ID: 965610320

View in Genome Browser
Species Human (GRCh38)
Location 3:170536770-170536792
Sequence CTCATGAGAGATGCATAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965610320 Original CRISPR CTCATGAGAGATGCATAAGG TGG Intronic
900666502 1:3818960-3818982 CTCCTGAGAGATTCATAATTGGG + Intronic
906700542 1:47854303-47854325 CTCATGAGAGAGGCCAAAGGAGG - Intronic
907401012 1:54224831-54224853 CTCCTGGGAGATGAATCAGGTGG - Intronic
908142789 1:61204445-61204467 CTAATGTGAGATGCAGCAGGAGG + Intronic
908184721 1:61641807-61641829 CACATGAGAGAGGGAGAAGGAGG + Intergenic
909059156 1:70859704-70859726 CTCGTAAGAAATGCAGAAGGAGG + Intronic
913281835 1:117192376-117192398 CTTATGAGAGATGCTAAAGAAGG + Intronic
914954686 1:152150832-152150854 CTGATGATAGGTGCAGAAGGTGG + Intergenic
915568326 1:156729118-156729140 CTCATGAGAGAGGCCTCGGGCGG - Exonic
917608438 1:176660633-176660655 CTCATGAGATCTTTATAAGGAGG - Intronic
917928464 1:179807752-179807774 CTCATGAGAGCTGGACAGGGAGG - Intronic
918491334 1:185084447-185084469 ATAATGTTAGATGCATAAGGAGG + Intronic
919303358 1:195798949-195798971 CTCCTGATATGTGCATAAGGTGG + Intergenic
921336732 1:214094397-214094419 CTTATAAGAGATCCTTAAGGGGG + Intergenic
922819883 1:228476883-228476905 CTCAGGAGAGACGCCTCAGGGGG + Intergenic
923419677 1:233800080-233800102 TTCATGTGACATGCATAAGTTGG - Intergenic
924879379 1:248143114-248143136 TTCATGAGAGTCCCATAAGGAGG + Intergenic
924882546 1:248177933-248177955 CTCATGAGTGTCACATAAGGAGG + Intergenic
1064103294 10:12481245-12481267 GTCATCAGAAATGCAAAAGGTGG - Intronic
1066813644 10:39373159-39373181 ATCATGAGTGATGCAGAAGATGG - Intergenic
1067551831 10:47241775-47241797 CTCATTACAGATGCAAAAGCTGG - Intergenic
1069685735 10:70317260-70317282 ATCAGGAGAGAAGCAGAAGGAGG + Intronic
1071501897 10:86210197-86210219 CTCAGGAGAGCAGCACAAGGTGG + Intronic
1071942079 10:90601300-90601322 GTCATGTGAGATGCAAGAGGTGG - Intergenic
1072475784 10:95758537-95758559 CTCATCAGTTATGCCTAAGGTGG + Intronic
1076410588 10:130246236-130246258 CTCCTGTGGGATGCATCAGGAGG + Intergenic
1080895271 11:36443825-36443847 CTCCTGAGAGTTGCCTAAGTGGG + Intronic
1081228943 11:40561162-40561184 CACATAACAGATGCATAAAGGGG + Intronic
1082135855 11:48547978-48548000 AGCATGAGAGATGCAGAAGATGG - Intergenic
1085987282 11:81802173-81802195 CTCATGAAACATGCCCAAGGTGG + Intergenic
1089892448 11:121894876-121894898 AGCATGAGAGAGACATAAGGTGG + Intergenic
1090311943 11:125748648-125748670 CTGATGTGAAAGGCATAAGGTGG + Exonic
1092998674 12:13975254-13975276 CTCATTAGAAATGCAAAATGTGG + Intronic
1093223395 12:16450271-16450293 GTGATGAGAGATGTAGAAGGAGG - Intronic
1093813204 12:23511973-23511995 CTGAAGAGAGATGAACAAGGAGG - Intergenic
1094381498 12:29848512-29848534 AGCATGAGAGATGCAGAAGGTGG + Intergenic
1094777819 12:33752023-33752045 CTCTTGAAAGATACAGAAGGAGG - Intergenic
1099931195 12:89076948-89076970 CTCATGAGAAATGCTTCAAGTGG + Intergenic
1100003383 12:89864605-89864627 CTCATGAGAGAAGGAGAATGTGG + Intergenic
1103923208 12:124410238-124410260 CGCATCAGAGAGGCAGAAGGAGG - Intronic
1105020358 12:132812276-132812298 CTGATGGGAGATGTACAAGGAGG + Intronic
1111468369 13:88645906-88645928 CACATGGGAGATGCCTATGGTGG + Intergenic
1112730097 13:102351147-102351169 ATAATGAGAGATTCAGAAGGAGG - Intronic
1112947948 13:104955331-104955353 CTCAGGAGAGATGCTTCAGGGGG + Intergenic
1114985627 14:28225352-28225374 CTCATGAGAGATAAATTAGGTGG + Intergenic
1116306321 14:43262114-43262136 ATCATGAGTGATGCAGAAGATGG + Intergenic
1117531273 14:56662703-56662725 CTCATGTGGGATTCAGAAGGTGG - Intronic
1123792562 15:23736855-23736877 CCCTAGAGAGATGCATGAGGTGG + Intergenic
1125688966 15:41581227-41581249 TTCATGGGAGATGCAGCAGGAGG + Exonic
1137850256 16:51734763-51734785 GTCATGAAAGATGCAGAAAGTGG + Intergenic
1138563306 16:57815152-57815174 CTGATGTGAGAAGCAAAAGGAGG - Intronic
1139219643 16:65168106-65168128 CTGATGACAGATGCATAAGAGGG + Intergenic
1140608177 16:76565780-76565802 AACATGAGAAAGGCATAAGGAGG - Intronic
1144419617 17:15084221-15084243 CTGATGACACATGCCTAAGGTGG + Intergenic
1144664690 17:17094177-17094199 CTCTTGAGAAATGCACAGGGAGG + Intronic
1144725932 17:17502823-17502845 AACATGAGAGATGTGTAAGGGGG - Intergenic
1148769152 17:50056872-50056894 CTCATGAGAGATCTAAAGGGCGG - Intronic
1151698424 17:75730086-75730108 CTCATGAAAGATGCATCTGACGG - Intronic
1152352000 17:79789514-79789536 CTTATGAGAGCTGCAGAAAGGGG + Intergenic
1152578105 17:81151807-81151829 CTCAAGGGAGATGCACATGGTGG + Intronic
1153060182 18:986771-986793 CTCAAGAGAGTTGCACAATGGGG + Intergenic
1153514795 18:5893305-5893327 CTCATGAGAAAGGGATAAGGGGG - Intronic
1157886541 18:51372593-51372615 CTTATGAGAGATACCTAAAGTGG - Intergenic
1160148187 18:76380867-76380889 CACAGGAGAGATGCGTAGGGAGG - Intronic
1161814248 19:6489625-6489647 CTCATGAGAGATTTAGAAAGTGG + Intergenic
1164265541 19:23613477-23613499 AGCATGAGCGATGCAGAAGGTGG + Intronic
1167518307 19:49936538-49936560 CTCAGGAGAGGTGCTTAAGGAGG - Intronic
1167735903 19:51294434-51294456 CTCATAACAGAGGCTTAAGGAGG + Intergenic
926573193 2:14552336-14552358 CTCATGAGAAATAACTAAGGAGG - Intergenic
926672505 2:15589349-15589371 CTCATGGGAGTTGCATGTGGAGG - Intergenic
926932133 2:18051214-18051236 GGCATGAGAGATGGAGAAGGTGG - Intronic
928574641 2:32642593-32642615 CTCATGAGAGTTGCAAATAGAGG - Intronic
934532891 2:95106678-95106700 CTGATGAGAGATGGATGGGGAGG - Intronic
935821196 2:106894582-106894604 CTCATGAGAGAAGGTTAAGCAGG - Intergenic
936768575 2:115884458-115884480 CTGATCAGAGATGTATAATGAGG + Intergenic
937892825 2:126952421-126952443 CTCATGATAGATGAACAATGTGG - Intergenic
939080301 2:137653087-137653109 CTTATGAGAAATGCTAAAGGGGG - Intronic
940927024 2:159375436-159375458 GACATGAGAGGTGCATAAAGAGG + Intronic
941245150 2:163086948-163086970 CCCATGAGAAATGCAGAAGAGGG + Intergenic
945962524 2:216150625-216150647 CTAATGATAGATGCCTAGGGAGG + Intronic
947170013 2:227301379-227301401 CTCATCAGTGATGCGTAATGAGG + Intronic
947452149 2:230218619-230218641 CTCATGACAGATGAAGAATGAGG - Intronic
948410402 2:237755340-237755362 TTCATGAGAGATGCTTTAGTAGG + Intronic
949078094 2:242074140-242074162 CTCATGAGGGCTGCTTTAGGGGG + Intergenic
1169179304 20:3548905-3548927 CTCCTGAGAGTTGCTTAAGCAGG + Intronic
1169807847 20:9577727-9577749 CTCGTGAGAGATTCATGAGCAGG - Intronic
1174977825 20:55354407-55354429 CACCTGAGAGATGCAAAATGGGG - Intergenic
1175543340 20:59762031-59762053 CTCACGTGAGATGCAGAGGGCGG + Intronic
1179546315 21:42114602-42114624 CCCTTGAGAGAGGCATAAGATGG + Intronic
1182924865 22:34112663-34112685 CTCAAAAAAGATGCATGAGGTGG + Intergenic
950250350 3:11460232-11460254 CCAATGAAAGATGCAAAAGGAGG - Intronic
950737402 3:15021142-15021164 CTTATTACAGATGCATCAGGAGG + Intronic
951295283 3:20926275-20926297 CTCATGACAGAAGCCTGAGGGGG + Intergenic
951534211 3:23726708-23726730 TTCAGGAGAGATGCCTAAAGAGG - Intergenic
951709601 3:25574874-25574896 GCCAGGAGAGATGCATCAGGAGG + Intronic
952632275 3:35483197-35483219 AGCATGAGAGATGCAGAAGATGG - Intergenic
953402097 3:42632700-42632722 AACATGAGAGAAGCAGAAGGAGG + Exonic
954674649 3:52309080-52309102 CACCTGAGAGAGGCACAAGGGGG - Intergenic
959331373 3:105009553-105009575 CTGATGACAGGTGCCTAAGGTGG - Intergenic
960495122 3:118363836-118363858 CTCATGAGTGATGAATCAGGAGG + Intergenic
965610320 3:170536770-170536792 CTCATGAGAGATGCATAAGGTGG + Intronic
968052987 3:195668843-195668865 CTCTTGAGAAATGCATAAGATGG - Intergenic
968102827 3:195979520-195979542 CTCTTGAGAAATGCATAAGATGG + Intergenic
969890710 4:10257290-10257312 CTCCTTATGGATGCATAAGGAGG + Intergenic
973903238 4:55499712-55499734 CCCCTGAGAGATGCATGCGGAGG - Intronic
979236232 4:118403744-118403766 AACATGAGTGATGCATAAGACGG + Intergenic
979545369 4:121933780-121933802 CTTAAGAGAAACGCATAAGGTGG - Intronic
980677870 4:136113545-136113567 CTCTTGAGAGATGCTGAAGTTGG + Intergenic
981032153 4:140136301-140136323 CTTATGAGAGAGGCAAGAGGAGG - Intronic
981891057 4:149737841-149737863 GTCATGAGAGAAGGAAAAGGAGG - Intergenic
983182013 4:164658949-164658971 CTCATTAGAGATGCCTAAATAGG + Intergenic
984472576 4:180194912-180194934 CTCATGAGAGATACAAATGAAGG + Intergenic
985419317 4:189767859-189767881 CACATGAGAAATTTATAAGGAGG + Intergenic
985499248 5:231204-231226 CTCTTGAGAAATACATAAGACGG - Intronic
986308555 5:6533509-6533531 ATCATGACAGAGGCATCAGGAGG + Intergenic
987997373 5:25302222-25302244 CTCATCAGAGGTGGCTAAGGAGG - Intergenic
988572840 5:32389145-32389167 ATCTTGAGAGATGCAGAAGCTGG - Intronic
989291133 5:39767428-39767450 GTTATGACATATGCATAAGGTGG - Intergenic
989296351 5:39831413-39831435 CTTATGAGAGATGTATATAGAGG - Intergenic
989681986 5:44040955-44040977 AGCATGAGCGATGCATAAGATGG + Intergenic
992197148 5:74351162-74351184 AGCATGAGAGATGCAGAAGACGG - Intergenic
996871713 5:128199841-128199863 CTCATCAGTGATGAATAAGTGGG - Intergenic
997345481 5:133188430-133188452 ATCATCAGGGATGCAGAAGGGGG - Intergenic
1000557575 5:162744959-162744981 CACATGATATGTGCATAAGGTGG - Intergenic
1001225909 5:169944443-169944465 CTCTGGAGAGATGCTGAAGGAGG + Intronic
1001584119 5:172821199-172821221 CTCATGAAGGAAGGATAAGGTGG + Intergenic
1001645363 5:173277637-173277659 CTAATGAGAGATGCATTGGAGGG - Intergenic
1002634856 5:180602214-180602236 CTCATGAGAGATGAACACTGTGG - Exonic
1003618143 6:7673518-7673540 CTCACAAGAACTGCATAAGGTGG - Intergenic
1007554751 6:42756502-42756524 CTCAAGAGAGAGGCAGAGGGAGG - Intronic
1008170006 6:48193336-48193358 CTCAGAAGAGCTGCTTAAGGTGG - Intergenic
1009025055 6:57989441-57989463 CTCATGAGACAAGCATTTGGAGG - Intergenic
1009200622 6:60740897-60740919 CTCATGAGACAAGCATTTGGAGG - Intergenic
1010424394 6:75710842-75710864 CTCAAGTGAGATGGATAAGTGGG + Intronic
1012348474 6:98221589-98221611 ATCAGCAGAGATGCATAATGGGG + Intergenic
1015902524 6:138082604-138082626 CTCATGAGACATGCAGAAGCTGG - Intergenic
1020538908 7:9436444-9436466 AGCATGAGAGATGCAGAAGACGG + Intergenic
1023667318 7:42537276-42537298 CTTATGAGAGAGGCCTGAGGAGG - Intergenic
1024202336 7:47120112-47120134 CTGATGTGAGATGGATAAGTTGG - Intergenic
1024958660 7:54952157-54952179 CTCATGAGTGGTGAATCAGGAGG + Intergenic
1030164701 7:106542416-106542438 CCCACAAGAGCTGCATAAGGTGG - Intergenic
1032950678 7:136907596-136907618 CTCAAGAGAGAGGCACAATGGGG - Intronic
1034131284 7:148720436-148720458 CTGATGGGAAATGCAGAAGGGGG + Intronic
1034657672 7:152742180-152742202 CTCATCAGGGATGAACAAGGTGG + Intergenic
1034792537 7:153984323-153984345 CTCCTGTGAAATGCAGAAGGAGG - Intronic
1035071115 7:156145789-156145811 CCCCAGGGAGATGCATAAGGAGG + Intergenic
1044497284 8:92902080-92902102 GTCATCAGAGATGAAAAAGGAGG - Intronic
1044601519 8:94009696-94009718 AGCATGAGTGATGCATAAGACGG - Intergenic
1046516665 8:115271148-115271170 CTCATCAGAGATTAATAAGAGGG - Intergenic
1047794168 8:128236967-128236989 CTCATGTGAGAGGCAAAAAGAGG + Intergenic
1048089155 8:131219691-131219713 CCCCTGAGAGATAAATAAGGGGG + Intergenic
1059337351 9:113577586-113577608 CTGATGGGATATGCAGAAGGAGG + Intronic
1186144673 X:6612908-6612930 CTCAGGAGAGAAGCTTTAGGAGG - Intergenic
1186740112 X:12508254-12508276 CTCATGAGAGGTTCCTCAGGTGG + Intronic
1191775461 X:64808447-64808469 ATCATGAGTGATGCAGAAGATGG + Intergenic
1192430189 X:71106591-71106613 CTGATGAGTCATGCAGAAGGAGG + Exonic
1194573829 X:95586577-95586599 CTCATGGGACATGAATATGGTGG + Intergenic
1198084633 X:133270574-133270596 TTCCTGGGAGATGCAGAAGGGGG - Intergenic
1201234960 Y:11900332-11900354 CCCAGGAGAGATGCCTAAGGAGG - Intergenic
1201410155 Y:13691387-13691409 AGCATGAGAGATGCAGAAGATGG + Intergenic
1201532689 Y:15009679-15009701 CTAAGGAGAGAAGCATGAGGAGG + Intergenic