ID: 965608861

View in Genome Browser
Species Human (GRCh38)
Location 3:170524095-170524117
Sequence GTGGTGAAGGCCTCAATTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 72}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965608857_965608861 23 Left 965608857 3:170524049-170524071 CCTGTTTTGGGGAGAGGTAGGGT 0: 1
1: 0
2: 2
3: 19
4: 217
Right 965608861 3:170524095-170524117 GTGGTGAAGGCCTCAATTACTGG 0: 1
1: 0
2: 1
3: 4
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965608861 Original CRISPR GTGGTGAAGGCCTCAATTAC TGG Intronic
903095971 1:20973910-20973932 GTGGAGAAGGGGTCAAATACTGG + Intronic
903790924 1:25892444-25892466 GTAGTGATGGTCTCAAATACAGG - Intronic
907528808 1:55072030-55072052 GTGATGAAGGCCTCACTCTCAGG - Intronic
911731389 1:101295653-101295675 TTGGTGAATGCCTGATTTACAGG - Intergenic
914443764 1:147731440-147731462 GTGGTGAAGGCATCCAGTCCTGG + Intergenic
915849503 1:159306099-159306121 ATGGTGAAGCTCTCAAGTACTGG + Exonic
921211490 1:212903238-212903260 GTGGTGCAGGCCTATAGTACTGG - Intergenic
1082185409 11:49174628-49174650 ATTGTGCAGGCCTCAATTAAAGG - Intronic
1085224579 11:74907896-74907918 GGGGTGATGCCCTGAATTACAGG + Intronic
1086680917 11:89670716-89670738 ATTGTGCAGGCCTCAATTAAAGG + Intergenic
1088234373 11:107706653-107706675 GTAGTCAATGCCTCAATGACAGG + Intergenic
1091814196 12:3423886-3423908 GTCCTGAAAGCCTCAATTATTGG - Intronic
1092970084 12:13685353-13685375 TTGGTGATGGCTTCACTTACAGG + Intronic
1101028201 12:100634557-100634579 GTCCTGAAAGCCTCAATTATTGG - Intergenic
1101167837 12:102056797-102056819 GTAGTGAAGGCATCAAGTCCTGG - Intronic
1103839074 12:123848073-123848095 GTGGCGAAGGCATGGATTACAGG + Exonic
1104215729 12:126731287-126731309 GTGGTGAAGGCAGAATTTACAGG - Intergenic
1105686924 13:22793112-22793134 GTTAAGAAGGCCTCAATTTCAGG + Intergenic
1107561346 13:41560024-41560046 GAGGTGAAGGCCTCATTAATGGG - Intergenic
1110987504 13:81989186-81989208 GTGGTAAAGGCCTGATTTATTGG - Intergenic
1111407904 13:87834111-87834133 GTGGTGGAGAGCTCAATTAGTGG + Intergenic
1111421861 13:88021407-88021429 GTGGTGAAAGTCTCAATAATTGG - Intergenic
1130048043 15:80461326-80461348 GTGGTTAAGGTCTCAATGAGAGG + Intronic
1134568126 16:15268695-15268717 GTGGTGAGGGCCTGAAGTAGTGG - Intergenic
1134734307 16:16487660-16487682 GTGGTGAGGGCCTGAAGTAGTGG + Intergenic
1134933195 16:18224619-18224641 GTGGTGAGGGCCTGAAGTAGTGG - Intergenic
1148981974 17:51584557-51584579 GTGGTGAAGGACACAATCATTGG - Intergenic
1153337115 18:3936271-3936293 GTGATGAAGGCCTTGATCACTGG - Intronic
1156394982 18:36691243-36691265 GTGATGAAGCCCTCAATGAAAGG - Intronic
1157137876 18:45075119-45075141 CTGGTAAAGGCCTCACTTTCCGG + Intergenic
1160851848 19:1196443-1196465 CAGGTGAGGGCCTCAATTATAGG - Intronic
1160852272 19:1198257-1198279 CAGGTGAGGGCCTCAATTATAGG - Intronic
1167917154 19:52750692-52750714 GGGTTGTATGCCTCAATTACAGG + Intergenic
925965013 2:9056649-9056671 GTGGTGCAGGCCTATATTCCTGG + Intergenic
932749270 2:74361182-74361204 GGGGTGAAGTCCTCAATCAAGGG + Exonic
935985103 2:108664874-108664896 GTTTTGAAGGACTCAATTTCTGG + Intronic
936137540 2:109908518-109908540 GTTTTGAAGGACTCAATTTCTGG + Intergenic
936207157 2:110462967-110462989 GTTTTGAAGGACTCAATTTCTGG - Intronic
937589895 2:123600216-123600238 CTTGTGAAGGCCTCATTTCCCGG - Intergenic
941737301 2:168993049-168993071 GTTGTCCAGGCCTCAATTCCTGG + Intronic
945275997 2:207988266-207988288 GTGGTTAAGGCCACAGTTGCTGG + Intronic
949069717 2:242017033-242017055 GTTGTGTAGGCCTCAGTTCCCGG - Intergenic
1168813519 20:721446-721468 GTGCTGAATGCATGAATTACGGG - Intergenic
1173621203 20:44437329-44437351 GTGGTGGGGACCTCAAATACTGG + Intergenic
1181003656 22:19999469-19999491 GTGGTGAGGGCCTCCATTGGGGG - Intronic
959994575 3:112666597-112666619 TATGTGCAGGCCTCAATTACTGG + Intergenic
961121388 3:124374185-124374207 CTGGTGAGGGCTTCAATTCCTGG - Intronic
963515105 3:146299677-146299699 GTGGTTGATGCCTCAATTGCAGG + Intergenic
964591263 3:158364695-158364717 GTGGTGAAGTCCTCAAGTCAGGG + Intronic
965034597 3:163422703-163422725 GTGGTGCTTGCCTGAATTACAGG - Intergenic
965608861 3:170524095-170524117 GTGGTGAAGGCCTCAATTACTGG + Intronic
968797117 4:2714525-2714547 GGGGTGGAGGCCACAATCACTGG - Intronic
971157028 4:24094044-24094066 GTGGGGGAGGCTTCAATAACAGG + Intergenic
971417153 4:26442291-26442313 GTTTTGAAGGACTCAATGACTGG - Intergenic
972275225 4:37550902-37550924 GTTCTAAAGGCCTCAATTATTGG + Intronic
978447666 4:108795672-108795694 GTGTTGAAGAACTCAGTTACTGG - Intergenic
981527572 4:145721410-145721432 GTGGTGAGGCCCTCAATTCCAGG - Intronic
981602650 4:146508078-146508100 TTGCAGAAGGCCTGAATTACTGG - Intronic
993336506 5:86666140-86666162 GTGGTGCGGGCCTCACTTCCAGG + Intergenic
993793415 5:92235815-92235837 GTGGTGAAGGCCCCCAATACAGG - Intergenic
994077172 5:95666298-95666320 GTGGTAAAGGACTGCATTACAGG + Intronic
998029953 5:138857786-138857808 GTGGTTAAGGGCTCAAATTCTGG - Intronic
1005042529 6:21612034-21612056 GTTGTTAAGGCCTCTATTAAAGG - Intergenic
1005675779 6:28153344-28153366 GTGGTAAAGCCTTCAGTTACAGG + Exonic
1006902189 6:37510450-37510472 GTAGTGACGGCCCCAGTTACTGG + Intergenic
1007726679 6:43921041-43921063 GTGGTGAAGCCTTCAATTAATGG + Intergenic
1013458756 6:110356556-110356578 GAGCTGAAGGCCTCAATTACAGG + Intronic
1015471135 6:133607651-133607673 GTGGTGCAGGCCTGTATTCCTGG + Intergenic
1016045553 6:139477000-139477022 GTGGTGGAGGCCACTCTTACAGG + Intergenic
1022051206 7:26675069-26675091 GTGATGAAGGCCTGAATTAGTGG - Intronic
1026467132 7:70663713-70663735 CTGGTGAAGGACTCCATTTCCGG - Intronic
1026474113 7:70719347-70719369 GTTGTCAAGGGCTCAATAACAGG + Intronic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1051691134 9:19713746-19713768 GTGCTGAAGTCCTTACTTACTGG + Intronic
1055481793 9:76715926-76715948 GTGCTGAAGCCTTCAGTTACTGG - Intronic
1190375303 X:49783245-49783267 GTGGGGAAGGCCTCACTGCCAGG + Intergenic
1191951381 X:66597471-66597493 GTGGTGAGAACCTCAAATACAGG + Exonic
1198558551 X:137823387-137823409 GTGGTGAAAGCCTGTATTGCAGG - Intergenic