ID: 965612301

View in Genome Browser
Species Human (GRCh38)
Location 3:170557259-170557281
Sequence GGGCTCCACATTCCAAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965612301_965612305 9 Left 965612301 3:170557259-170557281 CCATCCTTTGGAATGTGGAGCCC 0: 1
1: 0
2: 0
3: 12
4: 144
Right 965612305 3:170557291-170557313 TTTCAGAAACCTCACAGCAATGG 0: 1
1: 0
2: 2
3: 25
4: 256
965612301_965612306 10 Left 965612301 3:170557259-170557281 CCATCCTTTGGAATGTGGAGCCC 0: 1
1: 0
2: 0
3: 12
4: 144
Right 965612306 3:170557292-170557314 TTCAGAAACCTCACAGCAATGGG 0: 1
1: 0
2: 0
3: 13
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965612301 Original CRISPR GGGCTCCACATTCCAAAGGA TGG (reversed) Intronic
901685790 1:10942654-10942676 GGCCTCCTCATTCCAAGGGGAGG - Intergenic
904823986 1:33262775-33262797 GTGCTCCACATTGGCAAGGATGG - Intronic
904899582 1:33846438-33846460 GGGCTCCAGACTCAAAAGGCAGG + Intronic
906055407 1:42912307-42912329 GAGCTCCAATGTCCAAAGGAAGG + Intergenic
907777914 1:57536846-57536868 GGTCTCTACATTCCAAACTATGG - Intronic
910504935 1:87939641-87939663 TGGCTTCACCTTCCAAATGAGGG + Intergenic
913152729 1:116061353-116061375 GAGCCATACATTCCAAAGGAAGG + Intronic
917152556 1:171960433-171960455 GGGCTCCACTTTTTATAGGATGG + Intronic
920075654 1:203334635-203334657 GGCCTCCAGATTCCATAGGCAGG + Intergenic
920512328 1:206560382-206560404 GGTCTCCCCATTTCATAGGAAGG + Intronic
921294351 1:213688157-213688179 GGTCTCCGCATTCCACAGGGTGG - Intergenic
922452882 1:225750915-225750937 AGGCTCCACATGCCCATGGAGGG + Intergenic
923281515 1:232447454-232447476 GTGCTGCACAGTGCAAAGGATGG + Intronic
1066455402 10:35567839-35567861 GGGCTTTCCATTCCAAAGGCTGG - Intronic
1068236769 10:54245113-54245135 GGCCTCCACACTCAATAGGAAGG + Intronic
1068967589 10:62928905-62928927 GTGCTCCACATCCCAGACGATGG + Intergenic
1070561634 10:77571843-77571865 GGGCTCCAAAGACCAAAGAAAGG - Intronic
1074535445 10:114325516-114325538 GGGTGCCACATGCCAGAGGAGGG - Intronic
1075520634 10:123141640-123141662 GGGCTCCACAGTCTGAAGGAGGG - Intergenic
1079082712 11:17425072-17425094 GGGCTCCTCCCTCCAAAGGCTGG + Intronic
1079804436 11:24911403-24911425 AATCTCCACATTTCAAAGGAGGG + Intronic
1081527669 11:43937638-43937660 GAGGCCCACATTCCAGAGGAGGG - Intronic
1082111201 11:48276698-48276720 GGCCTCCATATTGGAAAGGAAGG - Intergenic
1084776702 11:71381617-71381639 GGGCTGCACAGACCCAAGGAAGG - Intergenic
1085535174 11:77213245-77213267 GGAGTTCACATTCCATAGGAAGG - Intronic
1087229848 11:95648268-95648290 AGACTTCACATTCCAAGGGAAGG - Intergenic
1090237010 11:125156418-125156440 GGGCTCCCCAACCCAAAGGGTGG - Intergenic
1090666610 11:128918762-128918784 GGGCTCCCCACTCCCAGGGAGGG + Exonic
1093520444 12:20044088-20044110 GTGCTCCACATTTCAGAAGAGGG - Intergenic
1094111341 12:26866032-26866054 GGGCCCCAGATTCCAGAGAAGGG + Intergenic
1098357669 12:69626756-69626778 GGTCTGCACATTCCAGATGAAGG + Intergenic
1099262629 12:80401620-80401642 GGGCTCCACGTTCCTATGAAAGG + Intergenic
1100573957 12:95871758-95871780 GGGCTCCAAATTCCTAATGAAGG - Intronic
1100859020 12:98784909-98784931 GGGCTCCAGATTGGAAAGCATGG - Intronic
1101203042 12:102456805-102456827 AGTCCCCACGTTCCAAAGGAAGG + Intronic
1104146023 12:126034655-126034677 TCCCTCCACATTCAAAAGGATGG - Intergenic
1105221068 13:18327963-18327985 GGTCACCCCATTCCAAAGCATGG - Intergenic
1105290013 13:19047658-19047680 GGGCCCCACATTCCCAATGGAGG + Intergenic
1107112502 13:36712920-36712942 GGGCTGCACAGTCCACAGTAAGG - Intergenic
1107692229 13:42965436-42965458 GCGCTTCAAATTCCAAAGGGAGG + Intronic
1111009392 13:82292276-82292298 GGTCTCCACAATCCAGAGCATGG - Intergenic
1112991127 13:105514981-105515003 CCACTCCACATTCCAAAAGAAGG - Intergenic
1114647779 14:24265128-24265150 GGGCTCCACGTTCCCAGGAATGG - Intergenic
1119609880 14:76052665-76052687 GGGCTCCAAATGCCAAAGAAAGG + Intronic
1120097667 14:80406993-80407015 GGCATCCACATTGAAAAGGAAGG + Intergenic
1122932702 14:104942018-104942040 GGGGACAACATCCCAAAGGATGG + Exonic
1127301935 15:57663367-57663389 GGACTCCACATTTCAAGGGCTGG - Intronic
1127356515 15:58206074-58206096 TGCCTTCACATACCAAAGGAAGG + Intronic
1127364156 15:58271834-58271856 CAGCTCTACATCCCAAAGGAGGG - Intronic
1129250622 15:74306943-74306965 AGGCTCCTCACTCCACAGGAGGG - Intronic
1129654002 15:77510710-77510732 AGCCTCCACACTCCCAAGGACGG - Intergenic
1133957956 16:10463331-10463353 AGGCTTCACATTTTAAAGGAGGG - Intronic
1134305042 16:13024352-13024374 GGGCTCCAGCTGCCAAAGGCAGG - Intronic
1135051997 16:19200957-19200979 AGGCTGCACATTCCAGAGGGGGG + Intronic
1135826326 16:25731716-25731738 ACCCTCCACATTCCAAAGAAAGG - Intronic
1137500140 16:49004774-49004796 GGGACCCTCATTCCAGAGGAAGG + Intergenic
1138625075 16:58245001-58245023 GGGTTTCACATACCAAATGAGGG - Intronic
1140901225 16:79369907-79369929 GGCCTCCAAATTCTCAAGGATGG + Intergenic
1143874354 17:9980612-9980634 GTGCTCCACACACCATAGGATGG + Intronic
1145442628 17:23128334-23128356 GGGCTGCACATTCCTTTGGATGG + Intergenic
1145680924 17:26590984-26591006 GGGCTCAACATTCCTTTGGATGG + Intergenic
1145707349 17:26884682-26884704 GGGCTCAACATTCCTTTGGATGG - Intergenic
1146661531 17:34668086-34668108 GGGCTCCACATAGCAAAGAGGGG + Intergenic
1147586684 17:41657117-41657139 AACCTCCACATTCCAAATGATGG - Intergenic
1148344545 17:46894690-46894712 GAGCTCGTCATTCCACAGGAGGG - Intergenic
1153931755 18:9885448-9885470 TGGCTTCCCATTCCACAGGATGG + Intergenic
1154065100 18:11100473-11100495 GGGCACCACATTTTAAAAGACGG + Intronic
1158684228 18:59598522-59598544 TGCCTCCACATTTCAGAGGATGG - Intronic
1162423243 19:10578227-10578249 GGCCTCCACAATCCTAAGGTGGG - Intronic
1163389536 19:17021975-17021997 TGGCTCCACTTTGCAAAAGAAGG + Intronic
1163524457 19:17812148-17812170 GGGCTCCTGTTTCCATAGGAAGG + Exonic
1165340609 19:35209146-35209168 GGTATCCATATTCCACAGGAGGG + Intergenic
1167645161 19:50701849-50701871 TGGCTCCACTTTCCAGATGAAGG + Intronic
1168325960 19:55538285-55538307 GGGCTCCTGATTCCAAAGAGAGG + Intergenic
925661798 2:6210445-6210467 GGATTCCAAATTCCAAGGGACGG + Intergenic
929651981 2:43689160-43689182 ATCCTCCACATTCCAAAGAAAGG - Intronic
929774852 2:44923129-44923151 TGGCTGCACATACAAAAGGAAGG - Intergenic
933919200 2:87027607-87027629 GGGCTCCTCAATCCAAAGTTGGG + Intergenic
934003794 2:87742300-87742322 GGGCTCCTCAATCCAAAGTTGGG - Intergenic
934182989 2:89644505-89644527 GGTCACCCCATTCCAAAGCATGG + Intergenic
934293275 2:91718692-91718714 GGTCACCCCATTCCAAAGCATGG + Intergenic
934615508 2:95768272-95768294 AGACTCCAGATTCCACAGGAAGG + Intergenic
934645391 2:96056286-96056308 AGGCTCCAGATTCCACAGGAAGG - Intergenic
934838795 2:97612375-97612397 AGGCTCCAGATTCCACAGGAAGG - Intergenic
936072805 2:109382605-109382627 GGGCTCGGTGTTCCAAAGGAAGG - Intronic
938804306 2:134791917-134791939 GTGCTCCTCTTTCCAAATGAGGG + Intergenic
943596690 2:189866420-189866442 GGATGCCACATTCCAAAAGAAGG - Intronic
946576939 2:221085984-221086006 GGGCTTCACATTTCATAGTAGGG + Intergenic
946783540 2:223218672-223218694 GGGCTCCAGACTCCAAAAGGTGG + Intergenic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
948696818 2:239736934-239736956 GGGCGCCACATTCCGGAGGCCGG - Intergenic
1169317066 20:4601666-4601688 AGGCTCCACATTCCAATGGGTGG + Intergenic
1173743511 20:45419222-45419244 GGGATCCACATTCCAGAGATGGG - Intronic
1179249162 21:39658327-39658349 GGGCTCTAAATTCCCAGGGATGG - Intronic
1179501487 21:41812115-41812137 AGACTCCACCTTCCAAGGGAGGG + Intronic
1179511978 21:41879269-41879291 GCTCTGCACATTCCAAAGGCAGG - Exonic
1181009763 22:20033304-20033326 GGGCTCCATGGTCCAAGGGAAGG - Intronic
1181903125 22:26171102-26171124 GGGCTCTACATTTAAAAAGACGG - Intronic
1182289314 22:29266259-29266281 TGGCTCCCCTTTCCACAGGAAGG + Intronic
1183597076 22:38819117-38819139 GGGCACCACATGCCACAAGATGG + Exonic
1184042288 22:41951311-41951333 GGGGTCCACCTTCCCAAGCATGG - Intergenic
954642159 3:52107197-52107219 GGGCTCCAGCTTCTAAAGGCTGG - Intronic
955004209 3:54954216-54954238 GGCCTCCTCATTCCAAGGGAAGG + Intronic
955238527 3:57160728-57160750 GGGTCCCACAATCCAAAGAAGGG - Intronic
958668124 3:97166658-97166680 AGGCCCCACATTCCTCAGGATGG + Intronic
963515395 3:146301799-146301821 GGGCTCCACAATCCACAGGTGGG - Intergenic
963539799 3:146571045-146571067 TGGCTTCCCATGCCAAAGGATGG - Intergenic
964739297 3:159948856-159948878 GGGCTTCACATTTAAAGGGATGG - Intergenic
964824525 3:160810412-160810434 AGACTCCAGATTCCAAAGGATGG - Intronic
965612301 3:170557259-170557281 GGGCTCCACATTCCAAAGGATGG - Intronic
968318267 3:197742689-197742711 GGGCTCCTCATCCCAGAGCAGGG + Intronic
968345178 3:197998086-197998108 GGGCTCCACATAGCAGTGGAAGG + Intronic
968598114 4:1495753-1495775 GGTCTCCACACTCCAAGGCAGGG - Intergenic
969476397 4:7424798-7424820 GGCCCCCACATGCCCAAGGAAGG + Intronic
969493882 4:7514981-7515003 GCCCTTCACATTCCAAAGGCTGG - Intronic
970447869 4:16139384-16139406 GGGCTCCTCATCCTAAATGAGGG + Intergenic
977763635 4:100771341-100771363 GGCATCCACATCCAAAAGGAGGG + Intronic
978697143 4:111596037-111596059 GGTCTGCACATGCTAAAGGAAGG - Intergenic
980064959 4:128176886-128176908 GTGCTTCACATTCCCAAGAAAGG + Exonic
985129889 4:186728338-186728360 GGGTGCCAGATTCCTAAGGAGGG + Intergenic
985871929 5:2564070-2564092 GGGATCCACACTGCTAAGGAAGG - Intergenic
990382759 5:55232777-55232799 GGGCTCAGCAATTCAAAGGAAGG + Intronic
990670250 5:58120915-58120937 AGGCTCCACATTTTGAAGGAAGG + Intergenic
991294635 5:65067378-65067400 GGGCTGCCCATTCCACTGGATGG - Intergenic
997605168 5:135170105-135170127 GGGCTCCAAATCCCAGAGCAGGG + Intronic
998106663 5:139473249-139473271 TGGATTCACATTACAAAGGAAGG - Intergenic
1002790831 6:436236-436258 TGGCTCCACTTCTCAAAGGAAGG + Intergenic
1003393716 6:5735339-5735361 GAGCTACACACACCAAAGGAAGG - Intronic
1005510308 6:26506604-26506626 TTTCTCCACATTCCAAAGGAGGG - Intronic
1006337006 6:33426061-33426083 CCGCTCCACCTTCCAGAGGAGGG - Intronic
1007957513 6:45930654-45930676 GGGCTGCCCAGTCCAAAGGGTGG + Intronic
1013145521 6:107387118-107387140 GGTCCACACATTCCCAAGGAGGG + Intronic
1014206091 6:118656899-118656921 GGGCTCTGCATTGCAAAGAATGG - Intronic
1014484089 6:121977804-121977826 AGGTTCCAGAGTCCAAAGGATGG + Intergenic
1015032975 6:128618175-128618197 GGCTTGCACCTTCCAAAGGAAGG - Intergenic
1018127577 6:160696464-160696486 GGGCTCCTCAATCCAAAGTTGGG - Intergenic
1019209776 6:170395503-170395525 GGGCTCCAGCTACCACAGGACGG + Exonic
1019366304 7:635210-635232 GGGACCCACATTCCACAGGCTGG + Intronic
1021813810 7:24428380-24428402 GGGGGCCACATTCCCAGGGAGGG + Intergenic
1023625103 7:42107670-42107692 TTCCTCCACATTCCAGAGGAGGG + Intronic
1026400894 7:70011816-70011838 GAGCTCCACCTTCCACAGCAAGG - Intronic
1029490227 7:100866702-100866724 GGGCTCCACGTCCCAAGGGCAGG - Exonic
1035710843 8:1712661-1712683 GGGATGAAGATTCCAAAGGAAGG + Intergenic
1039721184 8:40166114-40166136 GGGCTCCACATTCATTAAGATGG + Intergenic
1040548100 8:48417510-48417532 GGGCTCCACTCTCCAGAGGGAGG + Intergenic
1045489546 8:102657650-102657672 AGGCCCCACATTCCTGAGGAAGG - Intergenic
1053152438 9:35751546-35751568 GGGCACCACAGGCCAAAAGATGG - Intronic
1057408118 9:94792055-94792077 GGGCTCCCCATTCCAGTTGAGGG - Intronic
1057922999 9:99114413-99114435 GGGCTCCACTTTATTAAGGAAGG - Intronic
1059291302 9:113226545-113226567 GGGCTTTGCATTCCTAAGGATGG - Intronic
1061837089 9:133336501-133336523 AGGCCCCCCACTCCAAAGGACGG - Intergenic
1062111993 9:134786959-134786981 GGGCTTCGCATTCCACAGGAAGG - Intronic
1189290991 X:39886081-39886103 CTGCTCCACCTTTCAAAGGATGG - Intergenic
1193692835 X:84668319-84668341 GGGTCCCCAATTCCAAAGGAGGG + Intergenic
1194545241 X:95225751-95225773 GGGATGAAAATTCCAAAGGAAGG + Intergenic
1195968973 X:110454032-110454054 GGGGTCAACATTCCGAAGGATGG - Exonic
1197688680 X:129473612-129473634 GTGTTCCACAATCAAAAGGAAGG + Intronic