ID: 965603707

View in Genome Browser
Species Human (GRCh38)
Location 3:170479410-170479432
Sequence TCTGATGTTCATGAGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965603707_965603711 23 Left 965603707 3:170479410-170479432 CCAGCCACCTCATGAACATCAGA 0: 1
1: 0
2: 0
3: 16
4: 155
Right 965603711 3:170479456-170479478 TACTGCAAATACAATAGAAATGG 0: 1
1: 0
2: 0
3: 26
4: 433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965603707 Original CRISPR TCTGATGTTCATGAGGTGGC TGG (reversed) Intronic
901107132 1:6765248-6765270 GCTGATGTCAATGAGGTGGTTGG - Intergenic
901166144 1:7222915-7222937 GGTGATGCTCATGAGGTGCCCGG + Intronic
901604950 1:10451834-10451856 TCTGATGTTCATTATGGTGCTGG + Exonic
903647089 1:24902230-24902252 GCTGGGGTTCATGAGGTTGCCGG + Exonic
909959708 1:81824763-81824785 TCTGAAGTTTATTAGGTGGAGGG + Intronic
910229272 1:84969272-84969294 TCAGAAGTTCCAGAGGTGGCTGG + Intronic
912785357 1:112598016-112598038 TCTGATGGTCCTGAGCTGACAGG + Exonic
912951756 1:114125090-114125112 TCTGATGCACTTGAGGTGGGAGG - Intronic
913291022 1:117271952-117271974 TCTCATGTTCATGTAGGGGCAGG + Intergenic
914241297 1:145854815-145854837 TGTGATGTTGATGGGGCGGCTGG + Exonic
915702162 1:157806332-157806354 GCCGATGTTCTTGAGGTGGCAGG + Intronic
917046580 1:170867219-170867241 TTTGATCTTCAAGAGGTGGGGGG - Intergenic
918526927 1:185474842-185474864 TATAATGTTCATTATGTGGCAGG - Intergenic
918527564 1:185481476-185481498 GCTGATGCTCCTGAGGTGGCAGG - Intergenic
920074031 1:203324060-203324082 TCTGAGATTCAGGAGGTTGCGGG + Intergenic
922273797 1:224057985-224058007 TCTGAACTTCATGTGGTAGCAGG + Intergenic
1064045140 10:12007042-12007064 TCTGTTGTTCATAAGTTGCCCGG + Intronic
1064186783 10:13168769-13168791 TCAGATATTGATGAGGTGGTGGG + Intronic
1064193966 10:13230627-13230649 TCTGATGTGCAAGAGGAGGCTGG + Intronic
1065363202 10:24908839-24908861 TCTGGTTTTCTTGAGGTGGCTGG - Intronic
1065564515 10:26995427-26995449 TCTGATGGTCATGATGTTACTGG + Intronic
1066217580 10:33302621-33302643 TCTGCTGTTAATGAGGAGGTAGG + Intronic
1072397736 10:95062751-95062773 TCTGATGTTTTTGCAGTGGCTGG + Intronic
1073431237 10:103488791-103488813 TCTGAACTTCAGGGGGTGGCTGG - Intergenic
1073930971 10:108576342-108576364 TCTGAGGTACATGAGGAGGATGG + Intergenic
1076506847 10:130983978-130984000 TCTTACATTCACGAGGTGGCAGG - Intergenic
1078582378 11:12548389-12548411 TCTCATGTCCCTGAGGTGGGAGG + Intergenic
1079556327 11:21762090-21762112 TCTGAAGTTGATGAGTTGGTAGG - Intergenic
1080932154 11:36822193-36822215 TCTGAGGTTCATGAGGGTGACGG + Intergenic
1083539009 11:63498693-63498715 TCTGGTGTTCCTGTGGTGGGGGG + Intergenic
1083632568 11:64103408-64103430 TCAGATGTTCATGGTGGGGCTGG - Exonic
1083991547 11:66249158-66249180 TCTGATGTTCTTCTCGTGGCTGG + Intergenic
1085184244 11:74561977-74561999 TCAGTTGTTGATGAGGTGGATGG + Intronic
1085277048 11:75307019-75307041 TCTGATGGACAGGAGGTGCCTGG - Intronic
1085332275 11:75663549-75663571 TCAGGTGTTCATGACGTGGTGGG + Intronic
1085452038 11:76639990-76640012 TCAGCTGTTCATGAGGTGCCTGG + Intergenic
1086222332 11:84463334-84463356 TCTGATATTCCTGAGGAGGATGG - Intronic
1088391525 11:109320073-109320095 TCTGATCATCATGAAGAGGCTGG + Intergenic
1089417124 11:118301580-118301602 TCTGATGATAAGGAGGAGGCAGG + Intergenic
1091327288 11:134700815-134700837 CCTGATCGTCAGGAGGTGGCCGG + Intergenic
1095094396 12:38138086-38138108 TCTGATTTTCAATAGATGGCAGG - Intergenic
1095694435 12:45128882-45128904 TCTGCTGTTAATAAGGAGGCCGG - Intergenic
1097459867 12:59848158-59848180 TGTGCAGTGCATGAGGTGGCTGG - Intergenic
1097510967 12:60539514-60539536 TCTGCAGTACATGAGGTGCCTGG + Intergenic
1099710617 12:86219948-86219970 TCTGATTGTCATCAGTTGGCAGG - Intronic
1107682519 13:42866397-42866419 TCTGATGTTCAAGAGCAGGAAGG - Intergenic
1110369280 13:74721318-74721340 ACTGAACTTCATGAGGTGGCAGG - Intergenic
1114293727 14:21310154-21310176 TATAATGATCATGATGTGGCAGG + Intronic
1114364118 14:22008707-22008729 TCTGATATACAAGAGGTTGCTGG - Intergenic
1117825653 14:59700256-59700278 TCTTATGTTCATGAATTGGAAGG + Intronic
1119532857 14:75375113-75375135 TCTGATCTTGATCAGGTGCCTGG - Intergenic
1120976566 14:90254144-90254166 TCTGATGTGCTTGAGGTTGCAGG + Intergenic
1123767644 15:23497348-23497370 TATGTTGTTAATAAGGTGGCAGG + Intergenic
1124789430 15:32713422-32713444 ACTGATGTTTATTAGGTGCCTGG + Intergenic
1124914754 15:33959006-33959028 GCTGATGTTGATGTGGTGCCAGG - Intronic
1125880843 15:43193469-43193491 TCAGCTGTTCATGAAGTAGCTGG + Intronic
1126858618 15:52862388-52862410 TCTGCTCTTTTTGAGGTGGCAGG + Intergenic
1128706952 15:69843444-69843466 TGTGAAGTCCCTGAGGTGGCTGG + Intergenic
1130577618 15:85106309-85106331 TCTGAAGTTCAGGAGGAGCCTGG - Intronic
1131423211 15:92324743-92324765 TCTTATGGCCATGAGGTGGCAGG - Intergenic
1135951925 16:26922391-26922413 TCTTGAGTTCATGAGGAGGCAGG - Intergenic
1136338223 16:29624810-29624832 TCTAATTTTACTGAGGTGGCTGG - Intergenic
1137761608 16:50945345-50945367 GCTGATGTTCACCAGCTGGCTGG - Intergenic
1138199928 16:55080983-55081005 TCTCAGGTGCATGGGGTGGCAGG + Intergenic
1142040951 16:87893723-87893745 TCTGATTTTACTGAGGTAGCTGG - Intronic
1142760341 17:2038409-2038431 TATGCTGTACATGAGGTTGCAGG - Intronic
1146411436 17:32589166-32589188 TCTGATGGCCACAAGGTGGCCGG + Intronic
1150918066 17:69456527-69456549 TGTGACGTTCATAAGGTGGATGG + Intronic
1161196600 19:2989877-2989899 TCCCAGGTTCAGGAGGTGGCAGG - Intronic
1162889386 19:13721483-13721505 TGTGATGGTCATGAGGAAGCTGG + Intergenic
1164820398 19:31245949-31245971 GCTGATGTGCATGAAATGGCTGG + Intergenic
1167420645 19:49401020-49401042 TCTGCTGTTCATGAGATTGATGG + Intronic
1167623059 19:50569284-50569306 TCTTCTCTTCATGAGGTGGAGGG - Intergenic
926864908 2:17345789-17345811 TCTGATGTTAATGACATGGAAGG + Intergenic
928737996 2:34314866-34314888 TCTGGTGTTCAAGAGGAGCCAGG + Intergenic
931106006 2:59056471-59056493 AATGGTGTGCATGAGGTGGCTGG + Intergenic
933246073 2:79976052-79976074 TTGTATGTTAATGAGGTGGCTGG - Intronic
933643126 2:84785485-84785507 GCTGATGTTCATGGGGAGGTGGG - Intronic
935109565 2:100079887-100079909 TCTGATGTTCCTCAAGTGCCTGG + Intronic
938021157 2:127906700-127906722 TCTGATGCTCATCACGTGGGTGG + Intergenic
944680663 2:202073805-202073827 TGTGTTGTTAGTGAGGTGGCGGG + Intronic
945223370 2:207506906-207506928 TCTGCTCTTCATGTGGTGGCTGG - Intergenic
946109787 2:217404681-217404703 TCTGATGCTTATTAGGTTGCAGG - Intronic
1170516280 20:17133671-17133693 TGAGATGTTTATTAGGTGGCTGG - Intergenic
1171041428 20:21767512-21767534 TTTGATGTTCACGAGGAGCCTGG + Intergenic
1172126490 20:32627765-32627787 TCTGAGGCTGAGGAGGTGGCGGG - Intergenic
1177332767 21:19683519-19683541 TCTCATCTTCATGAGTTTGCTGG + Intergenic
1178451767 21:32708204-32708226 ACTGAAGTTTATGAAGTGGCAGG + Intronic
1178859944 21:36280475-36280497 TGTGATGTTCATAATATGGCAGG + Intronic
1179449519 21:41458951-41458973 TCAGATGCACATGAGCTGGCGGG + Exonic
1180940496 22:19657355-19657377 CCTAATGTTCATCAGGGGGCTGG - Intergenic
1181515075 22:23405545-23405567 CCTGATGTGCAGGCGGTGGCTGG - Intergenic
1184834209 22:47011378-47011400 TCTCAGGGTCATGAGGTGGGCGG - Intronic
1185206143 22:49540251-49540273 TCTGCTATGCTTGAGGTGGCTGG - Intronic
951513151 3:23527509-23527531 TCTGATGCTAATGAGGTGACTGG + Intronic
953595365 3:44307496-44307518 TCACATATTCCTGAGGTGGCAGG + Intronic
956734756 3:72229709-72229731 TCTAAATTCCATGAGGTGGCTGG + Intergenic
958684454 3:97375130-97375152 TCTAAACTTCATGAGCTGGCAGG - Intronic
958720322 3:97835926-97835948 TCTGAAGGTTATGAGGTGGACGG + Intronic
958815972 3:98916022-98916044 TCCAATTTTCATGGGGTGGCAGG - Intergenic
959539086 3:107520547-107520569 TCTGAAGTTCATGATTTGGAGGG + Intergenic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
962557066 3:136564376-136564398 TCTGTTGTTCAGGCTGTGGCGGG - Intronic
964794204 3:160479995-160480017 TCTGCTGTTCAAAAGGGGGCAGG + Intronic
965603707 3:170479410-170479432 TCTGATGTTCATGAGGTGGCTGG - Intronic
968846422 4:3044752-3044774 TTGTATGTTAATGAGGTGGCTGG + Intergenic
969093575 4:4715632-4715654 CCTGATGCTCACGAGGTGGAAGG + Intergenic
969670120 4:8585555-8585577 CCTGATGTGCATGTGCTGGCCGG + Intronic
969676251 4:8616017-8616039 TCTGATGAACATGAGGTTGAAGG + Intronic
969856396 4:10003130-10003152 TCTCCTGTTTATCAGGTGGCAGG - Intronic
971003388 4:22347467-22347489 TCTGATGAGCTTGAGGTGTCAGG + Intronic
977355083 4:95935637-95935659 TCTGTTCTTCACAAGGTGGCAGG - Intergenic
978627092 4:110698991-110699013 TCTCATGTTCATGAATTGGAAGG - Intergenic
981084803 4:140672476-140672498 TCTTTTGGTCATGAGGTGTCTGG + Intronic
983788600 4:171765228-171765250 TCTGATGTTCAGGTATTGGCTGG - Intergenic
985752534 5:1689134-1689156 TGTGATGTTAATGAGGTAGTTGG - Intergenic
989129763 5:38095343-38095365 GCTGAGGTTTAGGAGGTGGCAGG - Intergenic
989404724 5:41047383-41047405 TCTGCTTTTCATTATGTGGCTGG + Intronic
991605713 5:68398596-68398618 TCTCAGGTTCTTGAGGTAGCTGG - Intergenic
993533665 5:89054238-89054260 TCTGTTGTTGATGAGATGGCAGG + Intergenic
995654508 5:114410101-114410123 TCTCATGTTCATGGGGTCCCAGG + Intronic
999170697 5:149591874-149591896 TATGATGTTCACTAGGTGTCAGG + Intronic
999676717 5:154011361-154011383 GCTGAGGATCATGAGGTGGCAGG + Intronic
999701696 5:154234244-154234266 TCTGATGTTGATGCTTTGGCAGG - Intronic
1000055557 5:157602997-157603019 TCTGATGGCCATGAGGAGGACGG + Intergenic
1001688390 5:173613606-173613628 TCACATGTTCATGGGGCGGCAGG - Intronic
1002353082 5:178598547-178598569 TCTGATGATGATTAGGTGCCTGG + Intergenic
1002357360 5:178641621-178641643 CCTGATGATCAGGAGGAGGCCGG - Intergenic
1002373017 5:178769700-178769722 CCTGATGATGATGATGTGGCGGG - Intergenic
1003340530 6:5216017-5216039 TCTCATTCTCATGAGGTGGGTGG - Intronic
1003688512 6:8328210-8328232 TCTGGTGAGCATGAGGTGTCAGG - Intergenic
1005171693 6:22993420-22993442 TCTGATATTCTTGGGGTGGGTGG + Intergenic
1007314048 6:40970242-40970264 GCTGGTTTTCATGAGCTGGCAGG - Intergenic
1009462747 6:63933702-63933724 TTCTATGTTCATGAGATGGCTGG - Intronic
1012487572 6:99739228-99739250 ACTGATCTTCATCAAGTGGCAGG + Intergenic
1013241779 6:108253005-108253027 TCTGATGTTCAAGAAATTGCTGG + Intronic
1013306714 6:108854439-108854461 TCTGATGTTCTTGAGGATGCAGG - Exonic
1015743655 6:136486274-136486296 TCTGGTGTTCATGATTTTGCCGG - Intronic
1016200778 6:141404919-141404941 TTTGATGTTCATTAGGTGTCTGG + Intergenic
1016799299 6:148152780-148152802 TCTGCTTTTCATGGGGAGGCTGG + Intergenic
1017455395 6:154596943-154596965 TCTTATGCTCATGAGGTATCAGG - Intergenic
1018021770 6:159767794-159767816 GCTGAGGTTCAGGAGGAGGCAGG + Intronic
1019693820 7:2433319-2433341 CTTGACCTTCATGAGGTGGCGGG - Exonic
1020000419 7:4752587-4752609 TCCGAGGCCCATGAGGTGGCAGG - Intronic
1021271717 7:18596144-18596166 TCTGATATTTATGAAGTGTCTGG + Intronic
1026782264 7:73276615-73276637 TCTCATGTTCATGGATTGGCAGG + Intergenic
1027064900 7:75115853-75115875 TCTCATGTTCATGGATTGGCAGG - Intronic
1030787340 7:113678542-113678564 TCTGATTTTCAGGTGGTGGGAGG + Intergenic
1030843052 7:114379540-114379562 TCTGATGTTAATGATGTCGAAGG - Intronic
1031122607 7:117738740-117738762 TCTGATGTGCAGCAGGTGGTGGG + Intronic
1035332815 7:158107459-158107481 TCTGGGGTTCTGGAGGTGGCGGG - Intronic
1037764939 8:21766823-21766845 TGTGATGTGCATGAGGTGTGTGG - Intronic
1039292987 8:36118588-36118610 TCTGTTGTTGATGGGGTGGTTGG + Intergenic
1044899890 8:96933218-96933240 TCTGATATTCATGACCTTGCTGG - Intronic
1045061060 8:98411536-98411558 TCAGATGTTAATGATGTGGCAGG - Intronic
1048480110 8:134782011-134782033 TCAGATTTTCAGGGGGTGGCAGG + Intergenic
1048786651 8:138057597-138057619 TCTGATCTTCATGTGCTGGTCGG + Intergenic
1049190188 8:141283150-141283172 TCTCATGTTCGTGAGGTTGTGGG - Intronic
1052923534 9:33992899-33992921 TCTGATTATTATGTGGTGGCTGG - Intronic
1056880314 9:90385353-90385375 TGTGATCTTCATGAAGTGGCTGG - Intergenic
1059451232 9:114372599-114372621 TCTGAAGGTCATGGAGTGGCGGG - Intronic
1060328471 9:122642384-122642406 TCTGAGGTTTAAGAGGAGGCTGG - Intergenic
1062350613 9:136136926-136136948 CCTGATGTTCTTGAGGTTTCAGG + Intergenic
1062394478 9:136347242-136347264 TCTGATGGTCTGGAGGTGCCAGG + Intronic
1062427844 9:136514197-136514219 TCTGATGCCCATGATGTGCCTGG - Intronic
1196526906 X:116738406-116738428 TCTGATGTTAATGAGATCGAAGG - Intergenic
1197410990 X:126116185-126116207 GCTGTTCTTCATAAGGTGGCAGG - Intergenic
1199598079 X:149523873-149523895 TCTGATCATCAGGAGGAGGCAGG + Intronic
1200181066 X:154151010-154151032 CCCGATCATCATGAGGTGGCTGG - Intronic
1200186713 X:154188124-154188146 CCCGATCATCATGAGGTGGCCGG - Intergenic
1200192364 X:154225262-154225284 CCCGATCATCATGAGGTGGCCGG - Intronic
1200198119 X:154263066-154263088 CCCGATCATCATGAGGTGGCCGG - Intronic