ID: 965616103

View in Genome Browser
Species Human (GRCh38)
Location 3:170594011-170594033
Sequence GCCTCCTCTACAATAACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965616103_965616105 19 Left 965616103 3:170594011-170594033 CCCTGTGTTATTGTAGAGGAGGC 0: 1
1: 0
2: 0
3: 7
4: 131
Right 965616105 3:170594053-170594075 TTCAATCTGTGTTTATATATTGG 0: 1
1: 0
2: 2
3: 34
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965616103 Original CRISPR GCCTCCTCTACAATAACACA GGG (reversed) Intronic
901566708 1:10122176-10122198 GCCTTCTCTCTAATAACACATGG - Intronic
910028525 1:82688006-82688028 GCCTACTCAACATGAACACAAGG + Intergenic
910098225 1:83548460-83548482 CCCTCCACCACAATAAGACATGG - Intergenic
910416641 1:87007439-87007461 GCATCCTCTATAATAACTTAGGG - Intronic
911788540 1:101981611-101981633 GCCTACTCTACAATTCCACTTGG + Intronic
914939369 1:152009012-152009034 GACTCCTAGACAATAACATAGGG - Intergenic
915924756 1:160008026-160008048 GCCTCATCTTCAATCAAACAGGG + Intergenic
919018493 1:192072465-192072487 CCCTCCTCTACCATCACCCATGG - Intergenic
919068067 1:192718076-192718098 GCCTCCAATACAATAACAGCTGG + Intergenic
924952709 1:248899134-248899156 GACTCCCCTACAATAACAGTGGG + Intergenic
1064539060 10:16387759-16387781 GCCTTCTCTACATTTACCCAGGG - Intergenic
1068737489 10:60430891-60430913 GCCTCTTCATCTATAACACAGGG + Intronic
1068958557 10:62844014-62844036 GCCTCCACTAAAATGCCACAGGG - Intronic
1071761157 10:88608932-88608954 TCATCCTCTCCAATTACACAGGG + Intergenic
1076007605 10:126960302-126960324 GCCCCCACTACAATACCACATGG - Intronic
1076467334 10:130692569-130692591 GTCTCATCTACAGCAACACAGGG + Intergenic
1078689599 11:13565781-13565803 GCATCCTCTAGATTAACAGAAGG - Intergenic
1079388743 11:20002826-20002848 GGCTTCTCTCCAAGAACACAAGG - Intronic
1080976582 11:37349792-37349814 CCTTCCTCTACATTAACCCAAGG - Intergenic
1080976589 11:37349821-37349843 CCTTCCTCTACATTAACCCAAGG - Intergenic
1081594562 11:44450343-44450365 GTCTGCTCTACAAGCACACATGG - Intergenic
1081752235 11:45519319-45519341 GCTTCCTCTTCTGTAACACAGGG + Intergenic
1084350552 11:68595883-68595905 GCCTCCACCACAGGAACACATGG - Intronic
1086058336 11:82674575-82674597 GCCTACTCAACACTCACACACGG - Intergenic
1086641661 11:89165731-89165753 GCTTCTTCTACACTGACACAAGG + Intergenic
1088511013 11:110574850-110574872 GCCTCCTCTGCCAGATCACAGGG - Intergenic
1092922813 12:13247454-13247476 CCTTCCTCTACAATAAACCAAGG + Intergenic
1095603811 12:44044022-44044044 CCTTCCTCTACATTAAAACAAGG - Intronic
1098749574 12:74277429-74277451 CCTTCCTCTACATTAACCCAAGG - Intergenic
1102368671 12:112362450-112362472 GCCTCCTCTATGGGAACACAAGG + Intronic
1103515808 12:121507547-121507569 GCCTCCTCTACATCATCAAAGGG + Intronic
1112151615 13:96770942-96770964 GCCTCTTTTAAAAGAACACAGGG + Intronic
1113076510 13:106472740-106472762 GCCACCTTTACCATCACACATGG - Intergenic
1113572836 13:111370858-111370880 GCCTCCTCCCCAAAAAAACAAGG - Intergenic
1115181439 14:30631056-30631078 GCCTCCTTTATAATAAAACCGGG + Intronic
1118652719 14:67914917-67914939 GCCACCTCTTCCAAAACACATGG + Intronic
1118889418 14:69895544-69895566 CCCTCCTCAACAAAAACAAAGGG - Intronic
1118979225 14:70702490-70702512 GTTTCCTCAACATTAACACAGGG + Intergenic
1120616937 14:86718386-86718408 TCATCCTGTACAATAAAACATGG + Intergenic
1121488153 14:94336323-94336345 GCCTACTCAACATGAACACAAGG - Intergenic
1123986118 15:25647751-25647773 GCCTCCACAAACATAACACACGG + Intergenic
1125793107 15:42384787-42384809 GCCTCCTCTCCAGTATCTCAAGG + Intronic
1127807885 15:62537844-62537866 GCCTCCTCAACACTATCAAAAGG - Intronic
1130081001 15:80733358-80733380 GCCTCCTTGAGAATTACACAAGG - Intronic
1130927756 15:88398012-88398034 CCTTCCTCCACAATGACACAGGG - Intergenic
1135126428 16:19813829-19813851 GCCTCCTCCCAAACAACACAAGG - Intronic
1135563209 16:23492642-23492664 GTATCCTTTACAATAAAACAGGG + Intronic
1138796113 16:59971311-59971333 GCCTCCTCTAGGAAAAGACAAGG - Intergenic
1142482494 17:227545-227567 GGCTTCACTACAAAAACACAGGG + Intronic
1142604467 17:1073908-1073930 GCCTCCTCTCCCATCAGACATGG + Intronic
1144398509 17:14870450-14870472 GCCTACTCTACATGAAGACAAGG - Intergenic
1144614328 17:16754834-16754856 GCCTCCAGTACAATAATAGATGG - Intronic
1144898379 17:18560843-18560865 GCCTCCAGTACAATAATAGATGG + Intergenic
1145133996 17:20384878-20384900 GCCTCCAGTACAATAATAGATGG - Intergenic
1147619889 17:41858879-41858901 GCCTCCTCTTAAATGAAACAGGG + Intronic
1147934284 17:44002493-44002515 TCCCCCTCTACAACAACAGAGGG + Intronic
1149301940 17:55313328-55313350 TCCTCCTCTACCATACCACATGG - Intronic
1153729444 18:7994356-7994378 GACTCCGTTACAATAACAGATGG + Intronic
1153929004 18:9861856-9861878 GCCTACTTTATATTAACACATGG - Exonic
1156922165 18:42534996-42535018 GCCTGCTGTAAAATAACACTGGG + Intergenic
1157149707 18:45204382-45204404 GCCAGCTCTACAATCACACACGG - Intergenic
1159287516 18:66373402-66373424 CCTTCCTCTACATTAACCCAAGG - Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
936485826 2:112924923-112924945 ACCTCCTCTACAAAAGCAGAAGG + Intergenic
937578203 2:123450910-123450932 CCCTCCCCCACAATAACCCAGGG + Intergenic
938375195 2:130800276-130800298 CCTTCCTCTACATTAAAACAAGG - Intergenic
940658757 2:156520345-156520367 GCCTCCTGTCCAATATCACTAGG + Intronic
941457541 2:165727460-165727482 GCCTTCTCCACAAAGACACAGGG + Intergenic
943738272 2:191381685-191381707 GCCTCTTCTAGAATGACAGATGG - Intronic
945881016 2:215325287-215325309 GCCTCCTCAACAGTTACACCTGG - Exonic
946532515 2:220587434-220587456 CCAACCTCTACAAAAACACAAGG + Intergenic
947035233 2:225845651-225845673 GCCTCCTGTGCAATAAGATAAGG - Intergenic
1170934722 20:20799729-20799751 GCCTCCTGAGCAATAACAAATGG - Intergenic
1171182392 20:23100378-23100400 GTCTGCTCAGCAATAACACAGGG + Intergenic
1173881791 20:46419613-46419635 GTCTCTTATACAAAAACACACGG - Intronic
1183476964 22:38041050-38041072 GCCTCCTGGAAAATAACACAGGG - Intronic
950541702 3:13617038-13617060 GAGTCCTCTACAATAGGACAGGG - Intronic
951641893 3:24845560-24845582 GCCTCCTTTACAGTTAAACATGG - Intergenic
951694859 3:25435614-25435636 GAATTCTCTTCAATAACACATGG - Intronic
953584640 3:44188565-44188587 GACTTCTCTACAATAGCACAGGG + Intergenic
955657042 3:61255099-61255121 GCATCCTCTTCAAGCACACATGG + Intergenic
956208972 3:66783659-66783681 GCCTCCTCTTCAAAAACAGGAGG + Intergenic
956893785 3:73639181-73639203 GCCTCCTCTACCATAACTGTTGG - Intergenic
958789111 3:98630655-98630677 CCTTCCTCTACATTAACCCAAGG + Intergenic
965191091 3:165530627-165530649 CCCTCCTCTACATTAAACCAAGG + Intergenic
965616103 3:170594011-170594033 GCCTCCTCTACAATAACACAGGG - Intronic
969451504 4:7276492-7276514 GCCTCCTCTACATCAGGACAAGG - Intronic
971008148 4:22398743-22398765 GACTCTTGTATAATAACACAGGG + Intronic
973536941 4:51892959-51892981 GCATTCTCAACAATAACAAATGG - Intronic
976245545 4:83002638-83002660 GCCTCCTCAACATGAAGACAAGG + Intronic
976403875 4:84639358-84639380 GCATCCTCTGCTATTACACAAGG - Intronic
977779120 4:100959509-100959531 GCTTCCTCTTCAATAAAATAGGG - Intergenic
981186335 4:141808110-141808132 GCAACCTCTACAGTCACACAAGG + Intergenic
983026957 4:162749955-162749977 GCCTTCTCCCCAATAACATAAGG + Intergenic
983359092 4:166705728-166705750 CCCTCCTCTACATTAAACCAAGG - Intergenic
989598550 5:43180870-43180892 GCATCCTCTTCATTTACACAGGG - Intronic
990102823 5:52214303-52214325 GACTCCTCTGTAATAACACCTGG - Intergenic
991234508 5:64378318-64378340 CCTTCCTCTATAATATCACAAGG + Intergenic
992000168 5:72428547-72428569 CCCTCCCCTACAATAATTCAGGG - Intergenic
992596029 5:78348125-78348147 GCCTCCTCTATATTATCCCATGG - Intergenic
996692689 5:126357671-126357693 GCCTCATCTCCAATAATACGTGG + Intergenic
998084554 5:139307879-139307901 GCCATCTCTACCATAACTCAAGG - Exonic
999660813 5:153860948-153860970 GTCTCCTGAACAATAGCACAAGG + Intergenic
1003350135 6:5308913-5308935 GCCTCTTCTATAATGATACAGGG - Intronic
1003881180 6:10481237-10481259 GTCTCCTTTACACTAAAACAGGG + Intergenic
1004425968 6:15507363-15507385 CCGTCCTCCCCAATAACACAGGG + Exonic
1006383932 6:33718423-33718445 GCCTCCTCTTTAATCACACAGGG + Intergenic
1007044989 6:38764132-38764154 ACCTCATCTACAAAAACACTAGG + Intronic
1010675964 6:78743634-78743656 GACTCCACTACAGTAACAAAAGG - Intergenic
1011383308 6:86766421-86766443 GCCACCTAGACAATAACCCAAGG + Intergenic
1016120177 6:140334722-140334744 CCCTCCTCTACATTAAACCAAGG + Intergenic
1019657069 7:2201507-2201529 GCCTCCTCTAAAATAAATCCTGG + Intronic
1023722545 7:43111749-43111771 GCCTCCTCTAGAATAAACAAAGG - Intergenic
1028043596 7:86089392-86089414 CCCTCCTCTACATTAAACCAAGG - Intergenic
1031410561 7:121436298-121436320 GCTTTCTTTCCAATAACACATGG - Intergenic
1035179497 7:157078655-157078677 CCCTCCTCTACAAGGACACCTGG - Intergenic
1036191820 8:6677909-6677931 GCCTCTTCTAAAAGTACACATGG - Intergenic
1040916418 8:52569909-52569931 CCCTCCTCTACATTAAACCAAGG + Intergenic
1044398249 8:91739521-91739543 GCTTCCTCTTAAATATCACATGG + Intergenic
1048058700 8:130894797-130894819 TCCTGCTCTACACAAACACAAGG - Intronic
1049038478 8:140095048-140095070 GGTCACTCTACAATAACACAGGG + Intronic
1050962621 9:11755177-11755199 GTCTCCTCATCAATAACAAAAGG - Intergenic
1056184113 9:84115849-84115871 GACTCCTATACAATAACAGCTGG - Intergenic
1058067568 9:100566333-100566355 GCCTCCTTTACATTTCCACATGG + Intronic
1058598980 9:106648460-106648482 GTATCATCTACAATAGCACATGG + Intergenic
1059651102 9:116316848-116316870 GCCTCCTCTTCAAAAGCAAAAGG + Intronic
1060677174 9:125525829-125525851 GTCTCCTCTTCAATAAAATAAGG - Intronic
1187061889 X:15794596-15794618 GCCTACTCAACATTAAGACAAGG - Intronic
1188602410 X:31984818-31984840 TCCTTCTCTATAAAAACACAAGG + Intronic
1192673477 X:73170213-73170235 TCTTCCTCTACATTAAAACAAGG + Intergenic
1194135631 X:90137659-90137681 TCATCCTCTTCATTAACACAGGG + Intergenic
1195848893 X:109261522-109261544 GACTCCAATACAATAACAAATGG - Intergenic
1196215367 X:113045009-113045031 GGCTCCACTACAATAACAGCTGG - Intergenic
1197387077 X:125814747-125814769 CCTTCCTCTACATTAACCCATGG + Intergenic
1197591591 X:128417267-128417289 CCTTCCTCTACATTAACCCAAGG - Intergenic
1198309482 X:135416412-135416434 GTATCCACTGCAATAACACAAGG + Intergenic
1200202941 X:154295181-154295203 TCCTCCTCAACAATCACACGGGG + Exonic
1201927830 Y:19308749-19308771 CCCTCCACTGCAAAAACACAAGG - Intergenic
1202079702 Y:21071683-21071705 GCCTCCTCTCCATTGAGACACGG + Intergenic