ID: 965605656

View in Genome Browser
Species Human (GRCh38)
Location 3:170495653-170495675
Sequence CCAGGTTAACAGGGCTCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 3, 2: 11, 3: 24, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965605656_965605665 13 Left 965605656 3:170495653-170495675 CCTGCTGAGCCCTGTTAACCTGG 0: 1
1: 3
2: 11
3: 24
4: 187
Right 965605665 3:170495689-170495711 TATCCAGGCCATGCACACCCAGG 0: 1
1: 2
2: 6
3: 27
4: 141
965605656_965605667 19 Left 965605656 3:170495653-170495675 CCTGCTGAGCCCTGTTAACCTGG 0: 1
1: 3
2: 11
3: 24
4: 187
Right 965605667 3:170495695-170495717 GGCCATGCACACCCAGGAGAAGG 0: 2
1: 4
2: 7
3: 28
4: 248
965605656_965605662 -2 Left 965605656 3:170495653-170495675 CCTGCTGAGCCCTGTTAACCTGG 0: 1
1: 3
2: 11
3: 24
4: 187
Right 965605662 3:170495674-170495696 GGAGGTAGATCCCAATATCCAGG 0: 1
1: 1
2: 3
3: 24
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965605656 Original CRISPR CCAGGTTAACAGGGCTCAGC AGG (reversed) Intronic
900106049 1:981558-981580 AAAGGTTTACAGGGCCCAGCAGG + Intronic
900503784 1:3019196-3019218 CAAGGTAGACAGGGCTTAGCCGG + Intergenic
900505821 1:3029371-3029393 CCAGGTGACAAGGGCTCCGCCGG - Intergenic
900740964 1:4330544-4330566 CCAGGATAACAGGGTTGACCAGG - Intergenic
901441409 1:9280537-9280559 CGCGGTTGTCAGGGCTCAGCTGG + Intergenic
903647897 1:24905731-24905753 CCAGGGGATCGGGGCTCAGCGGG - Intronic
904336745 1:29802770-29802792 GCAGGTTAACCAGGCTCAGGAGG + Intergenic
904565934 1:31428525-31428547 TCAGGTTCCCAGGGCTCCGCAGG + Intronic
904887593 1:33752788-33752810 CCAGGCTAACAGGTCTTAGATGG + Intronic
907367188 1:53971714-53971736 CCATGTTAACAGGGAGCATCTGG + Intergenic
909232173 1:73105067-73105089 CCAGGTTAAGAGGGCTCAGCAGG - Intergenic
909901514 1:81142296-81142318 CCAGGCTAACAGGCCTGAGTGGG + Intergenic
911094822 1:94046630-94046652 CCAAGTTGTCATGGCTCAGCGGG - Intronic
912383015 1:109257769-109257791 ACTGGTTAACGTGGCTCAGCTGG + Intronic
914901216 1:151712143-151712165 CCAGGTAAACAGGGCACAGCTGG - Intronic
915619688 1:157073469-157073491 CCAGGACAAGGGGGCTCAGCAGG - Intergenic
918259615 1:182783758-182783780 CCAGGCTAACAGCGCCCTGCAGG + Intergenic
919747154 1:201016082-201016104 CCATGTTACTAAGGCTCAGCAGG + Intronic
920147416 1:203873945-203873967 CCAGCTTAAGGGGGCTCAGCAGG + Intergenic
923899447 1:238309905-238309927 CCAGGTAAACAGTTCTCAACTGG - Intergenic
1063714663 10:8514894-8514916 CCAGATTAAGGGGGCTCAGCAGG + Intergenic
1065733166 10:28727848-28727870 CCAGGATATCAGGGCCCAGGTGG - Intergenic
1067289937 10:44933190-44933212 CTGGGTGAACAGGGCACAGCTGG + Intronic
1067730921 10:48810968-48810990 CCAGGAGAACAGGGCTAAGCAGG - Intronic
1069744523 10:70706637-70706659 CCTGGTGAGCAGGGCTCAGGTGG - Intronic
1069956111 10:72052976-72052998 ACAGGTGATCAGGGCTAAGCTGG + Intergenic
1070176573 10:73975592-73975614 CTGGATTAACTGGGCTCAGCTGG - Intergenic
1071979350 10:90987949-90987971 CCAGGCAAACTGGTCTCAGCTGG + Intergenic
1072587467 10:96795461-96795483 CCAGGTGATCAAGGCTCAGTCGG - Intergenic
1074643599 10:115417787-115417809 CAAGGTTGGCAGGGCTCTGCAGG - Intronic
1075337546 10:121619081-121619103 GTAGGTTGACTGGGCTCAGCTGG + Intergenic
1075568577 10:123521880-123521902 CCAGGTTGCCAGGCCTGAGCTGG + Intergenic
1076202466 10:128569455-128569477 CCTGATTAACATAGCTCAGCTGG + Intergenic
1076408307 10:130228120-130228142 GGAGGTTGACAGGGCTCAGCTGG - Intergenic
1076980693 11:203122-203144 TCAGGTGTACAGGGCTGAGCTGG + Exonic
1077240424 11:1507817-1507839 CCAGCTTCACAGAGCCCAGCAGG + Intergenic
1077730444 11:4723938-4723960 CCAGGTTAAGGGGACTCAGCAGG + Intronic
1078191420 11:9094705-9094727 CCAGCTTAAGGGGGCTCAGCAGG - Intronic
1080200367 11:29662344-29662366 GTAGGTGAACTGGGCTCAGCAGG - Intergenic
1080426287 11:32157682-32157704 CAAGATTAACAGTGCTCACCAGG - Intergenic
1084536190 11:69758611-69758633 CCAGGTCCTCAGGGCTCAGCAGG + Intergenic
1084579435 11:70013921-70013943 CCAGGGAGACAGGCCTCAGCAGG - Intergenic
1084956702 11:72695458-72695480 GCAGGGAGACAGGGCTCAGCTGG + Intronic
1088620018 11:111672149-111672171 CCAGCTTAAAAGAGCTTAGCAGG + Intronic
1088691462 11:112332024-112332046 CCAGGAGCACAGGGCTCAGGTGG + Intergenic
1089352982 11:117831895-117831917 CCAGGAAAACAGAGGTCAGCTGG - Intronic
1089599349 11:119604070-119604092 CCAGGTTAAGGGGGCTCAGCAGG + Intergenic
1089909582 11:122083385-122083407 CCAGGTTAACAGAGAGGAGCAGG - Intergenic
1096627552 12:52904747-52904769 CCAGGACAAGGGGGCTCAGCAGG + Exonic
1097615450 12:61879531-61879553 CCAGGTTAAGGGGCCTCAGCAGG - Intronic
1098051041 12:66453342-66453364 ACAGGCTAACAGCACTCAGCAGG - Intronic
1098264592 12:68705846-68705868 CCAGGTTAAGGGGGCTCAGCAGG - Intronic
1098673925 12:73265870-73265892 CCTGGTTGACTGGGCTCAGGAGG - Intergenic
1100451235 12:94708695-94708717 CCATGAGATCAGGGCTCAGCTGG + Intergenic
1102927343 12:116836279-116836301 CCAGGTGAGCAGGGCTCAGGCGG + Exonic
1103706273 12:122874984-122875006 CCAGTTTAACAGTCCTCAGTTGG - Intronic
1104790739 12:131480614-131480636 CCAGCTCAACAGGCCACAGCGGG + Intergenic
1104885216 12:132103477-132103499 CCAGCTCTACAGGGCTTAGCGGG - Intronic
1107272026 13:38631019-38631041 CCAGTGTAACATGGCTAAGCAGG + Intergenic
1107560135 13:41550975-41550997 GCAGGTTGACTAGGCTCAGCTGG + Intergenic
1109351504 13:61188284-61188306 CCAGGACAATATGGCTCAGCTGG - Intergenic
1113067360 13:106385901-106385923 CCAGGTTCACAGTCCTGAGCAGG - Intergenic
1113601178 13:111569252-111569274 GCAGGTTGACTGGGCTCAGTGGG + Intergenic
1114055657 14:18965328-18965350 CCAGGCTCACAGGGAGCAGCTGG - Intergenic
1114106889 14:19436435-19436457 CCAGGCTCACAGGGAGCAGCTGG + Intergenic
1115951509 14:38727254-38727276 TCAGGTTAAGGGGGCTCAGTAGG - Intergenic
1117255020 14:53968874-53968896 CTAGATTGACTGGGCTCAGCTGG + Intergenic
1118896664 14:69950925-69950947 GTGGGTTAACTGGGCTCAGCTGG + Intronic
1119208566 14:72812630-72812652 CCCGGTGGGCAGGGCTCAGCAGG + Intronic
1121315290 14:92957786-92957808 CAAGGTAAAGATGGCTCAGCGGG + Intronic
1121501990 14:94445214-94445236 ATGGGTTAACTGGGCTCAGCTGG - Intronic
1121542109 14:94735890-94735912 GGGGGTTAACTGGGCTCAGCTGG - Intergenic
1122176115 14:99920397-99920419 CCAGGTTTCCAGGGCGAAGCAGG - Intronic
1122434959 14:101689138-101689160 CCAGGTGGGCGGGGCTCAGCAGG + Intergenic
1123079451 14:105685430-105685452 CCCGGGTGACAGGGCTCAGGGGG - Intergenic
1125841139 15:42802178-42802200 CCAGGTTAAGAGGGCTCAGCAGG + Intronic
1126702270 15:51379041-51379063 CCAGGTTACCTGGTCACAGCTGG - Intronic
1127496450 15:59517134-59517156 CAAGGTTAACATGTCTCAGAAGG + Intronic
1128842125 15:70858926-70858948 CCAGGTTAAGAGGGCTCAGCAGG - Intronic
1129598047 15:76980217-76980239 CCAGGTTAAGGGGGCTCAGCAGG + Intergenic
1129664334 15:77571246-77571268 CCAGGTGCACAGGGCCCACCTGG + Intergenic
1130087637 15:80791457-80791479 CCAGGGTAATAGGGCCCAGAAGG + Intronic
1130960305 15:88654556-88654578 CCAGGACACCAGGGCTGAGCGGG + Intronic
1132052464 15:98618348-98618370 CCCCGTGCACAGGGCTCAGCAGG - Intergenic
1133110094 16:3542919-3542941 CCAGGGCAACAGGGCAGAGCTGG + Intronic
1133975676 16:10598440-10598462 CCTGGTTTCCAGGGCTGAGCTGG + Intergenic
1139430265 16:66907379-66907401 CCTACTTAGCAGGGCTCAGCCGG + Intergenic
1140753842 16:78049663-78049685 CCAGGTTAAGGGGGCTCAGTAGG + Intronic
1142389425 16:89789145-89789167 CCAGGCTAACTGGGCAGAGCTGG + Intronic
1142865660 17:2790063-2790085 CCAGGGAAACAGGGCACAGTGGG - Intronic
1143129198 17:4665468-4665490 CCAGGTTTACGGGGGTCAGGTGG - Intergenic
1144772981 17:17770009-17770031 CCAGGGTGACAGGGCTTTGCTGG + Intronic
1145066322 17:19763671-19763693 CCATGTAAACAAGGCTGAGCTGG + Intergenic
1145251135 17:21297666-21297688 CCAGGTGCACAGCACTCAGCTGG - Intronic
1146457695 17:33020171-33020193 CCAGGGACCCAGGGCTCAGCTGG - Intronic
1147190248 17:38734235-38734257 CCAGGTGACCGGGCCTCAGCTGG + Exonic
1147350191 17:39836162-39836184 CCAGCTTAAGGGGGCTCAGCAGG + Intronic
1148561592 17:48609848-48609870 CCAGGTTCACTGGGATCAGGAGG + Intronic
1150218840 17:63484630-63484652 ACAGGGTACCAGGGCTCAGCTGG - Intergenic
1152763393 17:82121661-82121683 CCAGGTCAACGGGCCTCAGGTGG - Intronic
1153578886 18:6551070-6551092 CCAGGCTGACAGGTCTCAGGTGG - Intronic
1155228498 18:23751424-23751446 ACAGTTTAACATGGGTCAGCAGG + Intronic
1161723308 19:5915329-5915351 CCAGGGCAGCAGGGCTGAGCCGG - Exonic
1162017400 19:7853006-7853028 CCAGGGCAACAGGGCTCGGGCGG + Intronic
1163453742 19:17394051-17394073 CCAGGCTACCAGGGCCCCGCCGG + Intergenic
1163775568 19:19215332-19215354 CCCGGTCACCAGGGCTCAGGAGG - Intronic
1164454217 19:28393695-28393717 ACAGGATAACAGGGCAGAGCTGG + Intergenic
1165036868 19:33040069-33040091 CGAGGTTTACAGGGATCAGGTGG - Intronic
1165737394 19:38185378-38185400 GGAGGGTAACAGGGTTCAGCAGG - Intronic
1165990520 19:39809564-39809586 CCAGGTTGACTAGGCTCAGCTGG - Intergenic
1166967472 19:46538214-46538236 GTGGGTTAACAGGGCTCAACAGG - Intronic
1167612031 19:50512341-50512363 CCAGGTGAGCAGAGCTAAGCAGG - Exonic
1167647155 19:50711985-50712007 CCTGTTCAACAGGGCCCAGCTGG - Exonic
927307121 2:21586462-21586484 CCAGGATCACAGAGCTCAGGGGG - Intergenic
928361616 2:30666483-30666505 TCAATTTAACAGGGCTCAGAGGG - Intergenic
929435925 2:41928255-41928277 CAAGGTGATCAGGGCACAGCCGG + Intergenic
929918748 2:46157338-46157360 CCAAAATAAAAGGGCTCAGCTGG - Intronic
932854751 2:75221529-75221551 GCAGGTTATCAGAGCTCTGCTGG + Intergenic
936046721 2:109194333-109194355 TCAGGGGAACAGGGCACAGCTGG - Intronic
938473822 2:131589904-131589926 CCAGGGTCACAGGGAGCAGCTGG - Intergenic
941278026 2:163515540-163515562 CTATGTTATCAGGGGTCAGCAGG - Intergenic
943064544 2:183072252-183072274 CCAGGTTAAGGGGGCTCAGCAGG + Intergenic
943918369 2:193668310-193668332 CCAGGTTGGCTTGGCTCAGCAGG + Intergenic
944763559 2:202841536-202841558 CCAGGTTAAGGGGGCTCAGCAGG + Intronic
945307224 2:208269759-208269781 CAAGTTTAACAAGGATCAGCTGG - Intronic
1169173324 20:3485041-3485063 GGAGGTTGACTGGGCTCAGCTGG + Intronic
1172341238 20:34159459-34159481 CCAGGGGACCAGCGCTCAGCAGG - Intergenic
1172841408 20:37904515-37904537 CCAGGCTCACAGGGGTCAGGGGG - Intronic
1173054622 20:39599057-39599079 GCAGGTGAACAGGGCCAAGCAGG + Intergenic
1173139792 20:40471722-40471744 CCAGGTTTAAAGGGCATAGCTGG + Intergenic
1176130756 20:63495837-63495859 CCAGGTGAGCAGGGCACAGCAGG - Exonic
1180302740 22:11050469-11050491 CCAGGGTGACAGGGCTGACCGGG + Intergenic
1180474133 22:15687880-15687902 CCAGGCTCACAGGGAGCAGCTGG - Intergenic
1180834047 22:18920974-18920996 TGGGGTTGACAGGGCTCAGCTGG - Intronic
1181065774 22:20305265-20305287 TGGGGTTGACAGGGCTCAGCTGG + Intergenic
1183351558 22:37337446-37337468 GCAGATTAAGAGGGCTGAGCTGG + Intergenic
1184259043 22:43304150-43304172 GCAGGTTAACAGGGGTCTTCAGG - Intronic
1203284135 22_KI270734v1_random:146272-146294 TGGGGTTGACAGGGCTCAGCTGG - Intergenic
949857707 3:8477270-8477292 GGAGGTTGACTGGGCTCAGCTGG + Intergenic
950332516 3:12167856-12167878 CCAGGCTAACAGGTCTCAGATGG + Intronic
952611660 3:35216915-35216937 CCAGGCTAAGGGGGCTTAGCAGG + Intergenic
954132791 3:48568818-48568840 CCTGGTGACAAGGGCTCAGCCGG - Exonic
954438312 3:50507804-50507826 CTGGGTAAACAGGGCTCAGAAGG - Intergenic
954903670 3:54041830-54041852 CCAGGCTCACAGGGCACAGTTGG + Intergenic
955490323 3:59475531-59475553 CCAGGTCCACAGGGTTCACCTGG - Intergenic
955839600 3:63097567-63097589 CCAGGTTAAGGGGGCTCAGCAGG + Intergenic
957966066 3:87323480-87323502 GCAGGTTAAGGGGGCTCAGCAGG - Intergenic
958997299 3:100919089-100919111 CCAGGAAGAGAGGGCTCAGCTGG + Intronic
959579158 3:107966618-107966640 CTAGATGAACAGGGGTCAGCCGG - Intergenic
960155748 3:114295648-114295670 CCAGGTCAACTGGGAGCAGCAGG + Exonic
962712925 3:138102683-138102705 CCAGGTTAAGGGGGCTCAGCAGG + Intronic
962928980 3:140020153-140020175 CCTGGGTAACAGACCTCAGCAGG - Intronic
964802123 3:160568071-160568093 CCAGGTTAAGGGGGCTCAGCAGG - Intergenic
965605656 3:170495653-170495675 CCAGGTTAACAGGGCTCAGCAGG - Intronic
967411076 3:189167188-189167210 CCCTGTTCACAGGGCTCAGGAGG - Intronic
970342207 4:15119027-15119049 GCAGGTTGACTGGGCTCTGCTGG + Intergenic
970959807 4:21858180-21858202 CCAGGTCAAGAGGGCCCAGTGGG + Intronic
972872754 4:43320533-43320555 CAATGTTACCAGAGCTCAGCAGG - Intergenic
977928790 4:102729937-102729959 CCAGGTTAAGGGGGCTCAGCAGG + Intronic
979674003 4:123391466-123391488 TAAGGTGAGCAGGGCTCAGCAGG + Intergenic
980820979 4:138017153-138017175 ACAGGTTAACAGGGGCCAGAAGG - Intergenic
981241964 4:142488488-142488510 CCAGGTCAACAGGGCTTCACTGG - Intronic
986269977 5:6221498-6221520 CCAGGGCAACAGGGACCAGCTGG - Intergenic
987253159 5:16120915-16120937 GCAAGTTGACTGGGCTCAGCTGG - Intronic
987646943 5:20685682-20685704 CCATGTTAGTAGGTCTCAGCAGG + Intergenic
994320917 5:98393292-98393314 CCAGGTTAAGGGGACTCAGCAGG + Intergenic
996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG + Exonic
996433031 5:123402109-123402131 CCAGGACAAGGGGGCTCAGCAGG + Intronic
997230098 5:132236060-132236082 CTAGGGTAACAGGGCTGAGGGGG - Intronic
998887287 5:146707378-146707400 TCAGGTTAAGGGGGTTCAGCAGG + Intronic
1001872719 5:175170749-175170771 CCAGGTACAGAAGGCTCAGCAGG - Intergenic
1003567172 6:7231120-7231142 CCAGCTGAACAGGGCCCTGCAGG - Exonic
1005315331 6:24598245-24598267 CCAGCTTAAGGGGGCTCAGCAGG - Intronic
1006253930 6:32814326-32814348 CCACAGAAACAGGGCTCAGCAGG + Exonic
1006976303 6:38105536-38105558 CCAGGTTGCCAGGGATCAGTGGG + Intronic
1007092940 6:39195460-39195482 TCAGCTTGACTGGGCTCAGCTGG - Intronic
1008558080 6:52694596-52694618 CTGAGTTGACAGGGCTCAGCTGG - Intergenic
1009395340 6:63193406-63193428 CCAGGTTAAGGGGGTTCAGCAGG + Intergenic
1009458073 6:63879843-63879865 CCAGGATAACAGGGGTAAACAGG + Intronic
1009934564 6:70218550-70218572 CCAGGTTAAGATGGCTGAGATGG - Intronic
1012451741 6:99359806-99359828 ACAGGTTAACAGGCCTAAACTGG - Intergenic
1015134532 6:129852706-129852728 GCAGGTTAACAGGGTTCTACTGG + Intronic
1015365532 6:132393439-132393461 CCAGCTTAGCTGGGATCAGCTGG + Intronic
1015539348 6:134298462-134298484 CCAGATTAAGTGGGCTCAGCAGG + Intronic
1018235114 6:161716479-161716501 AGAGGTTAACAGGGCTGAGACGG - Intronic
1018567751 6:165173731-165173753 CCAGGTTGCCAGCTCTCAGCTGG - Intergenic
1018910166 6:168097176-168097198 CCAGGTGCTCTGGGCTCAGCAGG - Intergenic
1018915249 6:168128981-168129003 TCAGCTGGACAGGGCTCAGCTGG - Intergenic
1018915252 6:168128996-168129018 TCAGCTGGACAGGGCTCAGCTGG - Intergenic
1019135876 6:169907494-169907516 CCAGGGGCACAGGGCTCAGGGGG + Intergenic
1019601632 7:1886633-1886655 CCAGGACAGCAGGGGTCAGCAGG + Intronic
1023289542 7:38655417-38655439 CCAGGTTCAGGGGGCTCAGCAGG - Intergenic
1025751705 7:64299573-64299595 CCATGTGAGCAGGGCCCAGCAGG + Intergenic
1026874565 7:73871873-73871895 CCAGGTTAACGTGGCCCATCTGG + Intergenic
1028996399 7:97105128-97105150 CCAGGTTAAAAGGGGTCAAATGG + Intergenic
1029097930 7:98103993-98104015 AAAGGTTCACAGAGCTCAGCTGG - Intergenic
1030536039 7:110768371-110768393 CCAGATGCACAGGGCTCTGCAGG + Intronic
1032640819 7:133765485-133765507 CCATGTTAACAGGGCACATCTGG - Intronic
1032953039 7:136938495-136938517 CTAGGATAAGGGGGCTCAGCAGG + Intronic
1033428271 7:141265146-141265168 CATGGTTAACAGGGCTTCGCAGG + Intronic
1035041982 7:155935735-155935757 CCTGGTAGACAGGGCTCTGCAGG + Intergenic
1038395324 8:27242013-27242035 CCAGGTCAACAGGTCTCCTCTGG - Intronic
1038439220 8:27560037-27560059 CCAAGTTCACTGGGCTGAGCTGG - Intergenic
1039456248 8:37709183-37709205 CCAGGTAGATAGGGCTCAGTGGG - Intergenic
1040596873 8:48846984-48847006 CCAAATTAACAGGCCACAGCGGG - Intergenic
1041655930 8:60350699-60350721 CCAGAGCAACAGAGCTCAGCAGG - Intergenic
1041814895 8:61959275-61959297 CCAGGCTCACAGGGCTTAACTGG + Intergenic
1044475602 8:92621668-92621690 CCATTTGAACAGGGCTCAGCAGG - Intergenic
1045435633 8:102160799-102160821 TTAGGTTGACTGGGCTCAGCTGG - Intergenic
1046868545 8:119177650-119177672 CCAGGTGAGCAGTTCTCAGCTGG - Intronic
1052343576 9:27385993-27386015 CCAGGTGTCCAGTGCTCAGCAGG - Intronic
1053199730 9:36144128-36144150 CCAGTTTAAGAAGGGTCAGCTGG - Intronic
1057943523 9:99305372-99305394 CCAGGTTAAGGGGGCTCAACAGG - Intergenic
1058896386 9:109404238-109404260 CGTGGATAACAGGGCACAGCAGG - Intronic
1059039766 9:110800046-110800068 CCAGGACAACAGCGCTCTGCTGG + Intronic
1061661592 9:132133802-132133824 GGAGGCTAACTGGGCTCAGCCGG - Intergenic
1062086573 9:134652330-134652352 CCAGTGTAACACGGCTCTGCTGG + Intronic
1062496031 9:136832114-136832136 GCTGCTTAGCAGGGCTCAGCAGG + Intronic
1186645039 X:11497630-11497652 CCAGGTAAAGAGGCCTCACCAGG + Intronic
1186756903 X:12680853-12680875 CCACGTTTACTGGCCTCAGCAGG + Intronic
1187685515 X:21811986-21812008 CTTGGTTGACTGGGCTCAGCTGG + Intergenic
1189106058 X:38236481-38236503 TAAGGTTAACGTGGCTCAGCTGG - Intronic
1189893902 X:45633499-45633521 CCAGGTGAAGGGGACTCAGCAGG + Intergenic
1190280299 X:48924776-48924798 CCAGGATAAAGGGGCTGAGCAGG - Intronic
1191220653 X:57984898-57984920 CCAGGTTAATGGGGCTCAGCAGG - Intergenic
1191758637 X:64623349-64623371 CCAACTTAAAGGGGCTCAGCAGG - Intergenic