ID: 965616894

View in Genome Browser
Species Human (GRCh38)
Location 3:170603167-170603189
Sequence AAGCCAAAGGGGCCACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965616894_965616899 -8 Left 965616894 3:170603167-170603189 CCTGCTTGTGGCCCCTTTGGCTT 0: 1
1: 0
2: 0
3: 23
4: 172
Right 965616899 3:170603182-170603204 TTTGGCTTTGGATGATCTCCTGG 0: 1
1: 1
2: 2
3: 18
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965616894 Original CRISPR AAGCCAAAGGGGCCACAAGC AGG (reversed) Intronic
900759289 1:4460340-4460362 TGGCCAGAGGGGCCTCAAGCAGG - Intergenic
901079690 1:6576920-6576942 AAGCCAGAGGGGCCACACGTAGG - Intronic
901602504 1:10432872-10432894 AAGCCAAAGAGGCATCAACCTGG - Intronic
901788954 1:11643275-11643297 AATCAGAAGGGGCCACATGCTGG - Intergenic
902116465 1:14125566-14125588 AAGCCAAAGCCACCAGAAGCTGG + Intergenic
904977964 1:34472901-34472923 AAGCCACAGGGCCCACAGGGCGG - Intergenic
905259575 1:36707977-36707999 GAGCCAAAGGGGACCCAGGCAGG - Intergenic
905470221 1:38186158-38186180 AAGCCTAAGAGGCCACACGGAGG - Intergenic
907037523 1:51229500-51229522 AAGCCAAAAGAGCCACAAGGCGG + Intergenic
907413051 1:54295746-54295768 CAGCCACAGGGGACACTAGCTGG + Intronic
907585980 1:55618336-55618358 AAGCCAAAGGCGCAAGAACCAGG - Intergenic
910809257 1:91219295-91219317 AAGACAAAGGGGACACAGGGTGG - Intergenic
911498348 1:98657582-98657604 AAGGCAAAGGGGGCACAGACAGG + Intergenic
911651751 1:100396800-100396822 AAACCAAAAGTGCCACAAGATGG - Intronic
911671081 1:100608588-100608610 AAGCCACAGGGCTTACAAGCTGG - Intergenic
920425079 1:205868612-205868634 AAGCCAAAAGAGCCACAAGGTGG - Intergenic
923656308 1:235920323-235920345 AAGCCAAACAGGCCCCCAGCTGG + Intergenic
1065435285 10:25699155-25699177 AAACCAAAGGGGACAGAAGTAGG + Intergenic
1070578203 10:77696596-77696618 AAGACAAAAGGGACACAAGTTGG + Intergenic
1070751275 10:78965360-78965382 CGGCCACAGGGGCCCCAAGCTGG + Intergenic
1072017832 10:91366761-91366783 AAGCCAAAGAGGCCATACCCAGG - Intergenic
1077233959 11:1470982-1471004 CAGCCCAAGTGCCCACAAGCTGG + Intronic
1078889275 11:15539575-15539597 GAGCCAAAGGGGCAGCAAGCGGG + Intergenic
1079870663 11:25794325-25794347 AAGCCAGATGGGCCACCTGCTGG + Intergenic
1080002733 11:27368715-27368737 AAGCCAAAAGGGCAGCAACCCGG + Exonic
1081070702 11:38605793-38605815 AAGCCAAAAGAGCCACAAGGTGG + Intergenic
1081177894 11:39951390-39951412 AAGACAAAGGGGAAGCAAGCAGG - Intergenic
1083991119 11:66246340-66246362 AACCTAAGGGGGCCAGAAGCTGG - Intergenic
1084160421 11:67346011-67346033 AACCCAAATTGGCCTCAAGCTGG + Intronic
1089571920 11:119416822-119416844 AAGCCACAGAGGCCACCAGAGGG - Intergenic
1090153929 11:124416438-124416460 ACGCCAAAGTGGACACATGCAGG - Intergenic
1090954744 11:131504119-131504141 AAGCCACAGTGTCCAGAAGCAGG - Intronic
1091156533 11:133379591-133379613 AAGTGAAAGAGGCCAGAAGCTGG - Intronic
1091582636 12:1798449-1798471 AACCCAGAGGGGACACTAGCTGG + Intronic
1091869965 12:3881277-3881299 AAGCCAAGGGGGCCAGGAGAGGG + Intergenic
1095139104 12:38640553-38640575 AAGCCAAAAAAGCCACAAGGCGG + Intergenic
1095293405 12:40502043-40502065 AAGCCACAGGTTCCACAAGAGGG + Intronic
1099605398 12:84796544-84796566 AAGCCAAAAGAGCCACAAGGCGG + Intergenic
1104851135 12:131874615-131874637 AAGCCAAAAGAGCCGCAAGGCGG - Intergenic
1104975550 12:132550443-132550465 AAGCAAACGGGGCCACAGGCAGG - Intronic
1106052268 13:26202830-26202852 AAGGCAAATGGGCCACAAACTGG + Intronic
1107137079 13:36956853-36956875 AAGCCAAAAGAGCTACAAGGCGG + Intronic
1109967548 13:69720983-69721005 AAGCCAAAGGGAAGTCAAGCTGG + Intronic
1110931576 13:81224929-81224951 AAGCCACTGGGGCCATAAACTGG - Intergenic
1111240419 13:85466237-85466259 AAGACAAAGGGGAAGCAAGCAGG + Intergenic
1114346454 14:21800424-21800446 AAGCCAAAGGGGACACCAGTAGG + Intergenic
1115933729 14:38528036-38528058 AAGCCACTGGGGCCATAAACTGG + Intergenic
1116612457 14:47093163-47093185 CAGCCAAAGTGGACCCAAGCTGG + Intronic
1119439587 14:74619381-74619403 AAGCCAAGGTGGGCACAGGCTGG - Intergenic
1119826490 14:77661175-77661197 AAGCCCAAGAGGCGATAAGCAGG + Intergenic
1127395941 15:58544108-58544130 AATCCATGGGGGCCACACGCCGG - Intronic
1128231114 15:66036086-66036108 CAGCCAGAGGGGCCAGGAGCTGG + Intronic
1135429365 16:22369741-22369763 AACCAAAAGAGGCCAAAAGCTGG + Intronic
1135573014 16:23563731-23563753 AGGGCAAACGGGCCAGAAGCTGG - Intronic
1136463410 16:30425988-30426010 AAGCCAAAGTGGCCTTAGGCGGG - Intronic
1138074550 16:54028229-54028251 AAGCCAAAGGGATCAGAAACAGG - Intronic
1138915849 16:61463379-61463401 AAGCCAAAAGGAACACAAGGTGG - Intergenic
1141877648 16:86837056-86837078 AATCCAAAAATGCCACAAGCAGG + Intergenic
1143679041 17:8462446-8462468 AAGCCAGACAGGCCAAAAGCCGG - Intronic
1144792450 17:17868152-17868174 AAGACAAAGGGGCCTCGGGCTGG + Intronic
1148581017 17:48743778-48743800 AAGCTGAAGGGGCCCCAACCAGG + Intergenic
1148767196 17:50046309-50046331 AGCCCAAAGGGACCACAAGGTGG - Intergenic
1148826887 17:50400370-50400392 AAGCCAAAAGAGCCGCAAGGCGG - Intergenic
1148860810 17:50603482-50603504 CAGCACAAGGGGCCACGAGCAGG + Intronic
1150549105 17:66192343-66192365 CCGCCAAGGGGCCCACAAGCTGG - Intergenic
1151817971 17:76480876-76480898 AAGCCCACGCTGCCACAAGCCGG + Intronic
1152735062 17:81993133-81993155 AAGCCCAAGGTGCCACACCCAGG - Intronic
1153158592 18:2177476-2177498 AAACCAAAGGAGAAACAAGCAGG + Intergenic
1155522749 18:26685559-26685581 AAGGCCAAGGGGCCACAGGGTGG + Intergenic
1158142694 18:54272151-54272173 AAGCCAAAGTGGGCACAAGAGGG - Intronic
1161224758 19:3138342-3138364 AGGCCAACGGGGCCATAATCAGG - Intronic
1164623144 19:29709354-29709376 AAATCAAAGGGGCCACGAGGTGG + Intronic
1164739669 19:30566843-30566865 TACCCAAAGAGGCCACATGCAGG - Intronic
1165402472 19:35610570-35610592 CAGCCAAAAAGGCTACAAGCTGG - Intergenic
1166554161 19:43687090-43687112 GAGCCAAAGGGGAGACAGGCAGG - Intergenic
1166664674 19:44671893-44671915 AATGCCAAGGGGCCACGAGCTGG - Exonic
1166811397 19:45516539-45516561 AAGACAGAGGGGCCAGAAGGAGG - Intronic
1167211869 19:48138614-48138636 CAGCCACGGGGGCCACAAGGCGG + Intronic
1168319035 19:55498044-55498066 CAGCCAAAGCGGCCAGCAGCAGG - Exonic
925094673 2:1186586-1186608 AAGCCAAAGGGGAAGCAGGCAGG + Intronic
926127907 2:10283198-10283220 AAGACAAAGCAGCCACAGGCAGG + Intergenic
928476590 2:31633081-31633103 AAGCCAAAAGAGCCACAAGGTGG + Intergenic
928677450 2:33663480-33663502 AAGCCAAAAGAGCCACAAGGCGG + Intergenic
935212098 2:100946883-100946905 AAGACAAAGGCGCCACCAGAGGG + Intronic
936025846 2:109030656-109030678 ATGCCTGAGGGGCCCCAAGCTGG - Intergenic
936387166 2:112040780-112040802 AAGCCGAAAGAGCCACAAGGCGG - Intergenic
937178914 2:119971187-119971209 AAGGCAAAGGGGAAGCAAGCAGG + Intronic
940910420 2:159205180-159205202 AAGCCAAAAGAGCCACAAAAGGG - Intronic
941991424 2:171560993-171561015 AAGCCAAAAGAGCCACAAGGTGG - Intergenic
943511537 2:188833153-188833175 AAGCCACAGGAGCCATAAGCTGG + Intergenic
944039207 2:195335638-195335660 AAGCCAAAAGAGCCACAAGGCGG - Intergenic
945157207 2:206851788-206851810 AAGCCAGAGTGGGCACATGCAGG - Intergenic
946241953 2:218361760-218361782 AAGCCAAAGGGAAGTCAAGCTGG - Intronic
947735778 2:232454681-232454703 AAACTAAGGGGGCAACAAGCAGG + Intergenic
948438345 2:237968443-237968465 CAGCCAAAGGGGCCCCGATCAGG - Intronic
948757275 2:240166999-240167021 AAGCCAGAGGGGTCTCTAGCTGG + Intergenic
1174035075 20:47663823-47663845 ACTCCCAAGGGGGCACAAGCTGG + Intronic
1174199433 20:48797258-48797280 AAGCCAAATGGGAATCAAGCTGG + Intronic
1179290497 21:40014034-40014056 AAGCCAGAGTGACCATAAGCAGG - Intronic
1180949728 22:19715553-19715575 AAGCCAGAGAGGACACCAGCAGG - Intronic
1181040272 22:20188701-20188723 AGGCCCATGGGGCCAGAAGCAGG - Intergenic
1181648644 22:24247118-24247140 ATACCAAAGGGCCCACAAACAGG - Intergenic
1182565133 22:31192798-31192820 AAGCAAATGAGCCCACAAGCAGG - Intronic
1182967615 22:34536718-34536740 AAGGAAAAGGGGGCAGAAGCAGG + Intergenic
1183460532 22:37947306-37947328 AAGCCAATGGGGCCTACAGCCGG - Exonic
1184659628 22:45959926-45959948 GAGCCACAGGAGCCAGAAGCGGG + Intronic
949288821 3:2438933-2438955 GAGAGAAAGGGGCCACTAGCTGG + Intronic
950707026 3:14789182-14789204 AGACCAAAGGGACCACAAGGAGG - Intergenic
951445946 3:22780999-22781021 AAGCCAGAGAGGCCAGAAACTGG + Intergenic
952878649 3:37969357-37969379 AAGCCACAGGAGCCAAGAGCAGG + Intronic
953029308 3:39168011-39168033 AAGGCCAAGGGGATACAAGCAGG - Intergenic
953188112 3:40657113-40657135 AAGCCCAAGGGAACACAAGTAGG - Intergenic
954213539 3:49111647-49111669 CAGCCATAGGGGTCACCAGCTGG + Exonic
954514757 3:51163543-51163565 AAGGACAAGGGGTCACAAGCAGG + Intronic
957519251 3:81297293-81297315 AAGAGAAACGTGCCACAAGCTGG - Intergenic
960913555 3:122674504-122674526 AAGGCAAAGGGGAAGCAAGCAGG + Intergenic
961558047 3:127710108-127710130 AGGCCAAGAGGGCCACCAGCAGG - Intronic
965054441 3:163695887-163695909 AACCCAAAAGAGCCACAAGGTGG - Intergenic
965616894 3:170603167-170603189 AAGCCAAAGGGGCCACAAGCAGG - Intronic
966109938 3:176388203-176388225 AAGCAAAATGGGGCACAATCTGG + Intergenic
966185679 3:177224691-177224713 AAGCCAATGAGGTCACAAGATGG - Intergenic
968762893 4:2451484-2451506 CAGCAACAGGGGCGACAAGCAGG + Intronic
969264304 4:6055055-6055077 AAGGGAATGGGGCCACATGCTGG + Intronic
969645324 4:8425234-8425256 AAGCCAAAAGAGCCGCAAGGTGG + Intronic
971006027 4:22375023-22375045 AAGGCGATGGTGCCACAAGCTGG + Intronic
972179142 4:36442638-36442660 AAGCCAAAAGAGCCACAATGTGG - Intergenic
972849400 4:43030385-43030407 AAGCCAAAGCCTCCACAAGAGGG - Exonic
972980923 4:44700176-44700198 AAGCCAAAGGGAAGTCAAGCTGG + Exonic
974930995 4:68360992-68361014 AAGCCAAAGGGAAGTCAAGCTGG + Intergenic
975655856 4:76640729-76640751 AAGCCAAAATGCCCAAAAGCCGG + Intronic
976351230 4:84062153-84062175 AAGCCAAAGGGCTCAGGAGCTGG + Intergenic
977441962 4:97079309-97079331 AAGTCAAGGGGTCCACAGGCTGG + Intergenic
980008042 4:127563392-127563414 ATGCTACAGAGGCCACAAGCAGG + Intergenic
983666670 4:170191196-170191218 AAGCCAAAAGAGCCACAAGGTGG - Intergenic
985555408 5:555591-555613 AACCCGACGGGGACACAAGCGGG + Intergenic
988758428 5:34286022-34286044 AAGTCCAAGGGTCCAAAAGCTGG - Intergenic
990972659 5:61525953-61525975 ATGCCAGAGGGGCCACCCGCGGG - Exonic
994696945 5:103084384-103084406 AAGCCAAATGAGCTACAAGAGGG - Intergenic
995319495 5:110816765-110816787 AATCCTATGGGGCCACTAGCAGG - Intergenic
995762645 5:115579546-115579568 AAGCCAGAGAGGCCCCAAACAGG - Exonic
997816326 5:137022244-137022266 AAGCCCAAGAGACCACAAGTGGG + Intronic
1000561231 5:162791945-162791967 AAGGCAAAGGGGACGCAAGCTGG + Intergenic
1000843078 5:166246096-166246118 CTGCCGAAGAGGCCACAAGCTGG - Intergenic
1003422039 6:5967457-5967479 AAGTCAATGGAACCACAAGCTGG + Intergenic
1003712293 6:8605445-8605467 AAGGCAATGGGGCCAGGAGCTGG - Intergenic
1004024358 6:11804784-11804806 AAGCCAAAGGGAAGTCAAGCTGG + Intronic
1004236958 6:13882727-13882749 AAGCCAAAAGAGCCGCAAGGTGG + Intergenic
1004556163 6:16700632-16700654 AAGCCAAAGGAGGCTGAAGCTGG - Intronic
1004777469 6:18863868-18863890 AAGGCAAAGGGGGAACAGGCAGG - Intergenic
1005929113 6:30467720-30467742 CAGTCAAAGGGGCTACAGGCAGG + Intergenic
1006797505 6:36741159-36741181 AAGCCAAGGCGGCCTCAAGTAGG + Exonic
1006952108 6:37831365-37831387 TGGCCAAAGGGGCCAAAAGCTGG - Intronic
1007939568 6:45766978-45767000 AAACCAAAGAGGCCAAAAGATGG + Intergenic
1009413891 6:63395489-63395511 AAGCCACAAGAGCCAGAAGCTGG - Intergenic
1011148872 6:84246484-84246506 CAGCCAAAGGAGCCACCAGTGGG + Intergenic
1012150235 6:95741066-95741088 AAGGCAAAGGGGAAGCAAGCTGG + Intergenic
1013543905 6:111137092-111137114 AAGCCGAAAGAGCCACAAGGCGG + Intronic
1014250011 6:119105464-119105486 AAGGCAAAGGGGAAGCAAGCAGG - Intronic
1016349828 6:143155342-143155364 AAGACAAGGGGGCCCAAAGCTGG + Intronic
1018271701 6:162086348-162086370 AAGCAAAAGAGGAAACAAGCAGG + Intronic
1019115481 6:169757938-169757960 CAGCTGAAGGGGCCACAAGTGGG - Intronic
1019962828 7:4475308-4475330 CAACCAAAGTGGCCAAAAGCAGG - Intergenic
1021116853 7:16754074-16754096 AAGCCAAAGAGCTCCCAAGCAGG - Intronic
1021742122 7:23697217-23697239 AAGCCACTGGGGCCAGGAGCGGG + Intronic
1023030709 7:36088306-36088328 AAGGCAAAGGGGGAACAGGCAGG - Intergenic
1023909715 7:44544955-44544977 AAGACAAAGGGGCCACCGGCAGG - Intergenic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1031471670 7:122175010-122175032 AAGCCAAAAGAGCCACCAGGTGG + Intergenic
1032425955 7:131822255-131822277 AAGCCAAAAGAGCCGCAAGGTGG - Intergenic
1033476966 7:141701536-141701558 AACCCAACGTGGCCACAAACCGG + Intronic
1034499368 7:151440040-151440062 AAGCCCGAGGGGCCACCAGGCGG + Exonic
1035045676 7:155963829-155963851 CAGCCAAAGGGGCCTCAAAGAGG - Intronic
1035483515 7:159204859-159204881 AGGCCAGATGGGCCACATGCGGG + Intergenic
1036778120 8:11627736-11627758 AAGCAAAATCGTCCACAAGCTGG + Intergenic
1037624456 8:20595104-20595126 AAGCCAAAGGGGAGCCAGGCTGG - Intergenic
1037851135 8:22329934-22329956 AAGCCTAAGGGACACCAAGCAGG - Intronic
1038820217 8:30945031-30945053 AAGCAAAAGGGCACAGAAGCTGG + Intergenic
1039242015 8:35567537-35567559 AAGCCAATGGGACCAAAAGAAGG - Intronic
1041663504 8:60421269-60421291 AAGCCAAAAGAGCCGCAAGGCGG - Intergenic
1042056254 8:64767366-64767388 AAGCCAAAAGAGCCGCAAGGCGG + Intronic
1044492003 8:92830472-92830494 GTGCCAAAGGGGACATAAGCAGG + Intergenic
1045726096 8:105175323-105175345 AAGCCAAAGGGACCAGAAGTGGG - Intronic
1049321351 8:141998607-141998629 GAGCCATGGGGGCCAGAAGCAGG - Intergenic
1049704439 8:144034209-144034231 AAGCCAAAGGTGCCACCAAGAGG + Intronic
1051705829 9:19878697-19878719 AAGGCAAAGGGGAAACAAGCAGG - Intergenic
1052671646 9:31565241-31565263 AAGCCAAAGGGAACGCAACCTGG - Intergenic
1058372956 9:104291332-104291354 AGGCCAGAGAGGCCAGAAGCAGG + Intergenic
1058400732 9:104616077-104616099 AACCCAAAGATTCCACAAGCAGG + Intergenic
1186316738 X:8378802-8378824 AAGCCAAAAGAGCCACACACAGG - Intergenic
1187031574 X:15493427-15493449 AGGCCAAAGGGCCGCCAAGCTGG - Exonic
1194910541 X:99637427-99637449 AAGTCCAAGAGTCCACAAGCTGG - Intergenic
1196526985 X:116738928-116738950 AAGCCAAAAGAGCCGCAAGGTGG - Intergenic
1197954443 X:131931002-131931024 AAGCCAAAAGAGCCGCAAGGTGG - Intergenic
1201723974 Y:17134087-17134109 AAGCCAAATAAGCCACAAGGTGG - Intergenic
1201855113 Y:18532783-18532805 AACCCATAGGAGCCACAAGCTGG - Intergenic
1201878208 Y:18787601-18787623 AACCCATAGGAGCCACAAGCTGG + Intronic