ID: 965612206

View in Genome Browser
Species Human (GRCh38)
Location 3:170556334-170556356
Sequence CCAGAGGCAATATGGCAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 214}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965612198_965612206 11 Left 965612198 3:170556300-170556322 CCTGTAACCTGGATAAAGACTGG 0: 1
1: 0
2: 1
3: 5
4: 101
Right 965612206 3:170556334-170556356 CCAGAGGCAATATGGCAAAGTGG 0: 1
1: 0
2: 1
3: 33
4: 214
965612202_965612206 4 Left 965612202 3:170556307-170556329 CCTGGATAAAGACTGGGGTCTCG 0: 1
1: 0
2: 0
3: 6
4: 68
Right 965612206 3:170556334-170556356 CCAGAGGCAATATGGCAAAGTGG 0: 1
1: 0
2: 1
3: 33
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965612206 Original CRISPR CCAGAGGCAATATGGCAAAG TGG Intronic
900183592 1:1323001-1323023 CAAGAGGCCAAATGGGAAAGGGG + Exonic
902124275 1:14195410-14195432 CCAGAGAGAATATGGTAGAGGGG + Intergenic
902172101 1:14620442-14620464 CCAGAGAAGATGTGGCAAAGTGG - Intronic
902520605 1:17013497-17013519 CAAGAGGCAGTATGGTACAGTGG + Intergenic
902844784 1:19101452-19101474 CAAGAGGCTTCATGGCAAAGTGG + Intronic
903076629 1:20773918-20773940 ACAGATGCAATATGGTATAGTGG + Intronic
903464796 1:23544687-23544709 CCAGAGGAAGGATGACAAAGTGG - Intergenic
905446510 1:38031237-38031259 CCAGAGGGAACATGAGAAAGAGG + Intergenic
907623069 1:56001657-56001679 CCAGAGGCCAGTGGGCAAAGGGG - Intergenic
909976140 1:82047886-82047908 CCTCTGGCAATCTGGCAAAGAGG + Intergenic
912352648 1:109028900-109028922 CCAGAGGCCAGAAGGGAAAGAGG - Intronic
912658103 1:111505597-111505619 CAAAAGGCAATCTGGGAAAGAGG + Intronic
916165920 1:161967355-161967377 CCAGAGACAATATGGCGAAATGG - Intergenic
916432554 1:164745132-164745154 GGAGAGGCAATGTGGCATAGCGG - Intronic
917871883 1:179249376-179249398 CCAGAGGGAGCATGGCACAGTGG + Intergenic
918531429 1:185526543-185526565 TGAGAGGCACTATAGCAAAGTGG - Intergenic
919731742 1:200917100-200917122 CCAGAGGCAATTTGGCCTGGAGG + Intergenic
920842844 1:209569207-209569229 CCAGATGGAATAGGGCCAAGGGG - Intergenic
1064763780 10:18650047-18650069 TTAGAGGCAACATGGTAAAGTGG + Intronic
1065977260 10:30853410-30853432 GTAGAGGAAATATGTCAAAGAGG - Intronic
1067169735 10:43896928-43896950 CCAGAGGCAAGCTGATAAAGTGG + Intergenic
1067696835 10:48541909-48541931 CCTGATCCAATACGGCAAAGGGG - Intronic
1067844984 10:49712456-49712478 CCAGAGGCAGCATGGCTTAGGGG + Intergenic
1068004138 10:51373117-51373139 TGAGAGGCAATATAGCATAGTGG + Intronic
1068688371 10:59891929-59891951 CCAGAGGCAACAAAGAAAAGAGG + Intronic
1069939838 10:71947765-71947787 CCAGAGGCAGAATTGCATAGTGG - Intergenic
1070491624 10:76981919-76981941 ACAGAGGCGATGTTGCAAAGGGG + Intronic
1071721297 10:88149223-88149245 TGAGGGGCAATATGGCATAGTGG - Intergenic
1072212506 10:93259616-93259638 CCAAGGGCAATATGGTACAGTGG - Intergenic
1074030206 10:109679723-109679745 CTAGAGCCCATATAGCAAAGGGG - Intergenic
1074281491 10:112055873-112055895 CTGCAGGCAACATGGCAAAGTGG - Intergenic
1079477489 11:20846558-20846580 CCAGAGGCATGATGACAAAGTGG - Intronic
1080979618 11:37385618-37385640 CTTGAGGCAATAGGGCAAAGAGG + Intergenic
1081659585 11:44879812-44879834 CTGGAGGCCAGATGGCAAAGCGG + Intronic
1081934786 11:46897231-46897253 GCAGAGGCAATATGTCCAAAGGG - Intronic
1083009235 11:59379751-59379773 CCAGTGGGGACATGGCAAAGTGG - Intergenic
1083168610 11:60907974-60907996 CAAAAGGCAATATGGCATAGTGG + Intergenic
1083306233 11:61763234-61763256 CCCAAGGCAACATGGCAAGGAGG - Intronic
1083530306 11:63415303-63415325 CCAGAGACAAGATGGGAAGGAGG + Intergenic
1085193052 11:74645872-74645894 CAAGAGGCAATATAGCACAGTGG - Intronic
1086529669 11:87770008-87770030 CCAAAGACAATCTGGCCAAGGGG + Intergenic
1088233297 11:107696216-107696238 ACAGAGGCAATAGGGCATAGTGG - Intergenic
1089707194 11:120287233-120287255 CCAAAGGCCATATAGCTAAGTGG - Intronic
1089841362 11:121420911-121420933 CCAAAGGCAATATGGAAAAATGG + Intergenic
1090573232 11:128070545-128070567 CCAGAGACAGTATTGCAAAGTGG - Intergenic
1090998629 11:131889484-131889506 TCACATGCAATATGACAAAGTGG - Intronic
1091888973 12:4037970-4037992 AAAGAGGCAAAATGGAAAAGGGG - Intergenic
1092877280 12:12859148-12859170 CCAGATCCGAAATGGCAAAGGGG - Intergenic
1095702399 12:45203653-45203675 AGAGAGGCAATATAGCAAAGTGG + Intergenic
1098217094 12:68232341-68232363 CCAGAGGCAAGATGGTACTGTGG - Intergenic
1098355297 12:69607019-69607041 CCAGAAGCAATGTAGCATAGCGG - Intergenic
1098778961 12:74659727-74659749 GCAGAGGGGATATGTCAAAGGGG - Intergenic
1098975104 12:76894529-76894551 CCAGAGGGAAAATGCCACAGAGG + Intergenic
1099692816 12:85981814-85981836 CCAGAGGCAATGTAACACAGAGG - Intronic
1100269173 12:93007319-93007341 CCAGAGACAGTATGCCAGAGTGG - Intergenic
1101365019 12:104063580-104063602 CCAGAGGCAGTATGGTATAATGG + Intronic
1101542514 12:105677630-105677652 AGAGAGGCAAAATGGCAAGGGGG + Intergenic
1101595373 12:106159967-106159989 CCAGAGGCAGTAAAGCATAGTGG - Intergenic
1106091781 13:26602206-26602228 CCAGAGGCTGCATGGTAAAGGGG - Intronic
1107277659 13:38694792-38694814 ACAGGGGCAACTTGGCAAAGAGG - Intronic
1107595897 13:41962544-41962566 CCTAAGGCAATTTTGCAAAGTGG + Intergenic
1107898644 13:44990156-44990178 CAGAAGGCAATATGGCACAGAGG - Intronic
1109897217 13:68708910-68708932 CCAGTGAAAATATGACAAAGAGG - Intergenic
1110682361 13:78330511-78330533 TCATAGGCAGTATGGCAATGAGG + Intergenic
1111832365 13:93344918-93344940 CTAGAGGCAATATGCCTCAGTGG + Intronic
1113226652 13:108167383-108167405 CTAAAGGCAATAAGTCAAAGAGG - Intergenic
1115881441 14:37923563-37923585 TAAGAGGAAATATGGCAAAGAGG - Intronic
1117834612 14:59790461-59790483 CAAAAGACAATAAGGCAAAGTGG - Intronic
1118810163 14:69267302-69267324 CCAGAGGTACTTTGGGAAAGAGG + Intronic
1120064628 14:80026716-80026738 CAAAAGGAAATATGGCAAAAAGG + Intergenic
1121834589 14:97080394-97080416 CAAGAGGCAAGTTGGAAAAGGGG + Intergenic
1123095391 14:105764811-105764833 GGAGAGGCAAGATGCCAAAGAGG - Intergenic
1125381261 15:39089738-39089760 CAACAATCAATATGGCAAAGTGG + Intergenic
1126312742 15:47335936-47335958 CTGGAGGGAATATGGCAAACTGG - Intronic
1128714176 15:69894967-69894989 ACATAGGCAAGATGGCAAAGTGG - Intergenic
1129357216 15:74999295-74999317 ACACAGGCAAAGTGGCAAAGTGG - Intronic
1130241603 15:82198505-82198527 CCAGAGGCCATTTGACATAGAGG - Intronic
1130458831 15:84142650-84142672 CCAGAGGCCATTTGACATAGAGG + Intergenic
1131918769 15:97300779-97300801 CCAGAGCCAATAGGGCACAGTGG + Intergenic
1133416128 16:5608399-5608421 GAAGGGGCAATATGGCAAAGTGG + Intergenic
1133602504 16:7353020-7353042 CCTGAAGCCATATGGAAAAGTGG - Intronic
1134469681 16:14512740-14512762 TCAGAGGCAATAAGGCAGAGTGG - Intronic
1135539376 16:23318163-23318185 CAGGAGGCAATATAGCAAAGTGG + Intronic
1136589203 16:31207231-31207253 CAGGAGGCCACATGGCAAAGGGG - Intergenic
1137961422 16:52885473-52885495 CCAGAGGCTATATGGCACCCAGG - Intergenic
1138845817 16:60564476-60564498 CCAGAGACAATGTGGCCCAGTGG - Intergenic
1139641675 16:68296249-68296271 CCAGAGGTAATCTGGTGAAGTGG + Intronic
1139894654 16:70278833-70278855 CAAGAGGCAATATGGCACAAAGG + Intronic
1142912199 17:3103723-3103745 GTAGGGGCAATATGGAAAAGGGG + Intergenic
1142975347 17:3640387-3640409 CCAGTGGCCACATGGCCAAGAGG - Intronic
1143476673 17:7207204-7207226 CAAGAGGGAACATGGGAAAGGGG + Intronic
1143860161 17:9884450-9884472 TGAGAGGCACTATGGCATAGTGG - Intronic
1144364210 17:14526367-14526389 CCAAAGGCAGTTTGGGAAAGGGG - Intergenic
1144405435 17:14948545-14948567 GCAGAAGAACTATGGCAAAGTGG + Intergenic
1146306169 17:31731314-31731336 CCAGAGGCAGCCTGGGAAAGTGG - Intergenic
1147651976 17:42067981-42068003 CCAGAGGCTATATATCACAGAGG - Intergenic
1149305116 17:55339936-55339958 CCAGTAGCAATGTGGCAGAGGGG + Intergenic
1151180861 17:72326858-72326880 TCAGAGGCAGTATAGCAAAATGG + Intergenic
1152056836 17:78035249-78035271 ATGGAGGCAGTATGGCAAAGTGG + Intronic
1152403861 17:80085509-80085531 CTGGAGGAAATATGGCTAAGGGG - Intronic
1154458669 18:14556484-14556506 CCCAAGGGTATATGGCAAAGAGG - Intergenic
1156191959 18:34730503-34730525 ACTGAGGGAACATGGCAAAGTGG + Intronic
1156543873 18:37944587-37944609 CCAAAGGCAGTATGGTACAGGGG - Intergenic
1157107232 18:44785814-44785836 CCATAGGCAAAATCGCAAAGTGG - Intronic
1157775423 18:50391845-50391867 CAAGAGGCAATGTGACATAGTGG - Intronic
1158094225 18:53752779-53752801 TCAGAGGCAACATGGCCCAGTGG - Intergenic
1158096626 18:53779646-53779668 CCAGAGGCAATGTAGGAGAGAGG - Intergenic
1159404211 18:67978065-67978087 TCAGAGCCAAGATGGCAAACTGG - Intergenic
1163052100 19:14692191-14692213 CCAAAGGCAATATGAGAACGTGG + Intronic
1164487156 19:28668301-28668323 CCAGAGGCCATATGACCAGGAGG + Intergenic
1166346216 19:42167789-42167811 CCATAGGCAATATGGGCAATGGG - Intronic
925967650 2:9080899-9080921 ATAGAGGCAATATAGCATAGTGG - Intergenic
926521183 2:13916203-13916225 CAAGAGCCAAAATGACAAAGAGG - Intergenic
928178830 2:29053357-29053379 ACAGAGGCAAGATGGGAAAGTGG - Exonic
929670978 2:43876264-43876286 CAAGAGGCAAAAGGGCAGAGGGG - Intronic
932414663 2:71566296-71566318 CCTGAGGCTACATGGCCAAGAGG - Intronic
933165917 2:79074518-79074540 CCAAAGGCAAAAAGGCAAAGAGG - Intergenic
934700363 2:96434771-96434793 CCAAAGGCAACAAGGAAAAGTGG - Intergenic
935374393 2:102380120-102380142 TCAGAGTCAAAATGGCATAGAGG - Intronic
935936966 2:108196354-108196376 AGAGAAGCAAAATGGCAAAGTGG + Intergenic
936660638 2:114539419-114539441 CTAGAGGCCTTATGGCACAGTGG - Intronic
940247458 2:151635003-151635025 CAAGAGACAATATGGTACAGTGG + Intronic
940390417 2:153126575-153126597 CTAGAGGCAGTGTGGCATAGTGG - Intergenic
940958928 2:159760556-159760578 CCAGGGGAAACATGGAAAAGTGG + Intronic
941577967 2:167258951-167258973 GCAGAGGCCTTATGGTAAAGGGG + Exonic
942985712 2:182138813-182138835 CCAGAGGCAATCTAGCCTAGTGG + Intergenic
943019577 2:182556267-182556289 CCAAAGAAAATATGGCAATGAGG + Intergenic
943388525 2:187232401-187232423 CCATAGGCTACATGGCAAAGGGG - Intergenic
943707601 2:191051747-191051769 CCAGAGGCAGCATAGCAGAGGGG + Intronic
944996730 2:205302727-205302749 CCAGAGGCACTGTGGTACAGGGG + Intronic
945934437 2:215888646-215888668 CCAGAGACAACATGCCAAGGAGG + Intergenic
946181594 2:217952390-217952412 TTAGAGGCAATATGACATAGTGG - Intronic
946225999 2:218264444-218264466 GCAGAGGCAGTAGGGCACAGAGG - Exonic
946644528 2:221818543-221818565 TGAGAAGCAATAGGGCAAAGAGG + Intergenic
946952770 2:224895260-224895282 CCACAGGAAATATAGCAAAGTGG + Intronic
1171164214 20:22956361-22956383 CCATGGGCAGAATGGCAAAGTGG + Intergenic
1173193053 20:40890932-40890954 TCACAGGCAACAAGGCAAAGAGG + Intergenic
1175993482 20:62801556-62801578 CCAGAAGCAGCAGGGCAAAGGGG + Exonic
1178222940 21:30681548-30681570 CAAGAGGCAAGATGGCTTAGGGG + Intergenic
1178699305 21:34819847-34819869 CCAGAAGCAGGATGGCAAACAGG - Intronic
1178962943 21:37084671-37084693 AGAGAGGCAATGTGACAAAGTGG - Intronic
1179442038 21:41401851-41401873 GCAGAGGCAATGTTGCAAAGTGG - Intronic
1183787708 22:40040240-40040262 CCAGAGGCAATATAGCAGCGTGG + Exonic
1184668309 22:46000051-46000073 GCAGAGGCAAAAAGGGAAAGGGG + Intergenic
950352393 3:12369146-12369168 CCAGAAGAAATATGTGAAAGAGG - Intronic
954625943 3:52021972-52021994 CCAGAGTCACAATGACAAAGAGG - Intergenic
954702429 3:52457238-52457260 CAGGAGGCAATATGGCCTAGAGG - Intronic
955659134 3:61277901-61277923 CTAGAGGCAATATGGTACAGTGG + Intergenic
956330531 3:68102100-68102122 CCAGAGTCAAAATGTCAAAAAGG - Intronic
956479455 3:69659495-69659517 ACAGAGGCAACATGGCATGGTGG - Intergenic
957508432 3:81155801-81155823 CCAGAGCCAATAGGGCACAGTGG - Intergenic
957542294 3:81587956-81587978 CAAGAGGGAATATTTCAAAGTGG - Intronic
958903331 3:99914068-99914090 AGAGAGGGAATTTGGCAAAGTGG + Intronic
965175631 3:165327568-165327590 CAAAAGGCAGTATGGAAAAGTGG - Intergenic
965612206 3:170556334-170556356 CCAGAGGCAATATGGCAAAGTGG + Intronic
965848226 3:172989458-172989480 AGAGAGACAATATGGCACAGAGG + Intronic
966001500 3:174954093-174954115 CCAGAAGGAATATTGCAAATAGG - Intronic
966498945 3:180615387-180615409 ACAGAGGAAATAGGGCCAAGAGG + Intronic
967072762 3:185976148-185976170 CCAGAGGCAGTACGGGAAGGAGG + Intergenic
971965512 4:33550465-33550487 ACAGAGGCAATATGGAATATGGG - Intergenic
972358060 4:38300496-38300518 CAAGAGACAAAATGACAAAGAGG + Intergenic
972589158 4:40467866-40467888 CAAGATTCAATATGGCACAGTGG + Intronic
972724347 4:41733116-41733138 CCAGATGCAGTAGGGCAGAGTGG + Intergenic
973084085 4:46032563-46032585 GCAGAGGCCAGATGGCAAGGGGG - Intergenic
973994696 4:56445899-56445921 GGAGAGGCAATACAGCAAAGTGG + Intronic
974250333 4:59376627-59376649 CCAGAGGCACCCTGGCAGAGAGG - Intergenic
975978473 4:80126982-80127004 TGAGAGGCAATATTGCAAAGTGG + Intergenic
976963856 4:91011710-91011732 CCAGAGCCAATAGGGCTCAGTGG + Intronic
982350460 4:154409382-154409404 CCAGAACCAATAAGGCACAGTGG - Intronic
982693647 4:158575251-158575273 ACAGAGGCAATAGGGCATTGGGG + Intronic
987188690 5:15451199-15451221 CCAGAGGCAGGATGGCATGGGGG - Intergenic
987947532 5:24631082-24631104 CCAGAGGCAGTACTGCATAGTGG - Intronic
989429960 5:41341618-41341640 CAAGAGGTAATATTGCAAACAGG - Intronic
993446470 5:88018477-88018499 CAATATGCAATATGCCAAAGTGG - Intergenic
999426553 5:151492470-151492492 ACAGAGTTCATATGGCAAAGTGG + Intergenic
1000477535 5:161729842-161729864 CCAGATGAGAAATGGCAAAGAGG + Intergenic
1001111685 5:168901841-168901863 TCACAGGGCATATGGCAAAGAGG - Intronic
1003197610 6:3928946-3928968 CCAGGGACACTATGGCTAAGGGG + Intergenic
1004192316 6:13474423-13474445 CAAAAGGCACTAAGGCAAAGGGG - Intronic
1004502405 6:16220601-16220623 CAAGAGGCAGTATGGCACAGCGG + Intergenic
1005361978 6:25039449-25039471 CCTTAGGCATTATGCCAAAGAGG + Intronic
1006752837 6:36389506-36389528 CAAGAGGCAGTATGGCATAGTGG + Intergenic
1006988898 6:38196133-38196155 CTAGGGGCAATGTGGCACAGGGG + Intronic
1006995273 6:38253852-38253874 TAAGAGGCAATATGGTATAGTGG + Intronic
1009912673 6:69951907-69951929 GATGAGGTAATATGGCAAAGGGG - Intronic
1011975084 6:93285939-93285961 CCAGAGGGAATATGTAAAAAAGG - Intronic
1012220838 6:96647208-96647230 AGAGAGGCAGTCTGGCAAAGTGG - Intergenic
1012413696 6:98989161-98989183 CCAGAGGCAATATGAATAAATGG + Intergenic
1015808253 6:137133773-137133795 CCAGAGCCAATAGGGCACAGTGG - Intergenic
1016465409 6:144320348-144320370 TCAGAGGCAATGATGCAAAGAGG - Intronic
1016571130 6:145514258-145514280 CCAGAGGCAATATGGAGTCGTGG - Intronic
1019095636 6:169577229-169577251 CCAGGGGCAACCTGGGAAAGTGG + Intronic
1019111629 6:169721934-169721956 AAAGAGGCAATATGGTATAGTGG + Intronic
1019854783 7:3593750-3593772 CAAGAGGGCATATGGCACAGTGG + Intronic
1020101158 7:5394979-5395001 CCAGAGGCCACAGGGCAAGGCGG + Intronic
1021340308 7:19456216-19456238 CAAGAGGGAAAATGGCAAACAGG - Intergenic
1021441629 7:20683901-20683923 CGAGAAGCAATATAGCAATGTGG + Intronic
1021984328 7:26084576-26084598 CCAGAGGTGATATAGCAAAATGG - Intergenic
1022183913 7:27948471-27948493 CCATAGGCATTGTGGCACAGTGG - Intronic
1023119417 7:36894359-36894381 CCAGTGCCAACAGGGCAAAGAGG + Intronic
1025871055 7:65434574-65434596 GTAGAGGCAATATGACAGAGAGG - Intergenic
1027426214 7:78063585-78063607 ACATAGGCTAAATGGCAAAGGGG - Intronic
1028130538 7:87167158-87167180 GAAGAGGCAATATGGCATTGGGG - Intronic
1031374364 7:121006120-121006142 ACAGAGGCAATATAGCAGAAAGG - Intronic
1036752441 8:11451794-11451816 GCAGAGACAATTTGGCTAAGAGG - Intronic
1037211642 8:16395693-16395715 AGAGAGGCAATATGGCATACAGG - Intronic
1037265273 8:17052056-17052078 CTAGAGGCAGTATAGCATAGTGG - Intronic
1037698675 8:21251562-21251584 CAATAGGCAAGAGGGCAAAGTGG + Intergenic
1038610186 8:29053807-29053829 CCAGACCCTATATGGCAATGTGG + Intronic
1038827256 8:31017925-31017947 CAAGAGGCAATAGGGTAAATTGG - Intronic
1038950410 8:32408294-32408316 CCTGAGGGAACAGGGCAAAGAGG - Intronic
1042195003 8:66224166-66224188 CCACAGGAAATGTGGCATAGGGG + Intergenic
1042298608 8:67250640-67250662 CATGAGACAATATGGCAAGGTGG - Intronic
1043936256 8:86146073-86146095 GCAGAGGCACTATGGCAGAGTGG - Intronic
1044603509 8:94028901-94028923 GCAGAAGGAAAATGGCAAAGAGG + Intergenic
1046698746 8:117375826-117375848 CCAGAAGAGATCTGGCAAAGAGG + Intergenic
1046798923 8:118403374-118403396 TAAGAGGCAGTATGGCAGAGTGG + Intronic
1046928566 8:119820634-119820656 CCACAGGCATTATGGCATAGTGG - Intronic
1047974616 8:130117412-130117434 TCAGAGACAATATAGCATAGTGG - Intronic
1049302254 8:141877791-141877813 GCAGAGGCAATATGACCCAGAGG - Intergenic
1050175643 9:2867110-2867132 CCCGAGGCAATAGTGAAAAGAGG - Intergenic
1050841812 9:10158886-10158908 CCAGAGACAATATGGGGAGGTGG + Intronic
1052971599 9:34380366-34380388 CCAGAGCCATTCTGGTAAAGTGG + Intronic
1053416664 9:37951167-37951189 CCAGTGGGAATGTGGCCAAGTGG + Intronic
1055902556 9:81257879-81257901 CCAGAGGCAAAAAGGCAAAGAGG + Intergenic
1058509322 9:105699537-105699559 CCAGAAGCAAAATGATAAAGGGG + Intronic
1059545449 9:115171328-115171350 CAACCGGCAATATGGCAGAGTGG + Intronic
1060139158 9:121191035-121191057 CCAGAGACAATATGTAAAACAGG + Intronic
1060385202 9:123219649-123219671 CGAGACGCAGTAAGGCAAAGTGG + Intronic
1060675519 9:125510907-125510929 CGAGAGGCAATATAGCCAGGTGG + Intronic
1187589896 X:20706013-20706035 CAAGAGGCAATATAGCAATGTGG + Intergenic
1188057382 X:25557118-25557140 CCTGTGGCAATATGGAAATGTGG + Intergenic
1188379690 X:29476228-29476250 CCAGAGACAAGATGGCCATGTGG + Intronic
1189957292 X:46288603-46288625 CCAGAGGCAAGATGGCATGGGGG + Intergenic
1190037483 X:47039218-47039240 CCAGAGGCAATATCCAAAAAAGG - Intronic
1191600539 X:63000724-63000746 TCAGAGCCAACATGGCATAGTGG + Intergenic
1193505109 X:82332957-82332979 CTAGTGGCAATATTGCACAGTGG + Intergenic
1193894685 X:87098681-87098703 GCAGTGGCAGTATGGCTAAGTGG + Intergenic
1193977269 X:88137069-88137091 CTAGAGGCAGAATGGCATAGTGG + Intergenic
1195105990 X:101601582-101601604 CAAGAGGCAATAAGGGAAAATGG - Intergenic
1195106893 X:101612185-101612207 CAAGAGGCAATAAGGGAAAATGG + Intergenic
1196199367 X:112868085-112868107 GCAGTGGCAATATGGAAAATAGG + Intergenic
1197881296 X:131169607-131169629 CAAGAGGGAATATGGCAACAGGG + Intergenic
1198138113 X:133774848-133774870 ACAGAGGCAACACAGCAAAGTGG - Intronic
1198577321 X:138024870-138024892 GCAGAGGCAAGATGGCCAAATGG + Intergenic
1199709797 X:150461030-150461052 CCAGAGGCCAGGTGGCAATGGGG + Intronic
1199942002 X:152636846-152636868 CCAGAGCCCATAGGGCAAATGGG - Intergenic
1201536524 Y:15054499-15054521 CCAGAAACAATGTGGCAATGAGG + Intergenic
1201709602 Y:16975851-16975873 CCTGTGGCATAATGGCAAAGAGG + Intergenic