1014389327 6:120841466-120841488 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1014629036 6:123766962-123766984 AGGACCCAAACCTCAAAAGTAGG + Intergenic
1014851386 6:126343542-126343564 AGTCCCCAAACCTCAAAAGTAGG + Intronic
1015095094 6:129406872-129406894 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1015110841 6:129589845-129589867 AGTCCCAAAACCTCAAAAGTGGG + Intronic
1015145120 6:129976863-129976885 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1015218169 6:130773856-130773878 AGACCCAAAACCTCAAAAGTAGG - Intergenic
1016165469 6:140936607-140936629 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1016224226 6:141715260-141715282 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1016235151 6:141855436-141855458 AGCCCCAAAACCTCAAAAGTAGG + Intergenic
1016250063 6:142030238-142030260 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1016546096 6:145226198-145226220 CAGAACAAAACCTCGAAAGTGGG + Intergenic
1016777476 6:147920428-147920450 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1016859871 6:148706950-148706972 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1016938049 6:149462897-149462919 AGGCCCAAAACCTCAAAAATAGG - Intronic
1017293311 6:152766052-152766074 CATCTCCAAACCTCAAAAGTAGG + Intergenic
1017357607 6:153528236-153528258 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1018208351 6:161456450-161456472 ACTCCCAAAACCTCAAAAGTAGG - Intronic
1018234614 6:161711931-161711953 AGTCCCAAAACCTCAAAAGTAGG - Intronic
1018425608 6:163677603-163677625 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1018427484 6:163696487-163696509 GAGTCCAAAACCTCAAAAGTAGG + Intergenic
1018479093 6:164172059-164172081 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1018530252 6:164755361-164755383 AGTCCCCAAACCTCAAAAGTAGG - Intergenic
1018530738 6:164760119-164760141 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1018537024 6:164831505-164831527 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1018563990 6:165132351-165132373 AATCGCAAAACCTCAAAAGTAGG + Intergenic
1018654037 6:166015377-166015399 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1018666776 6:166145804-166145826 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1019020296 6:168912323-168912345 AAGTCCCAAACCTCAAAAGTAGG - Intergenic
1019040367 6:169098974-169098996 ATTCCCAAAACCTCAAAAGTAGG - Intergenic
1019093963 6:169564060-169564082 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1019256005 7:51671-51693 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1019947469 7:4341462-4341484 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1019954517 7:4402736-4402758 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1020623741 7:10551324-10551346 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1020629055 7:10618611-10618633 AAGCCATAAACCTCAAAAAATGG - Intergenic
1020742847 7:12043737-12043759 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1020875797 7:13692019-13692041 ATTCCCAAAACCTCAAAAGTAGG - Intergenic
1020886305 7:13822780-13822802 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1020976986 7:15018600-15018622 ACTCCCAAAACCTCAAAAGTAGG - Intergenic
1021979230 7:26038455-26038477 CAGCCCTAGATTTCAAGAGTAGG + Intergenic
1023463673 7:40429466-40429488 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1023576831 7:41636812-41636834 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1024744602 7:52391473-52391495 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1024993445 7:55254032-55254054 AGTCCCCAAACCTCAAAAGTAGG - Intronic
1025102365 7:56146177-56146199 CGGCCCCAACCCCCAAAAGTTGG - Intergenic
1026012021 7:66643924-66643946 AAGCCCTAAACCTCAGGAGGAGG - Intronic
1026507913 7:71002339-71002361 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1026559208 7:71434139-71434161 AATCCCAAAACCTCTAAAGTAGG - Intronic
1027590915 7:80117725-80117747 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1027676355 7:81163188-81163210 AGTCCCCAAACCTCAAAAGTAGG - Intergenic
1027692784 7:81369181-81369203 AATCCCAAAACCTCAAAAGTAGG - Intergenic
1027807887 7:82852586-82852608 AATCCCAAAACCTCAAAAGTAGG - Intronic
1028204249 7:87997944-87997966 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1028559265 7:92155717-92155739 AGTCCCGAAACCTCAAAAGTAGG + Intronic
1029171878 7:98636274-98636296 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1030404132 7:109089128-109089150 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1030532726 7:110730481-110730503 ACTCCCAAAACCTCAAAAGTCGG - Intronic
1030927137 7:115472243-115472265 CAGTCCTAACCCTTAAAACTTGG + Intergenic
1031144115 7:117978979-117979001 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1031338947 7:120575223-120575245 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1031643410 7:124193415-124193437 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1031767400 7:125798939-125798961 AGCCCCTAAACCTCAAAAGTAGG + Intergenic
1031768237 7:125807890-125807912 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1031882321 7:127211195-127211217 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1032634605 7:133693159-133693181 ACTCCCAAAACCTCAAAAGTAGG + Intronic
1032890578 7:136190919-136190941 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1033501158 7:141950983-141951005 AGTCCCAAAACCTCAAAAGTAGG - Intronic
1034033154 7:147789906-147789928 CAGTCCCAGACTTCAAAAGTAGG - Intronic
1034123225 7:148645983-148646005 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1034763274 7:153693881-153693903 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1034824754 7:154251594-154251616 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1035673238 8:1436191-1436213 AGGCCCAAAACCTCAAAAGCAGG + Intergenic
1036491358 8:9229080-9229102 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1037391071 8:18392334-18392356 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1038083370 8:24165374-24165396 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1038393101 8:27223487-27223509 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1038715042 8:29983975-29983997 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1038739012 8:30200048-30200070 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1042101439 8:65279549-65279571 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1042840976 8:73123571-73123593 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1042855302 8:73261089-73261111 ATTCCCAAAACCTCAAAAGTAGG - Intergenic
1043356992 8:79425340-79425362 CAGCCCTCAACCTCAACTCTGGG + Intergenic
1043992304 8:86770648-86770670 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1044285623 8:90409824-90409846 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1044344697 8:91091733-91091755 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1044895728 8:96889629-96889651 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1044993021 8:97813184-97813206 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1045405221 8:101859323-101859345 AATCCCAAAACCTTAAAAGTAGG - Intronic
1045588363 8:103564488-103564510 AGTCCCAAAACCTCAAAAGTAGG + Intronic
1045636377 8:104195819-104195841 CAGCCATAACCCTAAAAAGATGG - Intronic
1045711775 8:104993180-104993202 AGTCCCCAAACCTCAAAAGTAGG + Intronic
1047375831 8:124295097-124295119 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1047844591 8:128792332-128792354 AAACCCGAAACCTCAAAAGTAGG + Intergenic
1048737816 8:137520930-137520952 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1048895146 8:138985414-138985436 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1050191367 9:3029988-3030010 AATCCCAAAACCTCAAAAGTAGG + Intergenic
1050636251 9:7616170-7616192 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1051011200 9:12416556-12416578 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1051719115 9:20017613-20017635 AGCCCCAAAACCTCAAAAGTAGG + Intergenic
1051792757 9:20826470-20826492 AGTCCCAAAACCTCAAAAGTAGG - Intronic
1051856500 9:21573298-21573320 CAGTCCTAAACCTCTAATGAAGG + Intergenic
1052024822 9:23562787-23562809 AAGTCCAAAACCTCTAAAGTTGG + Intergenic
1052174298 9:25438946-25438968 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1052556633 9:30027117-30027139 AGTCCCCAAACCTCAAAAGTAGG + Intergenic
1053604934 9:39648093-39648115 AGTCCCCAAACCTCAAAAGTAGG - Intergenic
1053862810 9:42404443-42404465 AGTCCCCAAACCTCAAAAGTAGG - Intergenic
1054248607 9:62694322-62694344 AGTCCCCAAACCTCAAAAGTAGG + Intergenic
1054562721 9:66728848-66728870 AGTCCCCAAACCTCAAAAGTAGG + Intergenic
1055367012 9:75555400-75555422 CAGCCAAAAAGCTAAAAAGTAGG + Intergenic
1057866417 9:98685310-98685332 TGTCCCCAAACCTCAAAAGTAGG - Intronic
1058100964 9:100917127-100917149 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1058235030 9:102479438-102479460 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1058381335 9:104380038-104380060 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1058386717 9:104444951-104444973 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1058550513 9:106109875-106109897 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1058649827 9:107164859-107164881 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1059580814 9:115546512-115546534 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1059833626 9:118126426-118126448 GATCCCAAAACTTCAAAAGTGGG - Intergenic
1059958698 9:119544555-119544577 CAGCTCTAAACCCCAAATCTGGG + Intergenic
1059970967 9:119667724-119667746 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1060007501 9:120013683-120013705 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1061656435 9:132094834-132094856 AATCCCTAAACCTTAAAAGTAGG + Intergenic
1062082492 9:134631618-134631640 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1062135929 9:134928403-134928425 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1185524193 X:764353-764375 CATCCCAAAACATCAAAAGCAGG - Intergenic
1185564044 X:1082511-1082533 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1185728296 X:2440749-2440771 AGGCCCAAAACCTCAAAAGTAGG - Intronic
1185742508 X:2545071-2545093 AGTCCCTAAACCTAAAAAGTAGG - Intergenic
1185989374 X:4875858-4875880 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1186116534 X:6309991-6310013 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1186129443 X:6450784-6450806 CATCCTGAAACCTCAAAAGAAGG - Intergenic
1186129929 X:6455629-6455651 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1186130004 X:6456259-6456281 CAGCCCTAAAGCTCAGAAGTTGG + Intergenic
1186183231 X:6993075-6993097 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1186187246 X:7033215-7033237 AATCCCAAAGCCTCAAAAGTAGG - Intergenic
1186320176 X:8415801-8415823 GATCCCCAAACCTTAAAAGTTGG + Intergenic
1187241166 X:17514528-17514550 AGTCCCAAAACCTCAAAAGTAGG - Intronic
1187319509 X:18227185-18227207 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1187524324 X:20040181-20040203 AGTCCCAAAACCTCAAAAGTAGG - Intronic
1187575710 X:20552531-20552553 AATCCCAAAACCTCAAAAGTAGG + Intergenic
1187604448 X:20868607-20868629 AGTCCCAAAACCTCAAAAGTGGG - Intergenic
1187927584 X:24264107-24264129 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1188012558 X:25073381-25073403 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1188054225 X:25522768-25522790 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1188707627 X:33355439-33355461 AAGTCCAAAACCTCAAAAATAGG - Intergenic
1188848603 X:35104343-35104365 AATCCCCAAACCTCAAAACTAGG - Intergenic
1188982307 X:36737538-36737560 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1190545566 X:51522929-51522951 AATCCCAAAACCTCAAAAGTAGG + Intergenic
1190794264 X:53726292-53726314 CAGGCCTCAACCTCAATATTAGG - Intergenic
1191089886 X:56608653-56608675 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1191095398 X:56668474-56668496 AATCCCAAAACCTTAAAAGTAGG + Intergenic
1191096718 X:56680900-56680922 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1191133718 X:57041819-57041841 AGACCCAAAACCTCAAAAGTAGG + Intergenic
1191162017 X:57340049-57340071 TGTCCCAAAACCTCAAAAGTAGG + Intronic
1191226773 X:58052357-58052379 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1191877993 X:65815837-65815859 AGTCCCAAAACCTCAAAAGTGGG + Intergenic
1191988039 X:67003151-67003173 AATCCCCAAACCTCAGAAGTAGG + Intergenic
1192138514 X:68629233-68629255 GATCCCAAAACCCCAAAAGTAGG - Intergenic
1192658448 X:73017093-73017115 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1193121097 X:77823681-77823703 TGTCCCAAAACCTCAAAAGTGGG - Intergenic
1193354909 X:80508058-80508080 GATCCCAAAACCTCAAAAGTAGG + Intergenic
1193450160 X:81655662-81655684 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1193461773 X:81798479-81798501 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1193792888 X:85837979-85838001 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1193852259 X:86553133-86553155 CATCCCAAAATCTCAAAAGTAGG + Intronic
1194096155 X:89641328-89641350 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1194137526 X:90164691-90164713 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1194230282 X:91314324-91314346 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1194255101 X:91625868-91625890 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1194477765 X:94379990-94380012 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1194531289 X:95052130-95052152 AGTCCCCAAACCTCAAAAGTAGG - Intergenic
1195198255 X:102519964-102519986 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1195309221 X:103614659-103614681 AGTCCCAAAACCTCAAAAGTAGG - Intronic
1195495115 X:105522111-105522133 CAACCCTGGACCTCAAGAGTTGG + Intronic
1195850490 X:109277145-109277167 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1195999713 X:110768755-110768777 AGCCCCAAAACCTCAAAAGTAGG - Intronic
1196512249 X:116525496-116525518 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1196933939 X:120710406-120710428 GAGTCCCAAACCTCAAAAGTAGG - Intergenic
1197079371 X:122393965-122393987 AATCCCAAAACCTCAAAAGTAGG - Intergenic
1197084630 X:122456956-122456978 TGTCCCAAAACCTCAAAAGTAGG + Intergenic
1197347016 X:125336343-125336365 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1197364446 X:125546304-125546326 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1197388434 X:125828860-125828882 AGTCCCCAAACCTCAAAAGTAGG - Intergenic
1197399220 X:125969306-125969328 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1197537673 X:127709511-127709533 GAGTCCCAAACCTCAAAAGCAGG - Intergenic
1197598406 X:128495446-128495468 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1198565204 X:137896998-137897020 GGTCCCAAAACCTCAAAAGTAGG - Intergenic
1198634471 X:138680589-138680611 CAGCAGTAAGTCTCAAAAGTAGG + Intronic
1199081078 X:143577506-143577528 GAGTTCCAAACCTCAAAAGTAGG + Intergenic
1199111128 X:143936046-143936068 AGTCCCCAAACCTCAAAAGTAGG - Intergenic
1199233007 X:145461329-145461351 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1199243171 X:145572467-145572489 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1199418946 X:147620392-147620414 AGCCCCAAAACCTCAAAAGTAGG - Intergenic
1199785298 X:151099774-151099796 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1200015874 X:153163495-153163517 AACCTCAAAACCTCAAAAGTAGG + Intergenic
1200449161 Y:3302709-3302731 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1200483258 Y:3734627-3734649 AGTCCCAAAACCTCAAAAGTAGG - Intergenic
1200573884 Y:4865444-4865466 AGTCCCAAAACCTCAAAAGTAGG + Intergenic
1201252380 Y:12072415-12072437 AATCCTAAAACCTCAAAAGTAGG - Intergenic
1201428682 Y:13883531-13883553 AGTCCCCAAACCTCAAAAGTAGG + Intergenic