ID: 965614947

View in Genome Browser
Species Human (GRCh38)
Location 3:170584814-170584836
Sequence CTGCGGCCCTTGGGCAATTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 112}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965614927_965614947 27 Left 965614927 3:170584764-170584786 CCCCCAGCGCTCTCCTAGACCCT 0: 1
1: 0
2: 0
3: 7
4: 165
Right 965614947 3:170584814-170584836 CTGCGGCCCTTGGGCAATTCGGG 0: 1
1: 0
2: 1
3: 6
4: 112
965614930_965614947 24 Left 965614930 3:170584767-170584789 CCAGCGCTCTCCTAGACCCTATA 0: 1
1: 0
2: 0
3: 2
4: 47
Right 965614947 3:170584814-170584836 CTGCGGCCCTTGGGCAATTCGGG 0: 1
1: 0
2: 1
3: 6
4: 112
965614935_965614947 14 Left 965614935 3:170584777-170584799 CCTAGACCCTATACCTAGGGGGA 0: 1
1: 0
2: 0
3: 4
4: 59
Right 965614947 3:170584814-170584836 CTGCGGCCCTTGGGCAATTCGGG 0: 1
1: 0
2: 1
3: 6
4: 112
965614929_965614947 25 Left 965614929 3:170584766-170584788 CCCAGCGCTCTCCTAGACCCTAT 0: 1
1: 0
2: 0
3: 4
4: 54
Right 965614947 3:170584814-170584836 CTGCGGCCCTTGGGCAATTCGGG 0: 1
1: 0
2: 1
3: 6
4: 112
965614937_965614947 8 Left 965614937 3:170584783-170584805 CCCTATACCTAGGGGGAGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 105
Right 965614947 3:170584814-170584836 CTGCGGCCCTTGGGCAATTCGGG 0: 1
1: 0
2: 1
3: 6
4: 112
965614939_965614947 7 Left 965614939 3:170584784-170584806 CCTATACCTAGGGGGAGGCAGGG 0: 1
1: 0
2: 0
3: 18
4: 192
Right 965614947 3:170584814-170584836 CTGCGGCCCTTGGGCAATTCGGG 0: 1
1: 0
2: 1
3: 6
4: 112
965614941_965614947 1 Left 965614941 3:170584790-170584812 CCTAGGGGGAGGCAGGGTGACAT 0: 1
1: 1
2: 5
3: 17
4: 235
Right 965614947 3:170584814-170584836 CTGCGGCCCTTGGGCAATTCGGG 0: 1
1: 0
2: 1
3: 6
4: 112
965614928_965614947 26 Left 965614928 3:170584765-170584787 CCCCAGCGCTCTCCTAGACCCTA 0: 1
1: 0
2: 0
3: 12
4: 95
Right 965614947 3:170584814-170584836 CTGCGGCCCTTGGGCAATTCGGG 0: 1
1: 0
2: 1
3: 6
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965614947 Original CRISPR CTGCGGCCCTTGGGCAATTC GGG Intronic
900195868 1:1375182-1375204 CGGCCGCCCTCGGGCACTTCCGG + Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900805559 1:4765363-4765385 CTGCTGCCCCTGAGCAATCCTGG - Intronic
901448804 1:9323908-9323930 CTGTGGCCCATGGGAAATTCAGG + Intronic
901824400 1:11851266-11851288 CTGGGGCCCCTGGGCAATGAAGG + Intergenic
903286832 1:22282565-22282587 CTGCAGAACTTGGGCAATTTGGG + Intergenic
904688141 1:32275154-32275176 CTGCGGCCCTTGACCAGCTCGGG + Intronic
905466789 1:38160647-38160669 CTGCAGGCCATGGGGAATTCAGG - Intergenic
908513472 1:64869311-64869333 CTGATGTCCTTGGGCAGTTCTGG + Exonic
912363406 1:109113475-109113497 GTGCGGCGCTTGGGAAATTGCGG + Intronic
912952999 1:114133574-114133596 CAGGGGCCCTTGGGCAAGCCAGG + Intronic
916830071 1:168481759-168481781 CTGCGGCTCATGGGCCAATCTGG + Intergenic
1063394587 10:5675153-5675175 CTGTGCCCCTTGGTCAAATCTGG - Intergenic
1067076797 10:43192198-43192220 CTGCGCCACTTGTGCATTTCTGG - Intergenic
1070279291 10:75037183-75037205 CTGCGTCCCTTGGGAAAGTGGGG + Intergenic
1070746829 10:78938818-78938840 CTGCAGCCCTTGGCCAACACTGG + Intergenic
1075810130 10:125219033-125219055 CTGTGGCCCTTGGGGGCTTCTGG + Intergenic
1076500071 10:130930127-130930149 CTGTGTCCCTTGGGCAAGGCTGG - Intergenic
1082739814 11:56898357-56898379 CTGAGTCCCTTGGGAAATGCTGG - Intergenic
1085776089 11:79368058-79368080 CTGCGGCCCTTGGGGATTCGGGG + Intronic
1088625851 11:111729949-111729971 ATGCGGCCCCTTGGCAATTGAGG - Exonic
1089388072 11:118080766-118080788 CTGCTGCCCTGGGGCGTTTCTGG - Intronic
1090495406 11:127206513-127206535 CTGCACCCCTTGGCAAATTCAGG - Intergenic
1092471765 12:8787374-8787396 CTGCGGGCCCTGGGCAATGAGGG + Intergenic
1101568712 12:105933921-105933943 CTGCGGCCCTAGGTGAATTGTGG - Intergenic
1102175648 12:110872307-110872329 CTCCAGCCCTTGGTCAAATCTGG - Intronic
1102256502 12:111418482-111418504 CTGCGGGCCTTGGGCAGGCCAGG - Exonic
1103942944 12:124510759-124510781 CGGCGGCCCATGGGCACCTCTGG - Intronic
1108941821 13:55964399-55964421 CTGCACCCCTTGGCAAATTCAGG - Intergenic
1110416029 13:75253660-75253682 CTGGGGTTCTTGAGCAATTCAGG + Intergenic
1110514072 13:76387771-76387793 GTGCAGACATTGGGCAATTCTGG - Intergenic
1112771778 13:102800398-102800420 CGGCGGCCCTTGGGCTCTGCGGG + Intronic
1116578900 14:46612679-46612701 CTGGGGCCTTTGGGACATTCAGG - Intergenic
1116653824 14:47626861-47626883 CCGCAGCCCTTGGGCGGTTCTGG - Intronic
1119525345 14:75318270-75318292 CTGAGACCTTTGGGCAACTCTGG + Intergenic
1122643704 14:103177545-103177567 CTGCAGCCCTGGGTCGATTCTGG - Intergenic
1123920834 15:25068613-25068635 CTGTGGCCCTGGGTCACTTCCGG + Intergenic
1125878297 15:43168778-43168800 CTGCAGTCCTTGGGCAAATCTGG - Intronic
1126245167 15:46496610-46496632 CTGCTGCCCTCTGTCAATTCTGG - Intergenic
1129717500 15:77860689-77860711 CTGCTGCCCCTGGGCCACTCTGG + Intergenic
1130461252 15:84159508-84159530 CTGCTGCCCCTGGGCCACTCTGG - Intergenic
1133298432 16:4767025-4767047 CTGCCGGCCGTGGGCAGTTCGGG + Exonic
1141667957 16:85475597-85475619 CTGCAGTGCCTGGGCAATTCTGG + Intergenic
1143203757 17:5129458-5129480 CTTCTGCCCTTGGGCAGTTGTGG + Intronic
1144874939 17:18392569-18392591 CTTCTGCCCTTGGGCAGTTGTGG + Intergenic
1145157285 17:20551852-20551874 CTTCTGCCCTTGGGCAGTTGTGG - Intergenic
1145986892 17:29053071-29053093 GTGGGGCTCTTGGACAATTCCGG + Exonic
1146844828 17:36175932-36175954 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1146857133 17:36263867-36263889 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1146863482 17:36324508-36324530 CTGCTGCCCTTGGGCAGCTGTGG + Intronic
1146873045 17:36387777-36387799 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1146880403 17:36438863-36438885 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1147066342 17:37925096-37925118 CTGCTGCCCTTGGGCAGCTGTGG + Intronic
1147075928 17:37988402-37988424 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1147077875 17:38004657-38004679 CTGCTGCCCTTGGGCAGCTGTGG + Intronic
1147087453 17:38067948-38067970 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1147093811 17:38128592-38128614 CTGCTGCCCTTGGGCAGCTGTGG + Intergenic
1147103397 17:38191911-38191933 CTGCTGCCCTTGGGCAGCTGTGG - Intergenic
1148047054 17:44750699-44750721 CTGGAGCCCTTGGGCAAGGCCGG - Exonic
1148850243 17:50551091-50551113 GTGCGGACCTTGCTCAATTCAGG + Exonic
1149847971 17:60018380-60018402 CTGCTGCCCTTGGGCAGCTGTGG - Intergenic
1151745858 17:76011434-76011456 CTGCAGCCCCTGGGCAGCTCTGG - Intronic
1152108153 17:78342467-78342489 CTGCGGCCCGTGGGCTGTGCAGG - Intergenic
1152241813 17:79164896-79164918 CTGGGTCCCTTGGGTGATTCTGG - Intronic
1153594935 18:6715756-6715778 CTGGGGGCCCTGGGAAATTCTGG + Intergenic
1159665290 18:71151483-71151505 CAGGTGCCCTAGGGCAATTCAGG + Intergenic
1160143441 18:76346629-76346651 CTGGGGACCTTGGGCAGTGCAGG - Intergenic
1160154015 18:76419152-76419174 CTGAGACCCTGGGGGAATTCAGG + Intronic
1161963222 19:7534227-7534249 CTGCGGCCCCTGGGTGAGTCTGG + Exonic
1163421909 19:17218400-17218422 CTGCGGCCCTGGGGCAGTAGTGG + Intronic
1163777015 19:19224745-19224767 CTCAGGCCCATGGGCAAGTCGGG - Intronic
1167292201 19:48630494-48630516 CTGCAGCCCGTGGGCAGCTCCGG - Exonic
927565120 2:24105012-24105034 CTGCGTCCCTTGACAAATTCAGG - Intronic
930323095 2:49880187-49880209 AAGCTGCCCTTGGGCACTTCTGG + Intergenic
931416213 2:62083443-62083465 CTTCAGCCCATGGGCAAGTCTGG - Intronic
934712414 2:96524799-96524821 CTGCTGCCCTCGGGCAGTTAGGG - Intergenic
937263551 2:120601681-120601703 CTCCGGCCCCTGGGAATTTCAGG - Intergenic
945909734 2:215635199-215635221 CTGCACCCCTTGGCAAATTCAGG + Intergenic
946295105 2:218777789-218777811 CTGCTGCCCTTGGGCAACATGGG + Intergenic
948654252 2:239466806-239466828 CTGCGGCCCCTGGCCTACTCTGG + Intergenic
948797640 2:240412938-240412960 CTGCGGCCCTTGGGAACTAGGGG - Intergenic
1173255484 20:41391900-41391922 CTGCAGCCCTTGGGCAGATGTGG + Intergenic
1173689440 20:44948692-44948714 CTGCTGGCCTGGGGCATTTCAGG - Intronic
1176373461 21:6076051-6076073 CTGCGGCCAATGGGCAGTGCTGG + Intergenic
1177240039 21:18444147-18444169 CTGCAACCCTTGGCAAATTCAGG - Intronic
1179750016 21:43462192-43462214 CTGCGGCCAATGGGCAGTGCTGG - Intergenic
1184779168 22:46637748-46637770 CTGGGGCCCCTGGGCACCTCTGG + Intronic
953080005 3:39608215-39608237 CTGTGCCCCTTGGTAAATTCAGG + Intergenic
955146658 3:56326645-56326667 CTGCTGCCTTTGGCCATTTCTGG + Intronic
957002624 3:74903850-74903872 CTATGGCCCTTGGCCAAATCTGG + Intergenic
960980545 3:123220972-123220994 CTCCTTCCCTTGGGCAATTCAGG - Intronic
961779880 3:129315265-129315287 TTGCGGCCCTTGGGCACTTTGGG + Exonic
965614947 3:170584814-170584836 CTGCGGCCCTTGGGCAATTCGGG + Intronic
968356702 3:198113751-198113773 CTGCGGCCCTTGGGTGTTTCGGG - Intergenic
976161223 4:82201496-82201518 CTGCAGTCCATGGGCAAGTCTGG + Intergenic
978347036 4:107782040-107782062 ATGCGTCCTTTGGGAAATTCTGG + Intergenic
996599453 5:125245203-125245225 CTGCACCCCTTGGCAAATTCAGG + Intergenic
999265462 5:150264379-150264401 CTTCAGCCCTTGTGCAATTGGGG - Intronic
999476803 5:151907763-151907785 TTGCAGCCCCTGGGCAATTAGGG + Intronic
1002443647 5:179276856-179276878 CTGAGGCCCTGGGGTTATTCTGG + Intronic
1006672183 6:35736422-35736444 CTGGGGCCTTAGGGCATTTCTGG - Intergenic
1009497858 6:64373620-64373642 CTGTGCCCCTTGGCAAATTCAGG + Intronic
1013408695 6:109865342-109865364 CTGAGGCCCTTGAGCCTTTCCGG + Intergenic
1014132168 6:117846771-117846793 CTGTGCCCCTTGGCAAATTCAGG - Intergenic
1019444891 7:1066208-1066230 CTGTGGGCCTGGGGAAATTCTGG - Intronic
1026833433 7:73623566-73623588 CTGCGCCTCTTGGACATTTCTGG + Intronic
1032785270 7:135195400-135195422 TTGGGGCCCTTGGGCTGTTCTGG - Intronic
1034048521 7:147956608-147956630 CTGCGGTCCATGGTCATTTCAGG - Intronic
1034159547 7:148982960-148982982 CTGGGGACCTTGAGCTATTCTGG - Intergenic
1044609008 8:94073590-94073612 CTATGGCCCATGGGCAAATCTGG + Intergenic
1051469679 9:17423610-17423632 CTGCGGTCCTTGGGCAAGTCTGG - Intronic
1053376824 9:37614438-37614460 CTGACGCCCTTGTGCAATGCAGG - Intronic
1053462859 9:38284245-38284267 CTGCTTCCCTTGGGTAATTCAGG - Intergenic
1059041434 9:110819402-110819424 CTGGGGTCCTTGGACAATTGAGG + Intergenic
1189122007 X:38404970-38404992 CTGCTGCCCTTGACCAATGCTGG - Intronic
1191763025 X:64664503-64664525 CTGTGCCCCTTGGCAAATTCAGG - Intergenic
1198757433 X:139996102-139996124 CTGAGGCCCTTAGCCAATTATGG - Intergenic
1202054484 Y:20815197-20815219 CTGTGTCCCTTGGCAAATTCAGG - Intergenic
1202378004 Y:24255636-24255658 CTGCTGCCCCTGGGCCACTCTGG + Intergenic
1202492778 Y:25414485-25414507 CTGCTGCCCCTGGGCCACTCTGG - Intergenic