ID: 965609556

View in Genome Browser
Species Human (GRCh38)
Location 3:170530298-170530320
Sequence AGAGCGGGTGTTGCATCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965609549_965609556 30 Left 965609549 3:170530245-170530267 CCAGTTGTACCAGATGTCAGGGA 0: 1
1: 0
2: 1
3: 14
4: 191
Right 965609556 3:170530298-170530320 AGAGCGGGTGTTGCATCTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 81
965609550_965609556 21 Left 965609550 3:170530254-170530276 CCAGATGTCAGGGAAATGCTCCT 0: 1
1: 0
2: 0
3: 13
4: 152
Right 965609556 3:170530298-170530320 AGAGCGGGTGTTGCATCTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 81
965609553_965609556 1 Left 965609553 3:170530274-170530296 CCTCACATTGTGGTTCAAGAGGA 0: 1
1: 0
2: 1
3: 10
4: 117
Right 965609556 3:170530298-170530320 AGAGCGGGTGTTGCATCTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965609556 Original CRISPR AGAGCGGGTGTTGCATCTGC TGG Intronic
901219742 1:7576732-7576754 GGAGCGGGTGCTGCAGCTGAGGG + Intronic
901499356 1:9642029-9642051 AGGGCGGGTGTTGCTTCCCCAGG - Intergenic
901686084 1:10944352-10944374 CGCACGGGTGTTGCCTCTGCTGG - Intergenic
901988230 1:13092421-13092443 ACAGTGCGTGTTGCACCTGCGGG - Intergenic
901993582 1:13134346-13134368 ACAGTGCGTGTTGCACCTGCGGG + Intergenic
902653796 1:17853833-17853855 AGGGCTGTTGTGGCATCTGCAGG + Intergenic
903236038 1:21951390-21951412 AGAGCAGCTGCTGCAGCTGCTGG + Intergenic
909576561 1:77183297-77183319 AGAGGGGATGTTGCCACTGCTGG - Intronic
921258423 1:213363483-213363505 AGAGGGGCTGCTGCATCTCCAGG + Intergenic
921297496 1:213718450-213718472 AGAGAGGGTGTTACATATCCAGG - Intergenic
922814335 1:228438476-228438498 AGAGAGGGTGTGGCATCATCTGG - Intergenic
1065809040 10:29424273-29424295 AGAGCTGCTGTTTCATCTGAAGG + Intergenic
1072360145 10:94651610-94651632 AGAGCGGATGTTGCCACTACTGG - Intergenic
1076817049 10:132920200-132920222 AAGGCAGGTGTTGCAGCTGCTGG + Intronic
1077362893 11:2148520-2148542 AGGGCGGTTGTTGCCTCTCCCGG + Intronic
1077551355 11:3201800-3201822 AGAGCAGCTGATGCCTCTGCCGG - Intergenic
1081495870 11:43609677-43609699 AGACAGGGTGTAGGATCTGCCGG - Intronic
1086974971 11:93121086-93121108 AGAGCAGGGGTTGGACCTGCTGG - Intergenic
1090457499 11:126862632-126862654 AGAGCGAGTGTTGCACCAGGAGG + Intronic
1095386419 12:41655666-41655688 AGAAGGGGTGTTGCTCCTGCAGG + Intergenic
1096182242 12:49557368-49557390 AGAGCAGGTGCTGCAGATGCGGG + Exonic
1096795432 12:54074526-54074548 AGAGTGGATGTTACATCTGCAGG + Intergenic
1101389317 12:104286078-104286100 AGAGGGAGTGTGGCTTCTGCTGG + Intronic
1106436654 13:29729417-29729439 AAAAGGGGTGTTGCCTCTGCTGG + Intergenic
1117332446 14:54726548-54726570 AGATTGGCTGTTGCTTCTGCTGG - Intronic
1117348157 14:54854391-54854413 AGTGGGGGTGCTGCACCTGCCGG + Intronic
1121414924 14:93772851-93772873 AGATTGGGAGTTGCTTCTGCAGG - Intronic
1121891278 14:97593506-97593528 AGAGCTGGTGGTGCATCCTCAGG - Intergenic
1122631356 14:103109127-103109149 GGAGGGGGTGATGCAGCTGCGGG - Intronic
1131222024 15:90592779-90592801 AGAGTGGGTGTCCCATCTACAGG + Intronic
1132252878 15:100347724-100347746 ATAGCAGGTGTGTCATCTGCAGG - Intergenic
1140867999 16:79080884-79080906 AGACTGGGTGATGCATCTGTTGG - Intronic
1141856360 16:86683746-86683768 ATGGCCGGTGTTGCAGCTGCTGG + Intergenic
1141857629 16:86694636-86694658 AGAGCGTGAGCTGCACCTGCGGG - Intergenic
1150216620 17:63475100-63475122 AGGGCGGGCATTGCTTCTGCTGG - Intergenic
1151446279 17:74166494-74166516 AGAGCGGCTGTTGTGGCTGCTGG + Intergenic
1152888147 17:82864751-82864773 AGAGCAGGTGATGCATATCCGGG + Intronic
1156528962 18:37796693-37796715 ACAGCAGGTGTTCCATCTGTAGG + Intergenic
1157301302 18:46481747-46481769 AGAGCGGCTTTTTCTTCTGCAGG + Intronic
1160266334 18:77342987-77343009 AGAGCTGGTGCTGGTTCTGCTGG - Intergenic
934548375 2:95238505-95238527 AGAGTGGATGTTGTATTTGCAGG - Intronic
936953017 2:117997266-117997288 AGAGCGGGTGGATCTTCTGCAGG - Intronic
937865738 2:126750505-126750527 AAAGCGGGTATTGGATCTGTTGG + Intergenic
940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG + Intronic
944996844 2:205303646-205303668 AGAGCTGGTGTGGGATGTGCTGG - Intronic
1175542440 20:59756167-59756189 GGAGCTGGTGAAGCATCTGCAGG - Intronic
1175919025 20:62441416-62441438 ACAGCGGGCTTTGCATCTGCTGG + Intergenic
1176690468 21:9902954-9902976 AGAAAGAATGTTGCATCTGCCGG + Intergenic
1177603560 21:23348340-23348362 AGGGCTGGGGTTGCATCTGAAGG - Intergenic
952852607 3:37741290-37741312 AGAGCTGCTGTTGCTGCTGCTGG - Intronic
953019064 3:39102677-39102699 TGAGCAGGTGTGGCATGTGCTGG - Exonic
953179346 3:40581914-40581936 AGGGTGGGTGTTGCCTTTGCAGG + Intergenic
961842880 3:129732368-129732390 AGGGTGGGTGGTGCATCTGTGGG - Intronic
964473056 3:157074512-157074534 AGAGCAGGTGTGGCATCAGGTGG + Intergenic
965609556 3:170530298-170530320 AGAGCGGGTGTTGCATCTGCTGG + Intronic
965996136 3:174885030-174885052 GGAGGGGATGTTGCCTCTGCTGG + Intronic
968228330 3:196989803-196989825 AGTGTGGGTGGTGCTTCTGCAGG + Intronic
969243258 4:5915953-5915975 AGACCAGGTTTTGTATCTGCAGG + Intronic
974262710 4:59544893-59544915 AGAGGGGATGTTGCCTCTACTGG + Intergenic
976599205 4:86922727-86922749 AGAGGTGGTGGTGCAGCTGCAGG - Intronic
980353869 4:131720870-131720892 AGAAAGAATGTTGCATCTGCTGG + Intergenic
985648689 5:1097306-1097328 TGAGCAGGGGTTGCTTCTGCTGG - Intronic
993239878 5:85368821-85368843 GGAGCGAGTGTTACACCTGCTGG - Intergenic
995183624 5:109250663-109250685 AGAGTGGGTGATGCATGTGTGGG - Intergenic
996703177 5:126470288-126470310 AGAGAGTGTGATGCATGTGCTGG + Intronic
997339091 5:133128535-133128557 ATAGAGGGTGTTGAATCTGGGGG + Intergenic
997926465 5:138034888-138034910 AGAGCCTGTGTTGCATATGTGGG - Intronic
1016339014 6:143040950-143040972 AAAGCGTGTGTTGCATCTTGTGG - Intergenic
1028141397 7:87279385-87279407 AGAGGGGATGTTGCCACTGCTGG - Intergenic
1032186646 7:129732537-129732559 AGAGAGGATGTAGCATTTGCTGG + Intronic
1032415714 7:131733838-131733860 TAAGCGTGTGTTGTATCTGCTGG + Intergenic
1037858343 8:22387640-22387662 TGAGCGGGTGTTGGATCGTCTGG + Intronic
1049195827 8:141315188-141315210 GGAGTGGTTGCTGCATCTGCTGG + Intergenic
1049417663 8:142502834-142502856 AGAGTGGGTGTTGCTGCTGTTGG + Intronic
1053627198 9:39887467-39887489 AGAAAGAATGTTGCATCTGCTGG + Intergenic
1053778796 9:41578554-41578576 AGAAAGAATGTTGCATCTGCTGG - Intergenic
1054166758 9:61788794-61788816 AGAAAGAATGTTGCATCTGCTGG - Intergenic
1054216689 9:62363236-62363258 AGAAAGAATGTTGCATCTGCTGG - Intergenic
1054670793 9:67792105-67792127 AGAAAGAATGTTGCATCTGCTGG + Intergenic
1056460572 9:86805955-86805977 AGCTCGGGTCTTGCATTTGCAGG - Intergenic
1185825205 X:3243043-3243065 TGAGTGGGGGTTGCAGCTGCTGG - Intergenic
1187274509 X:17806047-17806069 ATAGTGGGTGTTGCTGCTGCAGG + Intronic
1195569042 X:106378896-106378918 AGAGATGTTGTGGCATCTGCTGG - Intergenic
1201975644 Y:19845890-19845912 AGAGCAGGTGTTGATTTTGCTGG + Intergenic