ID: 965610926

View in Genome Browser
Species Human (GRCh38)
Location 3:170543341-170543363
Sequence CTGTGCTTCTTAAAGACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 272}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965610926_965610936 27 Left 965610926 3:170543341-170543363 CCCTCTGTCTTTAAGAAGCACAG 0: 1
1: 0
2: 2
3: 21
4: 272
Right 965610936 3:170543391-170543413 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
965610926_965610934 24 Left 965610926 3:170543341-170543363 CCCTCTGTCTTTAAGAAGCACAG 0: 1
1: 0
2: 2
3: 21
4: 272
Right 965610934 3:170543388-170543410 TCCTGTAATCCCAGCACTTTGGG 0: 6574
1: 298330
2: 272362
3: 154692
4: 139673
965610926_965610933 23 Left 965610926 3:170543341-170543363 CCCTCTGTCTTTAAGAAGCACAG 0: 1
1: 0
2: 2
3: 21
4: 272
Right 965610933 3:170543387-170543409 CTCCTGTAATCCCAGCACTTTGG 0: 5428
1: 199502
2: 273806
3: 196586
4: 162484
965610926_965610930 -4 Left 965610926 3:170543341-170543363 CCCTCTGTCTTTAAGAAGCACAG 0: 1
1: 0
2: 2
3: 21
4: 272
Right 965610930 3:170543360-170543382 ACAGTCTCCACCGGGTGCAGTGG 0: 1
1: 0
2: 1
3: 37
4: 386

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965610926 Original CRISPR CTGTGCTTCTTAAAGACAGA GGG (reversed) Intronic
900357745 1:2272897-2272919 CTGTGCTTCTTCCAGGCGGAGGG + Intronic
900369900 1:2327640-2327662 CTGTGCTTCTAAAAGCCGCACGG - Intronic
900956406 1:5888780-5888802 CTGCACTTCCTGAAGACAGAGGG - Intronic
901190583 1:7407625-7407647 CTTTCATTCTTAAAGCCAGAGGG - Intronic
903465276 1:23547934-23547956 CTGAATTTCTCAAAGACAGAAGG - Intergenic
904489265 1:30848125-30848147 GTGTGCATGTTAAAGACAAAGGG - Intergenic
905649516 1:39647008-39647030 CTGAGCTCCTTGAAGTCAGATGG + Intergenic
906419422 1:45651759-45651781 CTCTGCTTCTTGACGACAGCAGG + Intronic
907634882 1:56124411-56124433 CTCTGTTTTTTAAAGCCAGATGG + Intergenic
908830823 1:68176608-68176630 ATGAGCTGCTGAAAGACAGAGGG - Intronic
908841001 1:68280012-68280034 ATGAGATTCTTCAAGACAGAAGG - Intergenic
909526329 1:76626765-76626787 CTGGCCTTCACAAAGACAGAAGG + Intronic
910169287 1:84360417-84360439 CTGGGCTTGTTAAGGAAAGAAGG - Intronic
910229998 1:84975443-84975465 CTGTGGTTCTTATAGACTCATGG - Intronic
911184448 1:94889064-94889086 GTTTGGTTCTTAAAGACAAAAGG - Intronic
912755002 1:112316900-112316922 CTGTGTTTCTTGGAAACAGAAGG - Intergenic
914694634 1:150066083-150066105 CTGTGCTTTTTTAAGAAAGAAGG - Intergenic
914726471 1:150331816-150331838 CTGAACTTCTTTAGGACAGAAGG + Intronic
915695109 1:157732536-157732558 CTGTGTTTCTTAAACATTGAAGG + Intergenic
916176000 1:162039154-162039176 CTGTGCTTCTTACCAACATAGGG + Intergenic
916278997 1:163027945-163027967 CTGTCCTTGTTAATTACAGAAGG - Intergenic
916283080 1:163074206-163074228 TTTTGCTTCTGAAATACAGAGGG + Intronic
916530873 1:165655082-165655104 CTGTACTTCTTTGAAACAGAGGG + Intronic
919433187 1:197522943-197522965 CTGAGCGTCTCAAAGACAGGGGG + Intronic
921066548 1:211626940-211626962 CTGGGCTTGTTAAACGCAGATGG + Intergenic
921221967 1:212979829-212979851 CTGTGGTTCGTAAAGAGAAAGGG + Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921619339 1:217308925-217308947 GTGTGCTTCTAAAAGACAACAGG - Intergenic
921845945 1:219882201-219882223 CTGTGATTCTTAAAGAAACTCGG - Intronic
923814909 1:237366572-237366594 CTGTGTTTTTTAAATACAGTTGG - Intronic
1063047095 10:2403434-2403456 CTGTTCTTCTTAAAGATTCAAGG - Intergenic
1063487556 10:6434125-6434147 CTCTGCTTCTTAAGGACATTTGG + Intronic
1064254424 10:13732039-13732061 CTGTGCTTCTGAAGGCCAGGAGG + Intronic
1064491440 10:15861190-15861212 TTGTGCTGCTTAAAAAAAGAGGG + Intergenic
1065580659 10:27168226-27168248 CTTTACTTTATAAAGACAGAAGG - Intronic
1065600007 10:27358507-27358529 GTGTGTTTGTTAAAGATAGAAGG + Intergenic
1065725805 10:28666997-28667019 CAGCGCTCCTGAAAGACAGATGG + Intergenic
1066550210 10:36547593-36547615 CTGGGTTTCTTAAAGACATCTGG - Intergenic
1067183708 10:44009455-44009477 CTGTGCTTTCTAAGGGCAGAAGG - Intergenic
1068170895 10:53393224-53393246 CTCTGCTTCTTGAGGAGAGAGGG + Intergenic
1068982534 10:63076595-63076617 ATGTTCCTCTTGAAGACAGAAGG + Intergenic
1071917675 10:90313876-90313898 CTGTGATATTAAAAGACAGAAGG - Intergenic
1072010600 10:91299708-91299730 CTGTGGTTCTCAAAGTCAGCCGG + Intergenic
1073947448 10:108767375-108767397 CTGTGTTTCTTAAAGTAATAAGG + Intergenic
1075184517 10:120243674-120243696 CCGTGCTTCTGACTGACAGAGGG + Intergenic
1075309839 10:121404984-121405006 CACTGCTTCTTCAGGACAGATGG + Intergenic
1075879463 10:125837957-125837979 CTGTCCTTCTTAAAGACACATGG + Intronic
1076133026 10:128026749-128026771 CTTTGCTTGTTAAAGAGAAAAGG - Intronic
1078391199 11:10937041-10937063 CTGTGCTTCTTAAAAACTCATGG - Intergenic
1078768168 11:14319662-14319684 CTGTGCTCTTAGAAGACAGAGGG - Intronic
1080706948 11:34704377-34704399 CTGTGCTCCTGAATGACTGATGG - Intergenic
1080861736 11:36155883-36155905 CTCAGCTTCTTAAAGGCAGGGGG - Intronic
1081144071 11:39539519-39539541 ATATGCTTCTGAATGACAGATGG - Intergenic
1081292792 11:41347460-41347482 ATGTGCTTCAAAAAGAAAGAAGG + Intronic
1081984383 11:47290915-47290937 CTTTGCTTCTTAGAGAGGGAAGG + Intronic
1082029203 11:47592729-47592751 CTGTGTCTCTTAGAGACAGCAGG + Intronic
1083477370 11:62923014-62923036 CTGTGCTTCTCAAAGCCAGCTGG + Intergenic
1085274456 11:75289445-75289467 CTGTGCCTCTCACAGCCAGATGG - Intronic
1085281457 11:75333802-75333824 CTGTGCTTCCCTAAGACAGGTGG - Intronic
1085456328 11:76667502-76667524 CTGTGCGCCTTCAAGAGAGATGG - Intronic
1085824155 11:79825571-79825593 CTGTGGGTCTTACAGAAAGAAGG - Intergenic
1086201329 11:84205943-84205965 CTGATTTTTTTAAAGACAGATGG + Intronic
1086237623 11:84650977-84650999 CTGTGCTTTTTAAAAAGTGATGG + Intronic
1087084159 11:94199565-94199587 CTGTGATTCAGAAAGGCAGATGG - Intergenic
1087260970 11:96011941-96011963 CTGTGCTTGTTAAAAAGAAAAGG + Intronic
1087448552 11:98287162-98287184 CTGTGCTTCTTATAAATAGTAGG + Intergenic
1087604825 11:100364916-100364938 GTTTGCATCTTAAAGACAGCTGG - Intergenic
1089272704 11:117313136-117313158 GCGTCCTTCTTACAGACAGATGG + Intronic
1092978146 12:13765919-13765941 CTGTGCTTCCTAAAGAAACAAGG - Intronic
1094047322 12:26181791-26181813 CTGTGCAACTTAAAAACAGGAGG + Intronic
1097180574 12:57169373-57169395 CCGTGGGTCTGAAAGACAGATGG - Intronic
1097984193 12:65766252-65766274 ATGTGCATCTTAAAGATAGAAGG + Intergenic
1098807778 12:75041918-75041940 CTGTGCTTCATGGAGACAGATGG + Exonic
1100660064 12:96687066-96687088 CTGTTGGTCTTGAAGACAGAAGG - Intronic
1100782797 12:98047258-98047280 ATATGCTTCTTAAAGAATGAGGG - Intergenic
1101242698 12:102854144-102854166 CTTTGCTTCTTAGATAAAGAAGG - Intronic
1103367343 12:120392958-120392980 CTGTGCTTTTTAAAGAAAAGGGG - Intergenic
1104247253 12:127055794-127055816 CTGTGCTTGATGAAGGCAGAGGG - Intergenic
1105733774 13:23246756-23246778 ATGGGCTTCTTTAAGAGAGACGG - Intronic
1109045914 13:57410148-57410170 CTGTGATTCTTACAGACTCATGG - Intergenic
1109692885 13:65916100-65916122 GTGTGCTTCTTAAAGTCATCTGG - Intergenic
1109944454 13:69414814-69414836 CTGTGCTCCCTGAAGACAGTGGG + Intergenic
1110014842 13:70387155-70387177 GTGTGCTTCATAAAGCCAGAGGG - Intergenic
1110786364 13:79532261-79532283 CTGTGTTTCTTACAAACTGAAGG - Intronic
1111187414 13:84757011-84757033 ATGTGCTTCTAACAGATAGAAGG - Intergenic
1111750687 13:92328025-92328047 CTGTGCTTCTTCAGGGCAAAAGG + Intronic
1116536655 14:46040257-46040279 ATGTGTCTCTTAAAGACAGCAGG + Intergenic
1116683374 14:48006884-48006906 CTGTGGTCATTAAAGCCAGAGGG + Intergenic
1117040347 14:51763550-51763572 CTGGGCATCTAAAAGACTGAGGG + Intergenic
1117474912 14:56084282-56084304 GTTTTCTTCTTAAAGACAGGAGG - Intergenic
1117576084 14:57099659-57099681 TTGTGGTTTTTAAAGCCAGATGG - Intergenic
1117990604 14:61429354-61429376 TTCTGTTTCTCAAAGACAGATGG + Intronic
1118040017 14:61906287-61906309 CTGTGCTACTAAAAAACATAAGG - Intergenic
1118194105 14:63608752-63608774 CTCAACTTCTTAAAGGCAGAAGG - Intronic
1119189405 14:72670203-72670225 CCGTGCTTCTGGAAGATAGAAGG - Exonic
1122160642 14:99781611-99781633 CTGTGCTTCAGGAAGACTGATGG - Intronic
1124661984 15:31557454-31557476 CAGTGCCTCTTAATGGCAGAAGG - Intronic
1124805413 15:32876977-32876999 CTCTGCTCTATAAAGACAGATGG + Intronic
1125225734 15:37393770-37393792 ATGTGTTTCTTAAAGAGATATGG - Intergenic
1126296631 15:47144930-47144952 CTGTTCTTCTTAAGCACACATGG + Intergenic
1126968555 15:54083764-54083786 CTGTGCTTGTGAAAGTCTGAGGG + Intronic
1127012565 15:54645609-54645631 CTGTGGTTCTTGCAGACATATGG - Intergenic
1127734394 15:61828125-61828147 CTGTGCTTACTAAAGAAAGCTGG - Intergenic
1130031335 15:80317211-80317233 CTGAGCTTCTTTAAGATTGAGGG - Intergenic
1130755559 15:86759197-86759219 TTATGCTTTTTAAAGACAGTTGG + Intronic
1131373970 15:91908297-91908319 CTCTGCTTTTTAAAGAAAAATGG + Intronic
1133190760 16:4132033-4132055 CTGTGCTTATTAAAGAAAGTTGG - Intergenic
1134386971 16:13782336-13782358 CTGTGCTGCAAATAGACAGAAGG - Intergenic
1134889940 16:17831784-17831806 CTGTGCATCTTAAATAAGGAAGG - Intergenic
1135639345 16:24107571-24107593 CTGTGCATCTCAAAGTCAGAAGG + Intronic
1138333964 16:56237605-56237627 CTGTGCTTCCCAAAAACACATGG - Intronic
1138500838 16:57443048-57443070 CTGTTTTCCTTAATGACAGAGGG + Intronic
1138966483 16:62090583-62090605 ATGTGCTCATTAAAGAAAGATGG - Intergenic
1139673175 16:68505529-68505551 CTTTGCTTCTCAGAGGCAGAAGG + Intergenic
1140558922 16:75954621-75954643 CTGTGCTTCTGATACACAGCTGG + Intergenic
1141857043 16:86690294-86690316 CTGTGTTTCTTACAAACTGAGGG - Intergenic
1143889651 17:10092873-10092895 CTGTGCCTCTGAGAGAGAGAGGG - Intronic
1144511601 17:15881834-15881856 CTGTGTTTCTGGAAGACACAAGG - Intergenic
1144585998 17:16488163-16488185 CAGGGCTCCTTAAAGACAGCAGG + Intronic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1145810644 17:27761981-27762003 TTTTGCTTCTTGAGGACAGAGGG + Intronic
1146717651 17:35099876-35099898 CAGTGCTGGTGAAAGACAGAGGG + Intronic
1146974959 17:37103271-37103293 CTGTTCTCCTGAAAGAAAGAAGG + Intronic
1147053746 17:37817950-37817972 CTGTTCTTCTTCTAGACAGGAGG + Intergenic
1149302640 17:55318932-55318954 CTGTGCTTCTGAAAGCGAGCAGG - Intronic
1151078071 17:71297052-71297074 CTGTGTCTCTGAAAGTCAGAGGG + Intergenic
1152924804 17:83081931-83081953 CTGTGCTTCGTCAGGACAGCTGG - Intronic
1153115262 18:1647316-1647338 CTGTGCAACTGAAACACAGAAGG - Intergenic
1154360146 18:13654090-13654112 CTGTGCCTCTGAAGGACAGGAGG + Intergenic
1155083347 18:22431656-22431678 CTGTGATTCTCAAACACAGTGGG - Intergenic
1155784923 18:29884126-29884148 CTGTCCTTCTTAAAAAAGGAAGG + Intergenic
1159652246 18:70990846-70990868 CAGTGTTTGTGAAAGACAGATGG + Intergenic
1163810277 19:19427085-19427107 CTCAAATTCTTAAAGACAGAAGG + Intronic
1164782361 19:30903254-30903276 CTCTGGTTATTTAAGACAGATGG - Intergenic
1168046597 19:53798491-53798513 CTGTGCTGGTTGCAGACAGAGGG + Intronic
1168511654 19:56978371-56978393 CTGTGCTTCTCACAAACAGCAGG + Intergenic
929726490 2:44434289-44434311 CTGTGCTTCAGATAAACAGATGG - Intronic
930400694 2:50881273-50881295 CTTTGCTTTCTAAGGACAGAAGG - Intronic
931243387 2:60472142-60472164 CTGTCCTTATCAATGACAGACGG - Intronic
933231041 2:79807741-79807763 TTGTGCTTTTTAAAGCCAAATGG - Intronic
933405050 2:81847379-81847401 CTGTGATCCTGAAAAACAGAAGG + Intergenic
933466777 2:82661478-82661500 CCTTGCTTCTCAAAAACAGATGG - Intergenic
935519423 2:104085459-104085481 GTGTCCTTCTTAGAGAAAGAGGG + Intergenic
935528576 2:104203912-104203934 CTGTGCAACATAATGACAGATGG - Intergenic
936460549 2:112711184-112711206 CTGTGCTGCAGAAAGGCAGAAGG - Intergenic
939535632 2:143424287-143424309 CTGACCTCCTTAATGACAGATGG - Intronic
941203548 2:162544178-162544200 GTGTGCTTTTTAAAGGCAGTGGG - Intronic
941848610 2:170157070-170157092 ATGAGCTTCTTAAATATAGAGGG + Intergenic
943974670 2:194458584-194458606 CTATGCTTCTTCATGAAAGAAGG + Intergenic
944120071 2:196231175-196231197 CTCTGTTTCTAAAAGACACAGGG - Intronic
944399669 2:199311024-199311046 CTACACTTCTTAAAGACTGATGG - Intronic
945395902 2:209317188-209317210 CTTTTCTCCTTAAAGTCAGAGGG - Intergenic
946174702 2:217915429-217915451 CAGTGCTTCTTGAAGACAGACGG - Intronic
946300651 2:218821905-218821927 CTGAGCTTCCTGAAGCCAGAGGG + Intergenic
946842744 2:223834910-223834932 CTGGGCTTATCAAAGACAGTTGG + Intronic
947586904 2:231362044-231362066 CCGTGCTTCTTAAAGATAGCTGG - Intronic
948121468 2:235534123-235534145 CGCTGCTTCTCAGAGACAGAAGG - Intronic
1170220851 20:13940100-13940122 CTGTATTTCTTACAGACAAATGG - Intronic
1170250983 20:14282464-14282486 CTGGGCTTCTTACAGCCTGATGG + Intronic
1170523042 20:17208108-17208130 GTGTGCTTCTTAAACACACTTGG - Intergenic
1171377185 20:24701420-24701442 CTGTGTTTCTCCAATACAGAAGG + Intergenic
1173048002 20:39531066-39531088 CTGAGCTTCTGAAGGTCAGAGGG - Intergenic
1173108008 20:40156255-40156277 CTATGCTTCTGGAAGACTGAAGG - Intergenic
1173337713 20:42126293-42126315 CTGTGATTATTAAAGACAGCAGG + Intronic
1174123840 20:48288191-48288213 CTGTGCTGCTGAGAGAGAGAGGG - Intergenic
1174227889 20:49018898-49018920 CTATGCTGCTTAAAGACTGGCGG - Exonic
1177853628 21:26377572-26377594 CTGGGCTTCTTAAAGAAATGGGG + Intergenic
1178189132 21:30260307-30260329 CTGTGCTTCCTAAACTGAGATGG + Intergenic
1178661984 21:34514573-34514595 CTATGTTTATGAAAGACAGAAGG - Intronic
1178694888 21:34784355-34784377 ATGTGCTTTCAAAAGACAGATGG - Intergenic
1179352595 21:40626722-40626744 ATAAGCTTCTTAAAGGCAGAGGG + Intronic
1180800031 22:18627394-18627416 CTGTGCATCCCCAAGACAGATGG + Intergenic
1181221684 22:21367872-21367894 CTGTGCATCCCCAAGACAGATGG - Intergenic
1181412224 22:22731859-22731881 CTGTGCTTCTTATTGCTAGAAGG - Intergenic
1181764179 22:25079464-25079486 CTGTGCTGGGGAAAGACAGAAGG + Intronic
1183802599 22:40179902-40179924 CCTTGCTTGTTAGAGACAGAGGG - Intronic
1184829794 22:46977416-46977438 CTGAGCTTCTTGGGGACAGAGGG - Intronic
1185098402 22:48824158-48824180 CTCAGCTCCTTGAAGACAGACGG + Intronic
1185138627 22:49088124-49088146 CTCTGCTTCCCAAAGACAGATGG + Intergenic
1185202593 22:49517267-49517289 CTGTGCTTCTTGGGGACCGAGGG - Intronic
950079819 3:10213375-10213397 CTGAGCTTCTTGAAGACGAATGG - Exonic
951807430 3:26661883-26661905 CTGTGCCTTTTAAAGACTGGTGG + Intronic
952042348 3:29276477-29276499 ATGTCCTTCTTAAAGATAGAAGG + Intergenic
952729866 3:36627445-36627467 AGGTGCTTCTGTAAGACAGATGG + Intergenic
953180984 3:40595252-40595274 CTGTGCTTCTCAAAGAATGGGGG + Intergenic
953978051 3:47397336-47397358 CTGTGTTTTTTACAGACTGAAGG - Intronic
954963132 3:54583794-54583816 CTTTGGGTCTTAAAGACAAAAGG + Intronic
956004665 3:64765678-64765700 CTGTGTTTCTAAAAGCCATACGG + Intergenic
956591506 3:70920223-70920245 CTGTGGGCCTCAAAGACAGATGG + Intergenic
958056212 3:88415728-88415750 CTGTGGTTCTTGAAGTTAGATGG - Intergenic
958161788 3:89826108-89826130 ATTTGCTTCTTCAAGAAAGAGGG + Intergenic
960932280 3:122865306-122865328 CTGTGTTTCTTACAGTTAGAGGG + Intronic
961751208 3:129095865-129095887 CTCTGCTTCTAAAAGACACTAGG - Intronic
961869275 3:129976123-129976145 CTGAGCTTCCGAAAGGCAGAAGG - Intronic
962280794 3:134050249-134050271 ATGAGTTTCTAAAAGACAGAAGG - Intronic
964348549 3:155779985-155780007 CTGTGCTTCTGTAACACAGCAGG + Intronic
964372070 3:156010868-156010890 CTTTGATTCTTAGAGATAGATGG - Intergenic
965610926 3:170543341-170543363 CTGTGCTTCTTAAAGACAGAGGG - Intronic
966037904 3:175442786-175442808 TTATGCTTCATAAAGACTGAGGG - Intronic
967224617 3:187279102-187279124 CTTTGCGTGTTAAATACAGAGGG + Intronic
967292713 3:187936721-187936743 CTCTGCTTCTCAATGACTGAAGG + Intergenic
969038213 4:4273213-4273235 CTTTTCTCCTTAAAGACAGTGGG + Intronic
970061317 4:12037748-12037770 CTTTTCTTCTTAAATAGAGATGG + Intergenic
971130677 4:23806122-23806144 CTGTGTTTCATAAAAAGAGATGG - Intronic
971582195 4:28356313-28356335 CTGTGATTCTTACAGTCTGATGG + Intergenic
974854113 4:67438899-67438921 CTGTGCTTCTTGCAGAGGGAGGG + Intergenic
976470267 4:85420143-85420165 CTCTGCTTCTGAAATACAGCAGG - Intergenic
981661961 4:147178073-147178095 CTGTGCGTCTGAAACACAAAGGG + Intergenic
982433969 4:155359711-155359733 CTGTGCTTCTTTAAAATAGATGG - Intronic
982765754 4:159346639-159346661 CTGTGCTTCATAAAGGCAACAGG + Intronic
984489442 4:180414388-180414410 CTGTGCATCTTAATGACTGGAGG + Intergenic
985879235 5:2626028-2626050 CTGTGAGTCTTAGAGACAAAGGG + Intergenic
986682214 5:10244384-10244406 GTGTGCTTCTTACAAACAGAAGG - Intronic
988174206 5:27700021-27700043 TTTTTCTTCTTAAAAACAGATGG - Intergenic
988945646 5:36195141-36195163 CTGTGCTTCTTGAACAGTGAAGG - Exonic
991058755 5:62348556-62348578 ATTTGTTTCTTAAAGAAAGATGG + Intronic
991133024 5:63147866-63147888 CTGTGCTATTTTAAGTCAGATGG + Intergenic
992008506 5:72503421-72503443 CTGTGATTCTCCAAAACAGATGG - Intronic
992086987 5:73286469-73286491 CTCTGCTGTTTGAAGACAGAAGG - Intergenic
992379666 5:76224791-76224813 CTGTGCTTGTGAAGAACAGATGG - Intronic
992614954 5:78538804-78538826 CTGTGCATCTCAAAGACAATGGG - Intronic
993266106 5:85728424-85728446 CTGAGCTTCTTATAAACTGAAGG + Intergenic
994096196 5:95850401-95850423 CTGAGCTTTTTAAGGACACAGGG + Intergenic
995222407 5:109664865-109664887 ATATGCATCTAAAAGACAGAAGG - Intergenic
996038450 5:118784266-118784288 ATGTGATTCTTAGAGACAAATGG + Intergenic
996218573 5:120899216-120899238 CTTGGCATCTTTAAGACAGAGGG - Intergenic
999053842 5:148552490-148552512 CTGTCCTTCTTAGAGACTAACGG + Intronic
999248819 5:150169478-150169500 CTGACCTTCTTGAAGCCAGAAGG + Intronic
999788783 5:154917757-154917779 CTGTAGTTCTCAAAGACACAAGG + Intronic
1000370064 5:160526926-160526948 CTGTCCTTCTTGCAGATAGAGGG + Intergenic
1001211050 5:169810674-169810696 CAGTCTTTCTTAAAAACAGAAGG - Intronic
1001763411 5:174225680-174225702 GTCTGGTTCTTAAACACAGAAGG + Intronic
1003015326 6:2463090-2463112 CTGTGCTTCCTACAGGCAGCCGG + Intergenic
1003489658 6:6610383-6610405 CTGTGGGTCATAAAGGCAGAGGG - Intronic
1003680682 6:8251179-8251201 CTGTGGTTCTTTAAGCCAGTAGG - Intergenic
1004591883 6:17059768-17059790 ATTTGCTTCTCAAAGATAGAGGG - Intergenic
1005231456 6:23706172-23706194 ATGTTCTTCTTATACACAGATGG + Intergenic
1008768369 6:54947795-54947817 TGTTGCTTTTTAAAGACAGAAGG + Intergenic
1009802806 6:68563308-68563330 TTGGGATTCTTAAAGAAAGAAGG + Intergenic
1013515267 6:110879386-110879408 ATGTGCTTCTTAAAGATACATGG - Intronic
1014102577 6:117527988-117528010 ATGTTCTGCTTAAAAACAGATGG - Intronic
1015988540 6:138911528-138911550 CTCTGCTACTGAAAGGCAGATGG + Intronic
1016675105 6:146756040-146756062 CTGTAGTTGTTAAAGAGAGAGGG - Intronic
1017247497 6:152242060-152242082 CTGTGCTACTGAAAGCCAGTGGG + Intronic
1019020474 6:168913685-168913707 CTGTGCTGCAGGAAGACAGAGGG + Intergenic
1019629149 7:2037391-2037413 CTGTGCTTCTTACAAATGGAAGG + Intronic
1020439392 7:8201446-8201468 CTGGGCCTTTTAAAGACACATGG + Intronic
1020679051 7:11214464-11214486 CTCTGCTTCATGAAGACAGATGG + Intergenic
1020907749 7:14085672-14085694 CTGTGCTTCTGGAAGGGAGAAGG - Intergenic
1023895814 7:44431977-44431999 CTGTGGTTTTTAAAAACAAATGG - Intronic
1024929129 7:54651595-54651617 ATGTGCACTTTAAAGACAGACGG - Intergenic
1030316693 7:108122686-108122708 CTCAGCTTATTAAAGACAGCAGG + Intronic
1031138719 7:117917443-117917465 GTGTTATTCTCAAAGACAGAAGG + Intergenic
1031890035 7:127283272-127283294 ATGTGATTTTTAAACACAGAGGG + Intergenic
1038764814 8:30417096-30417118 TTGTTCTTCTAAGAGACAGATGG + Intronic
1041899718 8:62968206-62968228 CTATGCTTCTGTAAGACAAAGGG + Intronic
1042089477 8:65143418-65143440 CAGTGCTTCTGAAAGGCAAATGG - Intergenic
1045409584 8:101903823-101903845 CTCAGCTTCTAAAAGACAGAAGG + Intronic
1046758902 8:118000194-118000216 CTGTGTGTATAAAAGACAGATGG + Intronic
1047650468 8:126914683-126914705 CTGTGCTTCTTACAAGCAAAAGG + Intergenic
1047697000 8:127413834-127413856 TTGTGCTTCTTAAAAAAAGGTGG + Intergenic
1049769928 8:144375024-144375046 CTGTGCTATTTATAGCCAGACGG - Intronic
1050055641 9:1650879-1650901 GTGTGCTTTTTAATGACACACGG - Intergenic
1050282174 9:4061927-4061949 CTGAGCTTCTTTAAGTCACATGG + Intronic
1051828976 9:21255056-21255078 CTGTACTTGTTAAAGGCAGTAGG - Intergenic
1053568634 9:39280127-39280149 CTGTGCCTCTGAGAGACAGCAGG - Intronic
1053834602 9:42121158-42121180 CTGTGCCTCTGAGAGACAGCAGG - Intronic
1054128511 9:61338880-61338902 CTGTGCCTCTGAGAGACAGCAGG + Intergenic
1054595938 9:67066373-67066395 CTGTGCCTCTGAGAGACAGCAGG + Intergenic
1054962582 9:70985271-70985293 ATTTTCTTCTTAAAGAGAGATGG + Intronic
1055114676 9:72593772-72593794 CTAGGCTTCTCAAAGACTGAAGG + Intronic
1055697941 9:78908378-78908400 GTGTGTTTTTTCAAGACAGAAGG + Intergenic
1055806587 9:80102100-80102122 TTGTGTTTCCTAATGACAGATGG + Intergenic
1057790399 9:98120655-98120677 CTGTGCTTTTTCAAGACTGGGGG + Intergenic
1059009754 9:110443934-110443956 TTGTGTTTCTTAAACACTGAGGG + Intronic
1059175940 9:112170281-112170303 CTGTGATTCCTGAAGACAGAGGG + Intronic
1059620249 9:115996930-115996952 GTGTCTTTCTTAAAGACACATGG + Intergenic
1060196577 9:121628006-121628028 ATGTGCTTCCTGCAGACAGAGGG - Intronic
1060500743 9:124152294-124152316 ATGTCCTTATTCAAGACAGAAGG + Intergenic
1062156728 9:135053283-135053305 CTGTGCTTCCTCCAGCCAGAAGG - Intergenic
1185677408 X:1859952-1859974 GTGTCCTTCTAAGAGACAGAAGG - Intergenic
1186195945 X:7110503-7110525 ATGTGCTTCTTAATGACAGTTGG - Intronic
1186511402 X:10132525-10132547 CTGGGTTTCTGAAAGACAGTCGG + Intronic
1187068743 X:15866747-15866769 CTGTATTTTTTAAATACAGATGG - Intergenic
1187070335 X:15881249-15881271 CTGTGTTTTCCAAAGACAGAAGG - Intergenic
1187878987 X:23828851-23828873 CTGTGACTCTGGAAGACAGAAGG - Intergenic
1188001135 X:24983341-24983363 CTGTGCTCCTGAAATACAGCAGG + Intronic
1188280827 X:28267067-28267089 CTGTGCTTTTAATAGTCAGAAGG + Intergenic
1188368952 X:29345312-29345334 CAGTGCTTCCAAAAGATAGAGGG - Intronic
1188375612 X:29424506-29424528 TAATGCTTCTTAAAGAAAGACGG - Intronic
1189102626 X:38207086-38207108 CTTTGCTAATGAAAGACAGAGGG - Intronic
1189278211 X:39802778-39802800 CTGTGCTTCCCAAATGCAGAGGG + Intergenic
1194526617 X:94984446-94984468 CTGTGGTTTTTAAAGACTCATGG - Intergenic
1195698898 X:107687056-107687078 CTGAACTTATTAAAGACACAGGG - Intergenic
1195785072 X:108510478-108510500 TTGTGCTTTTTAAGGCCAGAAGG + Intronic
1197415663 X:126168892-126168914 CTGTGCTTCTTAAAGATAACCGG + Intergenic