ID: 965602562

View in Genome Browser
Species Human (GRCh38)
Location 3:170469484-170469506
Sequence CTTTCTTTTCTGTAGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 424}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965602562 Original CRISPR CTTTCTTTTCTGTAGGTGGG GGG Intronic
900133976 1:1106119-1106141 CTTCCTTTTTTGTAGGTAGAGGG - Intronic
900218214 1:1493440-1493462 TTTTCTTTTCTTTTGGTGGGGGG + Intronic
900747624 1:4371901-4371923 TTTTCTTTTCTGGACGCGGGGGG + Intergenic
903452711 1:23465502-23465524 CTTTCTTTTTTTTTGGGGGGGGG + Intronic
903614068 1:24639310-24639332 CTTTCTTTTCTTTTGGAGAGAGG - Intronic
903714953 1:25358449-25358471 GTTTCTTTTTTGGAGGTGGGTGG - Intronic
903869931 1:26426594-26426616 CTTTCTTCCCTCTAGGTGGGGGG + Exonic
904596511 1:31649571-31649593 TTTTTTTTTTTGGAGGTGGGGGG - Intergenic
905311883 1:37054886-37054908 CTTGCTTTTCTGGAGGTTGCGGG + Intergenic
905555324 1:38878075-38878097 TTTTCTTTTTTTTTGGTGGGGGG + Intronic
906527137 1:46500549-46500571 CTTTCTTTTTTGGGGGAGGGGGG - Intergenic
907663862 1:56417283-56417305 GTTTGTTTTTTGTTGGTGGGGGG - Intergenic
909582513 1:77253855-77253877 CTCTCTTTTCTGCAAGTGGAAGG - Intergenic
910250406 1:85192166-85192188 TTTTCTTTTCAGTAGAAGGGAGG - Intronic
910433695 1:87183462-87183484 CTTTGTTCTCTGGAGGTTGGGGG + Intergenic
910449684 1:87332263-87332285 CTGTCTTTCCTGGAGATGGGGGG + Intronic
910570235 1:88692796-88692818 CTTTCTTTTATGGAGTTGTGTGG + Intronic
910783769 1:90971419-90971441 CTTTCTTTTTTTTTGGTGGGGGG + Intronic
911251794 1:95584938-95584960 CTCTCTTTTCTGTGTGTGGGAGG + Intergenic
911439680 1:97909624-97909646 CTTTCTTGTCTGCTGTTGGGAGG - Intronic
912009877 1:104946777-104946799 CTTTTTTGTGTGTGGGTGGGGGG - Intergenic
912544346 1:110440323-110440345 CTTTCTGGTGTGTGGGTGGGGGG + Intergenic
913103805 1:115594139-115594161 CTTCACTTTCTCTAGGTGGGTGG - Intergenic
913444300 1:118933452-118933474 TTTTTTTTTTTGTGGGTGGGGGG - Intronic
914678393 1:149921314-149921336 TTTTCTTTTTTTAAGGTGGGAGG + Intergenic
914730872 1:150369275-150369297 CTCTCTTTTCTGTGGGGAGGTGG + Intronic
915315160 1:155024440-155024462 CTGTCTTTTCTATAGGGGTGGGG - Intronic
915717778 1:157960750-157960772 CTTTCTAACCTCTAGGTGGGAGG - Intergenic
917204771 1:172560982-172561004 CTTTGTTTTCTGAAAGAGGGTGG + Intronic
918054331 1:181005867-181005889 CTTTCTTTTCTTGGTGTGGGAGG + Intronic
918499878 1:185182493-185182515 CTTTATTTTCTGTAGACAGGAGG - Intronic
918744791 1:188185435-188185457 TTTTCTTTTCTGTTGGTCAGTGG - Intergenic
919828671 1:201522765-201522787 TTTTCTTTTCTGTGGGGGTGGGG + Intergenic
921202137 1:212817503-212817525 TTTTCTTTTTTGTAGGGGGGTGG - Intergenic
921783175 1:219193045-219193067 CTTTCTTTTTTTTTGGGGGGGGG + Intronic
921862038 1:220050434-220050456 TTTTATTTTCTGTAGGTATGGGG + Intergenic
922158080 1:223055558-223055580 ATTTCTCTTCTGTGGATGGGTGG - Intergenic
922356676 1:224782878-224782900 CTTGTTTCTGTGTAGGTGGGTGG + Intergenic
923045317 1:230351233-230351255 CCTTCTTATCTATAGGAGGGTGG + Intronic
923322736 1:232851792-232851814 CTTTCTTTTCTGAACTTAGGAGG + Intergenic
923362577 1:233226264-233226286 TTTTCTTTTTTCTGGGTGGGGGG + Intronic
923485787 1:234429748-234429770 CTATCCTTTCTAAAGGTGGGGGG + Intronic
924042984 1:240001991-240002013 ATTTATTTTCTGCAGGTAGGTGG + Intergenic
1062794793 10:336631-336653 CTTTCTTTTTTATAAGTAGGAGG - Intronic
1063646626 10:7890202-7890224 CTTTCTTTTCTGTGCTTGGAAGG + Intronic
1063810468 10:9699477-9699499 TTTTCTCTAGTGTAGGTGGGAGG - Intergenic
1064138506 10:12770915-12770937 CTTTCTTTTTTGTGGGGGGTGGG + Intronic
1064180650 10:13111767-13111789 CTTCCTTGTCAGTAGGTGTGGGG + Intronic
1064695091 10:17957002-17957024 TTTTCTTTTCCGGAGGTGGGGGG - Intronic
1066075337 10:31869574-31869596 CTTTGTTTTTTTTAGGGGGGAGG - Intronic
1066194658 10:33087346-33087368 CTTTCTCTTCAGGAAGTGGGAGG - Intergenic
1066988284 10:42487616-42487638 CTTTCTTTTCTGGAGGACGCTGG + Intergenic
1067392186 10:45874075-45874097 ATTGCTTTTCTGTGGGTGGGAGG - Intergenic
1067402745 10:45992344-45992366 ATTGCTTTTCTGTGGGTGGGAGG + Intronic
1067871098 10:49961977-49961999 ATTGCTTTTCTGTGGGTGGGAGG + Intronic
1068847676 10:61697564-61697586 CTTACTTTTGGGTAGTTGGGTGG + Intronic
1073104823 10:101026551-101026573 CTTGCTTTTCTGTAACTGGAAGG - Intronic
1073575957 10:104623458-104623480 CTTTCTTTTTTGTAGGTATGTGG - Intergenic
1074189447 10:111123248-111123270 CTTTCTCTATTGGAGGTGGGGGG + Intergenic
1075212222 10:120500969-120500991 CTTCCTATTCTGGGGGTGGGGGG - Intronic
1075408628 10:122211271-122211293 CTATCTTTTTGGTAGGAGGGGGG - Exonic
1075476845 10:122743143-122743165 CTTTTTTTTTTTTTGGTGGGGGG - Intergenic
1075985499 10:126781564-126781586 CTTTCTTGTCTAGAGGAGGGAGG + Intergenic
1076548850 10:131264359-131264381 CTTTCCTTCCTGTGGGTGGGTGG - Intronic
1078056390 11:8012524-8012546 CTTTCCTTTCTCTAGGTAGCAGG - Intergenic
1079487326 11:20948961-20948983 CTATCTTTTCTGTAGCAGAGGGG + Intronic
1081243474 11:40734987-40735009 CTCTCTCTTCTGCAGCTGGGAGG + Intronic
1082874983 11:57978675-57978697 CTGCCTTTTTTGTTGGTGGGTGG - Intergenic
1082947183 11:58772871-58772893 CTTTCTTATCTGGTGCTGGGTGG - Intergenic
1083158405 11:60839892-60839914 CTTTCTTGCCTTTAGGTGGTAGG - Intergenic
1083724014 11:64619048-64619070 ATGTCTTTTCTGGAGCTGGGAGG + Intronic
1083817238 11:65141330-65141352 ATTTATTTTTTGTAGGAGGGGGG - Intergenic
1083893184 11:65607101-65607123 GTTTTTTTTCTGTCTGTGGGCGG - Intronic
1085058341 11:73421603-73421625 GTTTCTTTTCTTTGGGGGGGTGG + Intronic
1085167502 11:74416407-74416429 CTTTCTTTTTTTTAGGGGGGAGG + Intergenic
1085599818 11:77845428-77845450 TTTTCTTTTTTTTTGGTGGGGGG + Intronic
1086880543 11:92148336-92148358 CTCTCTTTTTTGTAGGTTAGAGG + Intergenic
1087007477 11:93483763-93483785 CTTTCTTTTGTGTCAGTGGCAGG - Intronic
1087185208 11:95184034-95184056 CTGCCTTTTTTGTAGGTGGGGGG - Intronic
1087679218 11:101200496-101200518 TTTTCTATTCAGTAGGTGAGGGG - Intergenic
1087709906 11:101536401-101536423 CTTTCTTTTTTTTTGGTGGGGGG - Intronic
1087893939 11:103566475-103566497 CTTTCTTTTGGGTAGGGGGAGGG + Intergenic
1089990209 11:122852326-122852348 TCCTCTTTTCTGTAGGAGGGCGG + Intronic
1090826266 11:130388757-130388779 CTTTCTTCTCTGTGTGTGTGGGG - Intergenic
1091127285 11:133111746-133111768 TTTTGTTGTTTGTAGGTGGGAGG + Intronic
1091577053 12:1747503-1747525 CTTTCTTTTTTGTTGGGCGGTGG + Intronic
1091931386 12:4398290-4398312 CTTTCTTTTTTGGGGGCGGGGGG - Intergenic
1094086291 12:26595941-26595963 CTTTCTTTTCTACTGTTGGGAGG - Intronic
1094107317 12:26828169-26828191 CTTTCTCTTCTGTTAGTTGGAGG - Intronic
1094602236 12:31919589-31919611 ATTCCTTTTCTGGGGGTGGGAGG - Intergenic
1094712286 12:32976682-32976704 TTTTCTTTACTGTAAGTGTGTGG - Intergenic
1095110045 12:38284394-38284416 CTTTTTTATGTGTATGTGGGCGG - Intergenic
1095381856 12:41604685-41604707 CTTTCTTTTTTTTGGGGGGGTGG + Intergenic
1096103474 12:48983135-48983157 TTTACTTTTCTGTTGGTGGAAGG - Intergenic
1096132404 12:49170215-49170237 CTTTCTTTTCTGGGGGAGCGGGG - Intergenic
1096580438 12:52581385-52581407 CCTCCTTTTCTGTAGGAGAGGGG - Intergenic
1096612869 12:52814430-52814452 GTGTCTTTTCTGGAGGAGGGAGG - Exonic
1096665122 12:53159474-53159496 CTCTCTTTTCGGTAGGGGTGGGG - Intronic
1096981138 12:55728750-55728772 CTTTTTTTTTTTTTGGTGGGCGG - Intronic
1097649226 12:62275393-62275415 CTTTTTTTTTTTTGGGTGGGGGG - Intronic
1098868768 12:75792280-75792302 TTTTTTTTTTTCTAGGTGGGAGG - Intergenic
1099224308 12:79950774-79950796 GTTTTTTTTTTGTAGGGGGGTGG + Intergenic
1099715360 12:86286919-86286941 CATTCTTTTCTGTGGGTGCATGG + Intronic
1099953756 12:89332398-89332420 CTTTTTTTTTTGTAGGGGGAGGG - Intergenic
1100029847 12:90173148-90173170 CTCTCTTTTCTGTTGGTTGCTGG + Intergenic
1100433107 12:94547784-94547806 CTTTTTTTTAGGTAGCTGGGGGG - Intergenic
1100465927 12:94845301-94845323 CTGTCTTTTCTGCAGGGGAGGGG - Intergenic
1100716948 12:97316024-97316046 CTTTCTTTCCTCTAGGTGTTTGG + Intergenic
1101035873 12:100705839-100705861 CTTTCTTTTCTGAGGGTGGGAGG + Intergenic
1101228761 12:102717582-102717604 CTTTCTTTTGTGTTGATGTGGGG + Intergenic
1101526758 12:105538174-105538196 CTTTGTTTCCTCTAGATGGGAGG + Intergenic
1101531297 12:105575789-105575811 CTTTCCTTTCTCTGGGTTGGTGG + Intergenic
1103284461 12:119788659-119788681 CTTTCGTTTTTTTTGGTGGGGGG - Intronic
1103473811 12:121203593-121203615 CTTTCTTCTCTGCAGGTGACTGG - Intergenic
1103529071 12:121587744-121587766 CTTTTTTTTTTTTTGGTGGGGGG - Intergenic
1103563063 12:121802585-121802607 CTTTTTGTTCTATGGGTGGGTGG - Intronic
1103594269 12:122014124-122014146 CTTTCTTTTCTGTAAAAGGAGGG + Intergenic
1104452227 12:128879454-128879476 CTTTCTTTTTTTTGGGGGGGTGG + Intronic
1106989871 13:35406020-35406042 CTTTTTTTTCTGGAGATGGAGGG - Intronic
1107258663 13:38463106-38463128 CTTTCTTTTTTTTTTGTGGGGGG - Intergenic
1107268675 13:38588600-38588622 CTTTCTATACTGTAGATGTGTGG - Intergenic
1110231066 13:73168062-73168084 CTTTCTTTTGTGTGTGTGGCAGG + Intergenic
1111688961 13:91537124-91537146 CTTGTTTTTCTTAAGGTGGGAGG - Intronic
1111751509 13:92337193-92337215 CTTTTTTTTTTTTGGGTGGGGGG - Intronic
1111815526 13:93148009-93148031 CTTTCTTCTCTGCAGGAGAGCGG - Intergenic
1111930582 13:94509237-94509259 CTCCTTTTTCTGTAAGTGGGAGG + Intergenic
1112318249 13:98384183-98384205 CTTTTTTTTTTGTAGGGGGGCGG + Intronic
1112894938 13:104287250-104287272 CTTTGTTTTCTGTCGGGGGGGGG - Intergenic
1115452737 14:33566703-33566725 CTTTCTTCTCTGTAGTTGCAGGG + Intronic
1117315274 14:54566529-54566551 CTTTCTTTGCTGTCGTTGGGGGG + Intergenic
1119730796 14:76949902-76949924 CTGTCTTTTTTGTAAGTGGCAGG + Intergenic
1120693130 14:87615468-87615490 CTTTTTTTTTTGGAGGGGGGTGG + Intergenic
1121689555 14:95866638-95866660 CTTTCTACTCTGTAAGTGTGGGG + Intergenic
1123686662 15:22802951-22802973 CTTTTTTTTTTTTGGGTGGGTGG + Intronic
1123984977 15:25637164-25637186 CTTTCTTTTCTGGAGGACGGGGG + Intergenic
1125745330 15:41993766-41993788 CTTGCTTTTGGGAAGGTGGGAGG + Intronic
1126045985 15:44640371-44640393 CTTTCTTGTCTTTTGGGGGGCGG - Intronic
1126749947 15:51866458-51866480 CTTTCTTTTTTTTGGGTAGGGGG - Intronic
1126960415 15:53987474-53987496 CTTTCCTTTCTGTAGGATGATGG - Intergenic
1127212473 15:56787800-56787822 CTTTCTTTTCTTTTGGGGGATGG + Intronic
1127707335 15:61560296-61560318 CTTTCTTACCTCCAGGTGGGAGG + Intergenic
1127850569 15:62908544-62908566 ATATCTTTTCAGTAGCTGGGAGG + Intergenic
1128199231 15:65791386-65791408 TATTGTTTTCTGGAGGTGGGGGG - Intronic
1128446181 15:67763093-67763115 CTTTCTGTTCTGCAGCTGAGCGG + Intronic
1129115798 15:73364696-73364718 GTTTCTTTTCTATTGGGGGGTGG + Intronic
1129531386 15:76268175-76268197 TTTTTTTTGCTGTAGCTGGGAGG - Intronic
1129857483 15:78834967-78834989 CTTTCTTTTTTGGAGGGTGGGGG - Intronic
1130012882 15:80165703-80165725 CTTTTTTTTTTTTTGGTGGGGGG - Intronic
1130235687 15:82131465-82131487 ATTTTTTTTCTGGAGGTGGTGGG + Intronic
1130577029 15:85102166-85102188 CCTCCTTCTCTGGAGGTGGGTGG - Intronic
1130969566 15:88721384-88721406 CTTCCTTTTGTGTAGGTGATGGG - Intergenic
1131697927 15:94900445-94900467 CATTTTTTTCTCTTGGTGGGAGG + Intergenic
1131784361 15:95895955-95895977 CTCTGTTTATTGTAGGTGGGAGG - Intergenic
1132051907 15:98614442-98614464 CTTTCTTTTCTCTATGAGTGGGG - Intergenic
1132722635 16:1324309-1324331 TTCTCTTTTCTGTAGGTCTGGGG - Intronic
1133581005 16:7144723-7144745 TTTTCTCATATGTAGGTGGGAGG - Intronic
1133622855 16:7542924-7542946 CTTTCTTGTTTGTATGTGTGGGG - Intronic
1135109820 16:19681894-19681916 CTTATTTTTCTGTGGGTGGTGGG - Intronic
1135672080 16:24384059-24384081 CTTACTTTTCTGGGGGTGGCAGG - Intergenic
1136138281 16:28271554-28271576 CTCTCTTTTTTGGGGGTGGGGGG - Intergenic
1136986056 16:35106238-35106260 CTTTCTTTTTTGAGGGGGGGTGG - Intergenic
1137085511 16:36117265-36117287 CTTTCTTCTCTGCAGATGGCTGG + Intergenic
1137341344 16:47609424-47609446 CCCTCTTTTTTGTGGGTGGGGGG + Intronic
1139619271 16:68123984-68124006 TTTTTTTTTTTGTAGGGGGGTGG - Intronic
1141401539 16:83751447-83751469 CTTTCTTTTTTGTGGAGGGGAGG - Intronic
1141446784 16:84064582-84064604 CCTTGTTTTTGGTAGGTGGGTGG - Intronic
1141909298 16:87047647-87047669 CTTTTTTTTCTGCAGGAGGGTGG - Intergenic
1143080845 17:4380338-4380360 TTTTATTTTTAGTAGGTGGGGGG + Intergenic
1143553668 17:7647509-7647531 CTTTCTTTTTTAGAGATGGGGGG - Intronic
1143616632 17:8055232-8055254 CTTTCTTTTTTTTGGGGGGGTGG + Intergenic
1143619341 17:8072201-8072223 CAGTCTTTTGTCTAGGTGGGCGG + Intergenic
1144578254 17:16443449-16443471 TTTGCCTTTCTGTAGGTGGGTGG + Exonic
1144830432 17:18128106-18128128 CTGTCTTCTCTGTAGGTTGCTGG - Intronic
1145376293 17:22351939-22351961 CTTTCTTTTTTTTTGGGGGGGGG + Intergenic
1146102894 17:30003084-30003106 CTTTTTTTTTTGTAGCGGGGGGG + Intronic
1146321732 17:31852108-31852130 CTTTCTGCCTTGTAGGTGGGCGG - Exonic
1146977353 17:37125643-37125665 CTTTCTTATTTTTAGTTGGGAGG + Intronic
1147253376 17:39166603-39166625 CTTTCTTTGCTTAAGCTGGGGGG + Intronic
1147491568 17:40872510-40872532 CTTTTTTTTTTTTAAGTGGGAGG + Intergenic
1148202226 17:45756768-45756790 CTGTCTTGGCTGTCGGTGGGTGG + Intergenic
1148752712 17:49954684-49954706 CTTTCTTTTTTTTTGGAGGGGGG + Intergenic
1152026216 17:77811118-77811140 CTTCCTTTTCTGAATGAGGGTGG - Intergenic
1152487338 17:80602486-80602508 TTTTCTTTTTTTTTGGTGGGGGG + Intronic
1152891508 17:82884224-82884246 TTTCCTTTCCTGAAGGTGGGGGG + Intronic
1153189514 18:2522091-2522113 CCTTCTTTTCTCTAGGAGGGAGG + Intergenic
1153503172 18:5769290-5769312 CTTACTTTTCTGTAGGTTTGGGG + Intergenic
1155179703 18:23333808-23333830 TGTTCTTTTCTGGAGGTGGAGGG + Intronic
1155511561 18:26582691-26582713 CTTTCTTTTCTAGAGGTGCATGG - Intronic
1156013672 18:32523371-32523393 TTTTTTTTTTTGTAGGGGGGAGG - Intergenic
1156887603 18:42153430-42153452 CTTTCATTTCTGTATTTGGTTGG - Intergenic
1156927568 18:42600855-42600877 CCTTCTTTTCTGTAGCTGTGTGG + Intergenic
1158053013 18:53246381-53246403 CTATCTTGTGTGTATGTGGGAGG + Intronic
1158141984 18:54265661-54265683 CTGTATTTTATGTTGGTGGGTGG - Intergenic
1158536297 18:58311087-58311109 TTTCCTTTTCTGTAGTTGAGTGG + Intronic
1161483184 19:4521050-4521072 TTTTCTTTTCTTTGGGGGGGTGG - Intergenic
1161774466 19:6251761-6251783 CTTTTTTTTTTTTTGGTGGGAGG - Intronic
1162064308 19:8115773-8115795 CTTTCTTTTCTCCAGGGGCGGGG + Intronic
1162256213 19:9491980-9492002 TTTTCTTTTCTTTTGGGGGGGGG + Intronic
1164651819 19:29896144-29896166 TTTTTTTTTCGGTAGGTGGTGGG - Intergenic
1164974558 19:32562203-32562225 TTTTTTTTTTTTTAGGTGGGGGG - Intergenic
1166286295 19:41831768-41831790 CTTTCTTTTTTGGGGGTTGGGGG - Intergenic
1166659164 19:44634609-44634631 CTTTCTTTTCTGGAGGACGCTGG - Intronic
1166697074 19:44858151-44858173 TTTTCTTTTCTCAAGTTGGGTGG + Intronic
1167606920 19:50486173-50486195 CTTTTTTTTTGGTGGGTGGGGGG + Exonic
1167786251 19:51639336-51639358 CTTTCTATTCTGTACTTTGGTGG + Intronic
1168472528 19:56651050-56651072 CTTTCTTTTTTGAAAGAGGGTGG - Intronic
925745651 2:7041575-7041597 ATAGCTTTTCTGGAGGTGGGTGG + Exonic
926169048 2:10539561-10539583 CTCTCCTTCCTGGAGGTGGGGGG - Intergenic
926196187 2:10764968-10764990 CTTTTTTTTTTTTTGGTGGGGGG - Intronic
926988205 2:18647243-18647265 CTTTTTTTTATGTAGGAGGTAGG - Intergenic
927081511 2:19635257-19635279 CTTTCTTCTCTGCTGATGGGAGG - Intergenic
927161434 2:20266481-20266503 CTTTTTTTTTTTTTGGTGGGGGG - Intronic
927207523 2:20619457-20619479 CCTGCTTTGCTGTGGGTGGGAGG - Intronic
927441968 2:23125303-23125325 CTATTTTCTCTGTAGGTAGGAGG - Intergenic
929320290 2:40535421-40535443 TTCTCTTTTCTGTAGTTGTGTGG + Intronic
929698559 2:44141460-44141482 TTTTCTTTTCTGTAGGGTTGAGG + Intergenic
929860785 2:45675673-45675695 CTTTAATCACTGTAGGTGGGAGG + Intronic
929886379 2:45882685-45882707 CTTTCTCTTCCGTTGGTGGATGG - Intronic
930953571 2:57175729-57175751 CTTTATTTTCTGCAGCTGGAAGG - Intergenic
932070260 2:68612775-68612797 CTTTTTTTTTTTTTGGTGGGGGG - Intronic
932925991 2:75975156-75975178 CTTTCTTATCTGTTGGGGAGAGG + Intergenic
934501434 2:94862838-94862860 GTTTTTTTTTTGTGGGTGGGGGG + Intergenic
936693358 2:114918933-114918955 CTTTCTTTTTTTTAGGTTCGGGG - Intronic
937738986 2:125326615-125326637 TTTTATCTTCAGTAGGTGGGAGG - Intergenic
937915141 2:127095259-127095281 CTTTCTTTGTGGGAGGTGGGAGG + Intronic
939203051 2:139063062-139063084 CTTCCCTTCCTGGAGGTGGGGGG + Intergenic
939386600 2:141508083-141508105 CTTTCTTTTTTTTTGGGGGGGGG - Intronic
939658366 2:144855517-144855539 TTTTCTCTTCTGTAGTTAGGTGG + Intergenic
940265503 2:151831485-151831507 TTTTCTTTTTTTTTGGTGGGGGG + Intergenic
941511043 2:166410317-166410339 CTTTCCTTTCTTTACCTGGGAGG - Exonic
943504031 2:188731021-188731043 CTTGCTTTTATAAAGGTGGGTGG + Intergenic
944640252 2:201717467-201717489 TTTTTTTTTTTGGAGGTGGGAGG - Intronic
944736676 2:202573048-202573070 CTTTCTTTTTTTTGGGGGGGGGG - Intergenic
945788247 2:214271844-214271866 CTTTCTTTTTTTTTGGGGGGGGG - Intronic
945830460 2:214778204-214778226 TTTTCTTTTTTGGGGGTGGGGGG - Intronic
945839778 2:214873685-214873707 CTTTCTAGTCTGTAGGCAGGTGG - Intergenic
945902438 2:215554055-215554077 CCTTCTTTTTTGTGGGTGTGAGG - Intergenic
946293797 2:218766636-218766658 CTTTCTTTTTTTTGGGGGGGGGG + Intergenic
946761791 2:223001731-223001753 ATTTGTTTTTTTTAGGTGGGTGG + Intergenic
947189393 2:227486249-227486271 CTTTCTTTTCTGTGGGGTGGGGG + Intronic
947457130 2:230265376-230265398 CTTTTTCTTCTGCAGCTGGGAGG - Intronic
947945810 2:234101306-234101328 CTTTGTGGTCTGTAGGTTGGGGG + Intergenic
948539361 2:238676534-238676556 CTTTCTTTTGTGTGTGTGTGTGG + Intergenic
948929080 2:241119246-241119268 CTGTCTTTTCTTTCGGAGGGTGG + Intronic
1168906375 20:1407246-1407268 CCTTCTTTTCTGTGTGTGTGGGG - Intergenic
1169114224 20:3052554-3052576 TTTTCTTTTTTTTTGGTGGGGGG - Intergenic
1170000417 20:11608271-11608293 CCTTCTTCCCTCTAGGTGGGGGG - Intergenic
1170858503 20:20080335-20080357 CTTTCTTTTCTGATGGTGCCTGG + Intronic
1171026419 20:21634465-21634487 CTTTTTTTTTTTTTGGTGGGGGG - Intergenic
1173038510 20:39436186-39436208 CTTTCTTTTTTGTGGGGTGGCGG + Intergenic
1173265597 20:41477062-41477084 CTTTCTTTTTTGTAGAGGTGAGG - Intronic
1174506345 20:51020117-51020139 CTGTCTTTTTTATAGGGGGGAGG - Intronic
1175365026 20:58447281-58447303 CTTTTTTATTTGTAGGTGTGAGG + Exonic
1175500658 20:59448158-59448180 CTTTCTCTTCCGTAATTGGGAGG - Intergenic
1175660149 20:60805259-60805281 CCTTTTTTTTTGTGGGTGGGAGG + Intergenic
1177256462 21:18669322-18669344 CTCTCTTTTTTGTACGGGGGAGG + Intergenic
1178293247 21:31387210-31387232 TTTTTTTTTTTGGAGGTGGGGGG + Intronic
1179122018 21:38556684-38556706 CTTTCTTTTCAGCCAGTGGGTGG - Intronic
1181591472 22:23888009-23888031 CTTTTTTTTGGGTGGGTGGGGGG + Intronic
1181603379 22:23965513-23965535 CTTTCTTTTTTGTGGGGGAGGGG + Intergenic
1181605135 22:23975794-23975816 CTTTCTTTTTTGTGGGGGAGGGG - Intronic
1182049882 22:27304555-27304577 CTTTCTTTTATGAAAGTGGGAGG - Intergenic
1182670315 22:31990335-31990357 CTTTCTATTCTCTAGGGGGTAGG + Intergenic
1182740331 22:32562830-32562852 CCTTCCTTTCTGTTGTTGGGGGG + Intronic
1182939216 22:34258467-34258489 CTTTCTTTTTTGTGGTGGGGAGG + Intergenic
1183804257 22:40194754-40194776 TTTTCTTCTCTATTGGTGGGGGG - Intronic
1183908512 22:41061227-41061249 CTTTCTTTTTTTTGGGGGGGTGG + Intergenic
1184980733 22:48094416-48094438 CTCTCTTTTTTGGGGGTGGGGGG - Intergenic
949443937 3:4113528-4113550 CTTTCTTTTTTGGGGGTGGGGGG - Intronic
949515916 3:4806878-4806900 CTTACTTTCCTGTAGTTGGAGGG + Intronic
949522995 3:4873703-4873725 CTCTCTTGTCTGGAGGTTGGTGG + Intronic
950713064 3:14827625-14827647 CTTTCTTTTCTGCTGGCTGGTGG + Intronic
951428534 3:22578187-22578209 CTTTCTTATCCGTTAGTGGGAGG + Intergenic
953789178 3:45933712-45933734 TTTTATTATGTGTAGGTGGGGGG - Intronic
953799651 3:46012697-46012719 CTTTCCTTTTTTTTGGTGGGGGG + Intergenic
954168566 3:48780968-48780990 CTTTTTTTTCTTTTGGTGGTGGG + Intronic
954210200 3:49092936-49092958 TTTTCTTTTGCGTAAGTGGGAGG - Intronic
954876170 3:53804489-53804511 TTTTCTTTTCTGGGGGTTGGGGG - Intronic
955098036 3:55819623-55819645 CTTTCTTTTCTCTCTGTGTGTGG - Intronic
955456348 3:59126178-59126200 CTTTTTTTTTTGTGGGGGGGTGG + Intergenic
955635864 3:61028878-61028900 TTTTTTTTTTTGTTGGTGGGGGG - Intronic
955830544 3:62997433-62997455 CTTTCTTATCTATAGATGAGGGG + Intergenic
955909435 3:63845093-63845115 CCTTCTTTTCTGGGGGTGGGGGG + Intronic
957254932 3:77824950-77824972 TTTTCTCTTCTGTAGGGGGTGGG + Intergenic
957264993 3:77951759-77951781 CTTTCTTGTCTTTTTGTGGGAGG - Intergenic
957681487 3:83441221-83441243 CTTTTTTTTCTGGTGGGGGGTGG - Intergenic
958438069 3:94122142-94122164 TTTTTTTTTTTTTAGGTGGGGGG - Intronic
958473166 3:94548295-94548317 CTTTCATTTCTTTTGATGGGTGG - Intergenic
958717562 3:97803854-97803876 CTTCCTTTTCTTTAAATGGGTGG + Intergenic
960089501 3:113625131-113625153 CTTTCTTTTTTTTGGGGGGGCGG + Intronic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961969961 3:130952487-130952509 TTTTCTTTTCTTTTGGTGGGGGG - Intronic
962606516 3:137036634-137036656 CTTTCTTTTTTTTTGGGGGGGGG + Intergenic
962606593 3:137037344-137037366 CTTTCTTTTCTCTTGGGGAGAGG + Intergenic
962694914 3:137938539-137938561 CTTACTTTTCTGTAGGCTAGAGG - Intergenic
962845387 3:139269759-139269781 CTTTCTTTTATGTAGGCTGGAGG - Intronic
963067607 3:141275663-141275685 CTTTCTTTCCAGTAGTTGGAAGG - Intronic
963205482 3:142630100-142630122 TTTCTGTTTCTGTAGGTGGGGGG - Intronic
963316691 3:143766538-143766560 TTTTCTTAGCTGTAGGTGGAGGG + Intronic
963778818 3:149466286-149466308 CCTTCATTTCTGCAAGTGGGAGG + Intergenic
965557507 3:170033365-170033387 GGTTCTTTTCAGTCGGTGGGGGG + Intergenic
965602562 3:170469484-170469506 CTTTCTTTTCTGTAGGTGGGGGG + Intronic
965836322 3:172856955-172856977 CTTTCTGTTCTGTATGTTAGTGG + Intergenic
967944108 3:194788638-194788660 CTTTCCCTCCTGTAGGTGGAAGG + Intergenic
968244909 3:197134946-197134968 CTTTCTTTTCTCTGGATGGCTGG + Intronic
970437498 4:16049507-16049529 ATTTCTTATTTGTGGGTGGGGGG - Intronic
971246952 4:24938061-24938083 ATTTCTTCTCTGTTGATGGGTGG + Intronic
971447948 4:26772428-26772450 CTTTATTTTTTCTGGGTGGGGGG + Intergenic
972917937 4:43903862-43903884 CTCTCTTTTCTGCAGGTAAGAGG + Intergenic
974016300 4:56652397-56652419 ATTCCATTTCTGGAGGTGGGTGG + Intronic
974971348 4:68832458-68832480 CTTTCTTTTTTGAAAGTTGGGGG - Intergenic
974982860 4:68982012-68982034 CTTTCTTTTTTGAAAGTGGGGGG - Intergenic
975224443 4:71855458-71855480 TTTTCTTTTCTCTAGGTTAGTGG - Intergenic
975563500 4:75729335-75729357 CTTTTTTTTGGGTAGGGGGGTGG + Intronic
976673995 4:87684350-87684372 GTTTTTTTTCTGTAGGGGTGGGG + Intergenic
976722401 4:88181556-88181578 TTTTATTTTTTGTAGGTGTGGGG - Intronic
977066791 4:92327813-92327835 CTTTCTATTCTCTACGTGAGGGG - Intronic
978126567 4:105143406-105143428 TTTTCTATTCTGCAGGTGGGAGG + Intergenic
978275908 4:106949387-106949409 ATCTCTTCTCTGTGGGTGGGTGG + Intronic
978410662 4:108421525-108421547 TTTGCTTTTCTGTGGTTGGGAGG - Intergenic
978449463 4:108815465-108815487 CTTTCCTTTCTGGGGATGGGTGG + Intronic
979491390 4:121331981-121332003 CTTTCTTTCAAGTAAGTGGGAGG + Intronic
979820796 4:125167875-125167897 CTTTCTTTTTTTTGGGGGGGGGG - Intergenic
980283771 4:130756200-130756222 CTCTCTTTTCTCCAGGTGGATGG + Intergenic
981420677 4:144546682-144546704 CTTTCTTTCCAGGGGGTGGGTGG + Intergenic
981900637 4:149857929-149857951 TTTTATTTTCTGTTGGTGGTGGG - Intergenic
982102706 4:151983834-151983856 TTTTCTCTTCTGTAGGAGTGAGG - Intergenic
982276997 4:153645945-153645967 CTTTCTTTTCTGGGGAGGGGGGG + Intergenic
982693044 4:158569797-158569819 TGTTCTTTTTTGTTGGTGGGGGG + Intronic
983526295 4:168763559-168763581 GTGTCTTTTCTGTAAGTGTGTGG - Intronic
983838565 4:172425269-172425291 CTTTCCTTTCTGCAGATTGGTGG + Intronic
984169663 4:176344611-176344633 CTTTCTTTTCTGGAGGATGCTGG + Intergenic
984804626 4:183739906-183739928 GTTTTTTTTTTGGAGGTGGGTGG + Intergenic
985197542 4:187448537-187448559 CTTTGTTTTGAGGAGGTGGGAGG - Intergenic
985677706 5:1240760-1240782 ATTTCATTTCTGTAGGGGTGTGG + Intronic
986198843 5:5562480-5562502 CTTTTTTTTCTGTTGGGGGTGGG + Intergenic
987387524 5:17344126-17344148 CGTTGTTTTCTGGAGGTGGGGGG + Intergenic
987645995 5:20672843-20672865 GTTTCTTTTCTTGAGGAGGGAGG - Intergenic
988418482 5:30976026-30976048 TTTTTTTTTCTGTAGATGGTAGG - Intergenic
988968425 5:36442537-36442559 CTTTCTTATCTGTATGTCTGTGG + Intergenic
990206027 5:53430408-53430430 CTTTCTTCTGTGTATGTGGCAGG - Intergenic
990875737 5:60483154-60483176 GTTTCTTTTCTGGGGGTGGGTGG + Intronic
990891400 5:60654362-60654384 TTTTCTTTTTTTTTGGTGGGGGG + Intronic
991418703 5:66418456-66418478 GTTTCTTTTCTGTAAGTGTTTGG + Intergenic
992523158 5:77577313-77577335 TTTTCTTTTTTTTTGGTGGGGGG - Intronic
992733963 5:79700299-79700321 AGTTATTTTCTGTAGGTGAGAGG + Intronic
993721591 5:91326335-91326357 GTTCATTTTCTGTAGGTGGACGG - Intergenic
993798135 5:92296185-92296207 CTTTTTTTTCTGTAGCAAGGTGG + Intergenic
994190073 5:96859471-96859493 CATTCTCCTCTGTAGGTGGATGG + Intronic
994301827 5:98156986-98157008 CTTTCTTTCCTGCAGGTAAGAGG - Intergenic
995520094 5:112995294-112995316 CTTTTCTTTCTGTAGATGGTAGG + Intronic
996286383 5:121797914-121797936 TTTTCTTGTCTGAAGGTGTGGGG - Intergenic
996291774 5:121860074-121860096 CTTTCTTTTCTGGAGGACGCTGG - Intergenic
997044537 5:130298435-130298457 CTTTCCTTTTGGTAGGTAGGTGG - Intergenic
997050615 5:130375320-130375342 CTTTTTCCTCTGTAGGTGGAAGG + Intergenic
997078835 5:130714635-130714657 ATTTCTTCTTTGCAGGTGGGAGG - Intergenic
997448342 5:133960272-133960294 TTTTCTTTTCTTTTGGTGGCAGG - Intronic
998246294 5:140508760-140508782 CTTTCTTTTTTGTGGGGGCGGGG - Intronic
998419516 5:141970689-141970711 ATTTCTTTTCTGCAGATGGCAGG + Exonic
998485797 5:142500827-142500849 GTTTCTTTTATGTATGTTGGGGG + Intergenic
998835052 5:146195286-146195308 CTTGCGTTTCTGTAGGTTAGAGG + Intergenic
999945535 5:156591457-156591479 CTTTCCTCCATGTAGGTGGGAGG - Intronic
1000675455 5:164117073-164117095 CATTCTCTTCTTTTGGTGGGTGG + Intergenic
1001411103 5:171512640-171512662 CTTCCTTGTCTGTAGGTGGAAGG + Intergenic
1001727291 5:173915937-173915959 TTTTCTTTTCTGTATGTGAAGGG + Intronic
1002663983 5:180809844-180809866 CTTTCCTTCCTGTAGGGGCGTGG + Intronic
1002893328 6:1356745-1356767 CTTTTTTTTTTTTTGGTGGGGGG - Intergenic
1003181857 6:3798935-3798957 CTTTATTTTCTCTAAGTGGCTGG - Intergenic
1004301558 6:14462845-14462867 TTTTCCTTTCTGGAGGTGTGAGG - Intergenic
1004459082 6:15818961-15818983 CTTTTTATTATGTTGGTGGGGGG - Intergenic
1005142476 6:22649306-22649328 CTTTCTTTTTTGGCGGGGGGTGG - Intergenic
1007341379 6:41193330-41193352 CCTCCTTTTCTGTGGGTGGGAGG + Intronic
1007393229 6:41562492-41562514 CTTTCTTTTCTTTTTATGGGGGG - Intronic
1008002702 6:46377151-46377173 CATTCTCTTCTGAAAGTGGGTGG + Intronic
1009176595 6:60467502-60467524 CTTTCTTTCCTTTAGTTGGGGGG - Intergenic
1010476003 6:76288146-76288168 TTTTCTTTTTTTTTGGTGGGGGG + Intergenic
1010517786 6:76794257-76794279 CTTACTTTTTTGTAGGAGGCAGG - Intergenic
1010716725 6:79238934-79238956 CTTTCTCTTCTGTAGTTGCAAGG + Intergenic
1012143249 6:95650019-95650041 TTTTCTTTTCTGTAAGATGGAGG - Intergenic
1013052998 6:106555165-106555187 TTTTCTTTTCTTTTGGTGGCGGG - Intronic
1014440000 6:121462917-121462939 TTTTCTTTTCTGGTGATGGGTGG + Intergenic
1014608717 6:123513708-123513730 CTTTTTTTTCTGTAGGTTATTGG + Intronic
1016044504 6:139467312-139467334 TTTTCTTTTCTGGAGATGGGGGG + Intergenic
1016340556 6:143057735-143057757 CTTTTTTTTCTTTTGGAGGGGGG - Intergenic
1016847267 6:148580865-148580887 CTTTTTTTTTTTTTGGTGGGGGG + Intergenic
1018151728 6:160945897-160945919 GTTTTTTTTTTGTGGGTGGGAGG + Intergenic
1020326949 7:6982031-6982053 CTTTCTTTTCACTTGGTGTGGGG + Intergenic
1021543013 7:21781642-21781664 GTTTCTGTTCTGAATGTGGGTGG + Intronic
1021823902 7:24528013-24528035 CTTTCCTTTCTGTTGATGAGTGG - Intergenic
1023116107 7:36864249-36864271 CTTTCTCTTCTGCAGGGGGATGG + Intronic
1023295465 7:38710701-38710723 ATTTCTATACTGTAGGTTGGAGG - Intergenic
1023632519 7:42178445-42178467 TTTGTTTTTCTGTAGGTGGTGGG - Intronic
1023759781 7:43454169-43454191 CTTTCTTTACTGTAGGTTCCTGG + Intronic
1025548072 7:62202613-62202635 CTTTCTTTTCTTTAGGAGTTTGG - Intergenic
1027390899 7:77702545-77702567 ATTTCTTTTCTCTGGGTGGTGGG + Intronic
1028100617 7:86815474-86815496 CTTTCTTTTGTATAAGTTGGGGG - Intronic
1028109801 7:86926392-86926414 TTTTCTTGTCTGTAGGATGGTGG - Intronic
1028368137 7:90058874-90058896 CTTTCTCTTCTGTAGGTTTCAGG + Intergenic
1029471964 7:100760306-100760328 CTTTCATTTCCATAGCTGGGAGG - Intronic
1030365834 7:108645159-108645181 GGTTCTATTCTGTAGGTGAGAGG - Intergenic
1030621367 7:111794725-111794747 CTGCCTTCTCTGTAAGTGGGAGG - Intronic
1031866660 7:127044327-127044349 CTTCCTTGTCTGTAGGCAGGTGG - Intronic
1032171078 7:129585086-129585108 CTTCCTGTTATGTATGTGGGGGG + Intergenic
1032300896 7:130685867-130685889 CTTTCTTTTCTCTAAATGGTTGG - Intronic
1032580944 7:133103154-133103176 TTTTCTTTTTTTTTGGTGGGGGG + Intergenic
1032832530 7:135642361-135642383 TTTTCTTTTCTGTAGGGACGGGG + Intronic
1033351426 7:140565322-140565344 CATGCTTTTCTGGGGGTGGGGGG + Intronic
1035359142 7:158298817-158298839 TTTACTTTTTTGAAGGTGGGAGG - Intronic
1035761516 8:2072235-2072257 CTTTCTTTTTTGGGGGCGGGGGG - Intronic
1035859850 8:3016077-3016099 CTTTCTTATCTGCAGGTCGAAGG + Intronic
1035993994 8:4525195-4525217 CTTCCTTTTTTGTTGGTAGGTGG - Intronic
1036007753 8:4686468-4686490 ATTTCTTTTCTCTAGGTATGGGG - Intronic
1036411357 8:8505161-8505183 TTTTTGCTTCTGTAGGTGGGTGG + Intergenic
1036765114 8:11544890-11544912 CTTTCTTGTCTGAAGTTGGGAGG - Intronic
1036935473 8:12997937-12997959 CATTCTTTTGTATAGGTGGTGGG + Intronic
1037580759 8:20244842-20244864 ATTTTTTTTCTGGAGATGGGAGG - Intergenic
1038662655 8:29510573-29510595 CTTTTTTTTTTTTTGGTGGGGGG + Intergenic
1039025599 8:33254573-33254595 TTCTCTTTTCTGTAGATGGAGGG + Intergenic
1039299482 8:36194217-36194239 GTTTCTTTTCATTAGGTGAGAGG - Intergenic
1041005855 8:53496469-53496491 CTTCCTTCTGTGTGGGTGGGAGG - Intergenic
1041638606 8:60172605-60172627 CTTTACTTTTTGTAGTTGGGCGG - Intergenic
1042384720 8:68161093-68161115 CTTTCTTTTTTTTTGGGGGGGGG + Intronic
1042754559 8:72196419-72196441 CTTTCCTTGCTGTGGGTGAGTGG + Intergenic
1043525169 8:81088715-81088737 GCTTCTTTTCTGAAGGTGGGTGG - Intronic
1043761177 8:84070071-84070093 CTTTCTTTTCTTTTGAAGGGTGG + Intergenic
1045629205 8:104096867-104096889 CTTTTTTTTTTTTTGGTGGGGGG - Intronic
1045874144 8:106959337-106959359 CTTTCTTTCCCCTATGTGGGAGG + Intergenic
1045908801 8:107381099-107381121 CTTTGTTTTATGTTGCTGGGTGG + Intronic
1046196972 8:110878000-110878022 TTTTCTTTTTTTTTGGTGGGGGG - Intergenic
1046593398 8:116232210-116232232 TTTTTTTTTCTGTACATGGGAGG - Intergenic
1047110616 8:121785259-121785281 TTTTTTTTTCTGTTGGGGGGAGG + Intergenic
1047265768 8:123307226-123307248 CTTTCTTTTTTGAACCTGGGAGG + Intergenic
1048784862 8:138039800-138039822 CTTCTTTTTCTGGAAGTGGGTGG + Intergenic
1049571569 8:143372422-143372444 ATTTCTTTTCTGGAGGAGGCGGG + Intronic
1050421086 9:5465860-5465882 CTTTCTCTTCTGTAAGTCTGTGG - Intronic
1050606966 9:7312046-7312068 CTTTTTTTTTTGTTGGCGGGGGG - Intergenic
1051516989 9:17940803-17940825 CTTTCTTTTTTTTGGGGGGGGGG - Intergenic
1051558184 9:18408473-18408495 TTTTTTTTTCTGTGGGTGGGGGG - Intergenic
1051713920 9:19961838-19961860 CTTCCCTGACTGTAGGTGGGAGG - Intergenic
1052246748 9:26346357-26346379 TTTTTTTTTCTGCAGGTGGGAGG - Intergenic
1053476264 9:38384210-38384232 CTTTCATTTCTGTGGCTTGGTGG - Intergenic
1055065167 9:72111230-72111252 CTTTCTTTTCTGCAGGGGAGGGG + Intergenic
1055269515 9:74541789-74541811 CTTTCATTTCAATAGGTGTGGGG + Intronic
1056270183 9:84939949-84939971 CTTTCTTTTGAGTTGCTGGGAGG - Intronic
1057482616 9:95457226-95457248 CTTTCTTCTCTGGGGGTGGGTGG + Intronic
1058578491 9:106429431-106429453 TTTTGTTTTTTTTAGGTGGGCGG - Intergenic
1059025478 9:110623841-110623863 CTTACCCTTCTGCAGGTGGGAGG - Intergenic
1059331782 9:113540136-113540158 CTTCATTATCTGTAGCTGGGGGG + Intronic
1060835995 9:126755561-126755583 CTTGCTTCTCTCTGGGTGGGTGG - Intergenic
1061042675 9:128149081-128149103 CTTTCCTTTCTGTGGGTGTGGGG + Exonic
1061797988 9:133099349-133099371 CTTCCTTTTCTGTAAGATGGGGG + Intronic
1061812843 9:133172570-133172592 CTTCCTTTTCTGGGGGAGGGGGG + Intergenic
1062585705 9:137248692-137248714 CTTTCTTTTTTGTAGAGGTGGGG - Intergenic
1185471388 X:386199-386221 CTTTCTTGTCTGTATGTGTGTGG + Intronic
1186186635 X:7026752-7026774 CATTCTTTGCTGTGGGAGGGGGG - Intergenic
1186282243 X:8005499-8005521 CTAAATTTTCTGTAGGTGGTAGG + Intergenic
1186878452 X:13840305-13840327 CTTAGATTGCTGTAGGTGGGTGG - Intronic
1187081469 X:15993728-15993750 CTTTATTTTCTGAAGATGGGGGG + Intergenic
1187272111 X:17788660-17788682 GTTTCTTCCCAGTAGGTGGGTGG + Intergenic
1187975481 X:24701100-24701122 CTTTCTTTTTTGGGGGTGGGAGG - Intronic
1190257436 X:48774069-48774091 ATTTATTTTGTGGAGGTGGGTGG - Intergenic
1192558721 X:72110715-72110737 TTTTTTTTTTTTTAGGTGGGAGG - Intergenic
1193421205 X:81284395-81284417 CTTTTTTTTTTTTTGGTGGGGGG - Intronic
1195540241 X:106055078-106055100 TTTTCTTTTCTGCAGCTGTGAGG - Intergenic
1196193167 X:112814743-112814765 CTTTCTCTGTTGTATGTGGGGGG - Intronic
1196722900 X:118871533-118871555 GTTTCTAGTCTGTAGTTGGGAGG - Intergenic
1197802720 X:130368394-130368416 CTTTCTTTTGTGTGTGTGTGGGG - Intronic
1197969059 X:132096018-132096040 CTTTTTTTTTTGGAGGTGGGGGG + Intronic
1198685065 X:139220087-139220109 ATCTCTTTGCTGTAGATGGGAGG - Intronic
1199303369 X:146238720-146238742 CTTACTTTTCTGTATGTGTCTGG + Intergenic
1199454123 X:148008694-148008716 CTCTCTTTTCTGGAGGAGGTAGG + Exonic
1200428367 Y:3047051-3047073 CTTTCTTTTTGGTAGGAGAGGGG + Intergenic
1201161074 Y:11167807-11167829 TTTTTTTTTTTGTCGGTGGGGGG - Intergenic
1201540967 Y:15104053-15104075 CTTTCTTTTTTTTGGGGGGGTGG + Intergenic
1202585682 Y:26424205-26424227 CTTTTTTTTCTGGGGGCGGGAGG - Intergenic