ID: 965622387

View in Genome Browser
Species Human (GRCh38)
Location 3:170654635-170654657
Sequence CCTCTTCCACCCCAGGAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 301}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965622381_965622387 2 Left 965622381 3:170654610-170654632 CCTGAGTGGGCCAGCATCATCTG 0: 1
1: 0
2: 0
3: 13
4: 139
Right 965622387 3:170654635-170654657 CCTCTTCCACCCCAGGAATGGGG 0: 1
1: 0
2: 2
3: 24
4: 301
965622377_965622387 15 Left 965622377 3:170654597-170654619 CCTCCTAGGACCTCCTGAGTGGG 0: 1
1: 0
2: 2
3: 16
4: 135
Right 965622387 3:170654635-170654657 CCTCTTCCACCCCAGGAATGGGG 0: 1
1: 0
2: 2
3: 24
4: 301
965622375_965622387 25 Left 965622375 3:170654587-170654609 CCTCAGATTGCCTCCTAGGACCT 0: 1
1: 0
2: 1
3: 22
4: 147
Right 965622387 3:170654635-170654657 CCTCTTCCACCCCAGGAATGGGG 0: 1
1: 0
2: 2
3: 24
4: 301
965622380_965622387 5 Left 965622380 3:170654607-170654629 CCTCCTGAGTGGGCCAGCATCAT 0: 1
1: 0
2: 2
3: 12
4: 104
Right 965622387 3:170654635-170654657 CCTCTTCCACCCCAGGAATGGGG 0: 1
1: 0
2: 2
3: 24
4: 301
965622382_965622387 -8 Left 965622382 3:170654620-170654642 CCAGCATCATCTGCTCCTCTTCC 0: 1
1: 0
2: 7
3: 75
4: 625
Right 965622387 3:170654635-170654657 CCTCTTCCACCCCAGGAATGGGG 0: 1
1: 0
2: 2
3: 24
4: 301
965622379_965622387 12 Left 965622379 3:170654600-170654622 CCTAGGACCTCCTGAGTGGGCCA 0: 1
1: 0
2: 0
3: 13
4: 186
Right 965622387 3:170654635-170654657 CCTCTTCCACCCCAGGAATGGGG 0: 1
1: 0
2: 2
3: 24
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965622387 Original CRISPR CCTCTTCCACCCCAGGAATG GGG Intronic
901118064 1:6864841-6864863 CCTTGTCCACCCCAGCACTGAGG - Intronic
901189806 1:7402888-7402910 CCTTTTCCACAGCAGGAATGGGG + Intronic
902333651 1:15742919-15742941 CCTCATCCCCCCAGGGAATGTGG + Intronic
903592776 1:24469854-24469876 CCTCCTCCACCAAAGGAATTAGG + Intronic
903647384 1:24903484-24903506 CCCCTGCTCCCCCAGGAATGTGG + Intronic
904272813 1:29361773-29361795 ACTCTGCCACCCCAGGTTTGGGG - Intergenic
904931177 1:34088473-34088495 TCTCTTCCATCACAGGGATGGGG + Intronic
905230529 1:36512394-36512416 CATCTGCAACCACAGGAATGAGG - Intergenic
905302705 1:36996687-36996709 GCTGTTCCCCACCAGGAATGAGG - Intronic
905459883 1:38115682-38115704 CCTTTTCCTCTCCAGGAAGGTGG + Intergenic
906277462 1:44527346-44527368 CCTCTTTCACCAAAGGAAGGAGG + Intronic
907455311 1:54571888-54571910 CCTCTTCCTCCCCAGAAAGTGGG - Intronic
908027034 1:59963520-59963542 TATCATCCAGCCCAGGAATGAGG - Intergenic
908231580 1:62110790-62110812 GCCCTTCCACCCAAGGGATGTGG + Intronic
908458380 1:64326212-64326234 GCTGCTCCACACCAGGAATGTGG + Intergenic
908523326 1:64965870-64965892 CTTCTTCGGCCCCAGGAAGGAGG - Intronic
908690554 1:66774753-66774775 CCCCTCCCACCCCAAGATTGGGG - Intronic
909561727 1:77015681-77015703 CCTCTGCCACCCCAAAATTGAGG - Intronic
909898658 1:81106729-81106751 AGTCTTGCACCCCAGGAATGTGG + Intergenic
909913722 1:81292291-81292313 GCTCTTCCACCGAAGGAGTGGGG + Intergenic
910527070 1:88191977-88191999 CCCCTCCCACCCCAGGAGTAGGG - Intergenic
915250242 1:154582874-154582896 CCTCTTCCACTCCAGGAGACAGG + Exonic
916181096 1:162084490-162084512 CCTCTGACACCCCAGCAAGGAGG + Intronic
917536406 1:175877552-175877574 CCACGTCCACACCAGGAAAGGGG + Intergenic
918026633 1:180755931-180755953 CCTCTCCCAGCCCTGGAATCAGG - Intronic
918308810 1:183270783-183270805 ACTCTTGCACCCCAGGGATTAGG - Intronic
918448679 1:184639035-184639057 CATCTGCAACCCCAGGAAAGAGG + Intergenic
920012373 1:202878183-202878205 TCTTTTGCACCCCAGGAATAAGG - Intergenic
920171829 1:204076695-204076717 CAACCTCCACCCCAGGCATGGGG + Intronic
920865022 1:209744633-209744655 ACTGTTCCACTCCAGGAATGGGG - Intergenic
921889438 1:220339086-220339108 CCTCTCCCAAACCAGGAAGGAGG - Intergenic
921992396 1:221381671-221381693 CCAATTCAACCCAAGGAATGTGG + Intergenic
922154752 1:223032095-223032117 TTTCTTCCTCCCTAGGAATGGGG + Intergenic
1063159192 10:3407461-3407483 CCTTTTCCACCCCAGCGAGGAGG - Intergenic
1063232651 10:4080878-4080900 CCTCCTTCAACCCAGGAATTTGG + Intergenic
1063296602 10:4812892-4812914 CCACTTCCACCCTAGGGGTGGGG - Intronic
1063936157 10:11080738-11080760 CCTCCTCCACCTCCGGAATAGGG - Intronic
1064123020 10:12635568-12635590 CCTCTTCCCCCCCAGCAAGATGG - Intronic
1064370682 10:14749706-14749728 CCTCTTCCATCCCAGGGAGCAGG + Intronic
1068147384 10:53088786-53088808 CTCCTTCCACCCCAGGCCTGTGG + Intergenic
1069455292 10:68549126-68549148 CCTCAGCCTCCCCAGTAATGGGG - Intergenic
1071528621 10:86372861-86372883 CCTCTGCCCTCCCAGGAATGAGG + Intergenic
1071561407 10:86649275-86649297 CCTCTTCCAGCCCCGGGATGAGG + Intergenic
1072535066 10:96356106-96356128 CCACTTCCACCCAGGGAAAGAGG - Intronic
1072685574 10:97534679-97534701 CCTTTTCTACCCCAGAAGTGGGG - Intronic
1072751116 10:97979543-97979565 CCACTTCCAGCCCAGCAATCAGG - Intronic
1074158122 10:110815846-110815868 CCTCTTACAACCCTGGAGTGGGG + Intronic
1074185288 10:111095894-111095916 CCTCATTCACCTGAGGAATGAGG + Intergenic
1075411736 10:122233487-122233509 CCTCTTCTAAGCCAGGACTGAGG - Intronic
1075914268 10:126154003-126154025 ACTCTTCCAATCCAGGGATGGGG - Intronic
1077025469 11:438055-438077 CATCGTTCACCCCAGAAATGAGG + Intronic
1077220379 11:1413062-1413084 CCCCATCCTCCCCAGGAATGCGG - Intronic
1078182934 11:9027646-9027668 CCTGTTGCCACCCAGGAATGGGG + Intronic
1078501586 11:11884828-11884850 CCACTGCCACACCAGGGATGGGG + Intronic
1079502553 11:21117930-21117952 CCTCTACCATTCCAGGCATGAGG - Intronic
1081257200 11:40911640-40911662 TCTCTTCCTCCAAAGGAATGCGG + Intronic
1081597177 11:44467289-44467311 CCTCATCGCCCCCAAGAATGAGG - Intergenic
1082771661 11:57212462-57212484 TCTGTTCCACCCCATGCATGAGG - Intergenic
1083333185 11:61908525-61908547 CCCCTTCCAGCCCAGGGCTGAGG + Intronic
1083365312 11:62138625-62138647 CCTCTACCATTCCAGGGATGGGG - Intronic
1083629804 11:64089642-64089664 TCACCTCCACCCCAGGAGTGGGG - Intronic
1084061665 11:66679183-66679205 CCTCTTCCACCCCAGCTACTTGG + Intergenic
1085023282 11:73222199-73222221 CCTCTCCCTCCCCAGGTCTGAGG + Intronic
1086916383 11:92534267-92534289 CCCCTCCCCCCCCAGGACTGTGG - Intronic
1089578823 11:119468736-119468758 CCACTGCCACCCCAGGCCTGTGG + Intergenic
1090351235 11:126109933-126109955 CCTCTGCCACCTCAGAAATGTGG - Intergenic
1090826883 11:130393721-130393743 CCTCTTCCAACCCGGGGATCTGG + Intergenic
1093073395 12:14731707-14731729 ACTCTTACACAGCAGGAATGAGG - Intergenic
1094167510 12:27457518-27457540 CATCACCCAACCCAGGAATGGGG + Intergenic
1095390690 12:41702844-41702866 CCTCTTCCACCATAGCACTGTGG + Intergenic
1096764063 12:53868686-53868708 CCACTCCCACCCAAGGAATGAGG - Intergenic
1097044667 12:56178597-56178619 TCTCCCACACCCCAGGAATGTGG + Intronic
1098950034 12:76630664-76630686 CCAGATCCAGCCCAGGAATGTGG + Intergenic
1099130344 12:78821347-78821369 CCTGTTCCACCTCAGGCATATGG - Intergenic
1101076554 12:101135214-101135236 CCTCTCCAACCCAAAGAATGGGG + Intergenic
1101115869 12:101530751-101530773 CCTCTTCCCCACCAGGACAGTGG - Intergenic
1101255451 12:102972846-102972868 CTTCATCTACCCCAGGAATCTGG + Intergenic
1102040988 12:109800636-109800658 CTTCTTCCAGCCCAAGGATGAGG - Exonic
1102059657 12:109923063-109923085 CCAGTTCCACCCCAGGCAGGTGG - Intronic
1102171940 12:110848898-110848920 CCTCTTTCAGCCCTGGAATTTGG - Intronic
1104652604 12:130546983-130547005 CCTCCTCCTCCCCAGCACTGGGG - Intronic
1107066949 13:36224667-36224689 ATTCTTCCACCCCATGAATATGG - Intronic
1108408200 13:50125003-50125025 CCTCCTCGACCCCAGCAAGGCGG + Intronic
1108576775 13:51797730-51797752 CCTCTTCAACCCAGGGAAAGCGG + Intronic
1110944593 13:81396595-81396617 CCTTTCCCACCCCAGGCTTGTGG - Intergenic
1112284214 13:98089563-98089585 GCTCTTCCACCCCATGGGTGGGG - Intergenic
1112332134 13:98484831-98484853 CATCTTCCTCTCCAGGAAGGAGG - Intronic
1117215507 14:53547555-53547577 CCTCATCTACCCCAGGCAAGGGG - Intergenic
1117332828 14:54730485-54730507 TCTCTTCTTCCCCCGGAATGAGG + Intronic
1119224526 14:72934633-72934655 CCACCTCCAGCCCAGGCATGTGG + Intronic
1119578456 14:75751511-75751533 GCTCTTTCCCACCAGGAATGTGG - Intronic
1120551512 14:85878331-85878353 CCTCATCCTCCCCAGTTATGGGG - Intergenic
1121279999 14:92691290-92691312 CCTCTGCCAGCCCAGGAGAGAGG - Intergenic
1121638040 14:95466860-95466882 CCTCCTTCACCCCAGCCATGGGG - Intronic
1122267454 14:100553361-100553383 CCTCTTTCTGCCCTGGAATGGGG - Intronic
1122861919 14:104586629-104586651 CATCCTCCACCCCAGGAATCAGG + Intronic
1124013583 15:25859036-25859058 CCTCTTCCACAGCAGGGGTGAGG - Intronic
1124434566 15:29636232-29636254 CCTCGTCCACAGCAGGCATGAGG - Intergenic
1125082959 15:35697134-35697156 CCTCTTCCACGCCGGCAAAGGGG - Intergenic
1125267693 15:37901967-37901989 CCTCTTGGACCCCAGGTTTGTGG + Intergenic
1125598938 15:40905086-40905108 CCTCTTCCTAGCCAGGCATGGGG + Intergenic
1125834061 15:42735625-42735647 CCTGTCCCACCCCAGAATTGGGG - Exonic
1126053277 15:44707027-44707049 CCACTTCCACCCCAGGCCTGTGG + Intronic
1129658700 15:77541426-77541448 CCTGTTCCTCCCCTGGACTGAGG + Intergenic
1130747526 15:86671933-86671955 TCTCTTCCACACCAGTGATGGGG + Intronic
1131172793 15:90190513-90190535 CCTCTTCCTTCCCAGGGAGGAGG - Intronic
1132154721 15:99487270-99487292 CTTCTTCCAGCCCAGGAAAATGG + Intergenic
1132551454 16:555475-555497 CCTGGGCCACCCCAGGACTGGGG - Intergenic
1132563312 16:608755-608777 CCTCTGCCTCCCAAGGAGTGGGG - Intronic
1132854989 16:2040747-2040769 CCTCAGCCTCCCCAGGAACGTGG + Intronic
1133210983 16:4263467-4263489 GCTTTGCCACCCCAGGACTGAGG + Intronic
1134042121 16:11076748-11076770 CCTCTCCCAGCCCAGGAAGCTGG + Intronic
1134392812 16:13835278-13835300 GTTATTCCACCCCAGGGATGTGG - Intergenic
1137610612 16:49814844-49814866 CATCCCCCACCCCAGGAGTGTGG + Intronic
1137796520 16:51224698-51224720 CTTCTCCTTCCCCAGGAATGAGG + Intergenic
1138191316 16:55016398-55016420 CCTCTCCATCCCCAGGAAAGGGG + Intergenic
1139568945 16:67798417-67798439 GGTCCTCCACACCAGGAATGTGG + Intronic
1141088025 16:81110624-81110646 CCTCTCCCACCCCTGGAAACAGG - Intergenic
1142125273 16:88407108-88407130 CCTCTGCGGCCCCAGGACTGAGG + Intergenic
1142259779 16:89037285-89037307 CCTCAGCCACCCCAGGACAGTGG - Intergenic
1142898802 17:2999559-2999581 CCTCATGAACCCCAGGAATCAGG - Intronic
1143030187 17:3963564-3963586 ACTCCGCCACCCCAGGAAGGTGG + Intronic
1143535687 17:7537851-7537873 CCGCTGCCACCCCAGGATTGAGG - Intergenic
1143540117 17:7563575-7563597 CATCTTTCACCCCAGCAAGGGGG + Exonic
1144771717 17:17763152-17763174 CCATTCCCACCCCAGGAAAGCGG - Intronic
1145933119 17:28700098-28700120 CCCCTTCCACCCCCTGAATTGGG + Intronic
1147212024 17:38877413-38877435 CCTCTCCCACCCCAGGAGGAGGG - Intronic
1147897016 17:43757663-43757685 CTTCTCCCTCCCCTGGAATGAGG + Intronic
1148539870 17:48471946-48471968 CCTCCTCCACCTCTGGGATGGGG + Intergenic
1148633968 17:49133009-49133031 ACTCTGCACCCCCAGGAATGGGG + Exonic
1151314115 17:73311505-73311527 CCTCCCCCTTCCCAGGAATGGGG - Intronic
1151575678 17:74951626-74951648 CCATTTCCTCCACAGGAATGTGG - Exonic
1151880932 17:76893951-76893973 CCTCTTACACCCCGGGAAGGTGG - Intronic
1152411569 17:80126750-80126772 CTTTTTCAACCCCAGAAATGAGG + Intergenic
1152432209 17:80254779-80254801 CCTCTTCCAGCCCTGGCAGGGGG - Intergenic
1152462707 17:80449838-80449860 CCTCTTCAACCTGGGGAATGGGG - Intergenic
1152533325 17:80934472-80934494 CCTCTTCCTCCCCAGGAGCTGGG + Intronic
1158319177 18:56244548-56244570 CCTCTTTCACCATAGGAATAAGG + Intergenic
1161480955 19:4510455-4510477 CATCTTCCACCCCATGAATGCGG - Exonic
1161619817 19:5292153-5292175 CTTTTCCCACCCCAGGAACGTGG + Intronic
1161784060 19:6312148-6312170 CCTGTTCCCCCCAAGGAAGGAGG + Exonic
1161975204 19:7604691-7604713 ACTCTTCAACACCAGGACTGGGG - Intronic
1162375795 19:10304743-10304765 CCTGTGCCAGCCCAGGAAGGTGG - Intergenic
1162706629 19:12559936-12559958 CCTCTTCCTCCACATGAAAGCGG - Intronic
1163737909 19:18992734-18992756 CCTCTGACACCCCAGGATTAGGG - Exonic
1164210501 19:23093700-23093722 CCTCTCCCACCCCAGGGGTAGGG + Intronic
1164591638 19:29510894-29510916 CAGCTCCCACCCCAGGAATGCGG + Intergenic
1164849061 19:31465609-31465631 CCTCTGCCATCCCATGAAAGTGG + Intergenic
1166237898 19:41469756-41469778 CCTCTTCCACCCCGGATATTAGG + Intergenic
1166893707 19:46009998-46010020 CCTCTTCCCAGCCAGGAATTAGG + Intronic
1167338442 19:48900718-48900740 CCTCTTCCTCCCCTGGAACCAGG - Intronic
1167356413 19:49006918-49006940 TTTCTCCCACCCCAGGAAAGAGG - Intronic
1168101157 19:54141815-54141837 CCTCTTCCCCTCCAGGGAGGGGG - Exonic
1168168755 19:54572855-54572877 CCACCCCCACCCCGGGAATGAGG - Intergenic
926688107 2:15714223-15714245 CCTGTCCCACCCCAGTACTGTGG + Intronic
927198108 2:20561917-20561939 TCTCTTCCACCCCAGGAGGTTGG - Intronic
927694199 2:25229374-25229396 CCTTTTCCACCCCCGGGATTGGG + Exonic
929050403 2:37831578-37831600 CCTTTTCCACCCCGTGAAAGTGG + Intergenic
929329467 2:40663151-40663173 CCACTTCCCCCCCTGGAATAAGG - Intergenic
930923257 2:56783716-56783738 CCTCTGCAACCCCAGGAAATTGG - Intergenic
931048048 2:58379425-58379447 CGACATCCACCCCAGAAATGGGG + Intergenic
933465480 2:82645557-82645579 AATCTTCCATCCCAGGGATGAGG - Intergenic
934056803 2:88258149-88258171 CTCCTACCACCCCAGGAGTGGGG + Intergenic
934620335 2:95799629-95799651 CCAACTCCACCCCAGGGATGAGG - Intergenic
934640556 2:96024936-96024958 CCAACTCCACCCCAGGGATGAGG + Intronic
935373093 2:102367844-102367866 CCCCTTCAACCACAGTAATGTGG - Exonic
936085917 2:109469130-109469152 TCTTCTCCACCCCAAGAATGCGG + Intronic
937404953 2:121618495-121618517 CCCCTTTCATCCCAGGAGTGAGG - Intronic
938125793 2:128670526-128670548 CCGCTGACACCCCAGGGATGGGG - Intergenic
938706032 2:133927882-133927904 CCTCTGCCACCCCAGTGGTGGGG + Intergenic
938768334 2:134478941-134478963 CCCCTTCCACCCCAGGATGAGGG - Intronic
939252290 2:139697402-139697424 CCTTTTCCCCCCCCGGAATGAGG + Intergenic
941300281 2:163792614-163792636 TCTCTTCCACACGAGGAAAGTGG + Intergenic
941501798 2:166288285-166288307 CTTTTTCCACACCAGAAATGAGG + Intronic
942459702 2:176160467-176160489 CCGCGTCTGCCCCAGGAATGGGG + Intronic
942715457 2:178886451-178886473 CCTCTGCCACCCCCAAAATGAGG + Intronic
943455327 2:188099875-188099897 CAACTTCAACCGCAGGAATGGGG - Intergenic
945202456 2:207296404-207296426 CCTCTCCCAGCTCAGGAAGGTGG + Intergenic
945431553 2:209771635-209771657 CCTCTTCAGCCCCCGGAATTCGG - Intergenic
946330223 2:219004732-219004754 CATCTGCCAGCCCTGGAATGGGG + Intronic
946481947 2:220065865-220065887 CCTCTTCCCCACCTGGAAAGAGG - Intergenic
948173490 2:235925215-235925237 CCTCGTCTACTCCAGGAAGGAGG + Intronic
948980344 2:241491317-241491339 CCTCTTCCCGCCCAGGCATGAGG - Intronic
1168834681 20:870178-870200 CCTCTTCCATGCCAGGACTCAGG - Exonic
1173084995 20:39907584-39907606 CCTCCCTCACCCCAGGAATAGGG - Intergenic
1174397920 20:50259251-50259273 CCCCTCCAACCCCAGGAGTGGGG + Intergenic
1174534669 20:51241696-51241718 TCTCTCCCACCCCTGGACTGTGG + Intergenic
1176372631 21:6071607-6071629 CCTCTGCAACCATAGGAATGCGG + Intergenic
1177940779 21:27409122-27409144 CTTCTTCCACCACATGACTGTGG + Intergenic
1179176066 21:39009200-39009222 CCACTTCCACACAAGGCATGGGG + Intergenic
1179750845 21:43466638-43466660 CCTCTGCAACCATAGGAATGCGG - Intergenic
1182228628 22:28819628-28819650 CCCCCTCCAACCAAGGAATGGGG - Intergenic
1183750085 22:39714940-39714962 CCTCTTCCACAGCAGGGAAGGGG - Intergenic
950144235 3:10636363-10636385 CCTCCTGCAGCCCAGGAAGGAGG - Intronic
952423735 3:33153707-33153729 CCTTTTCCAACCCAGGCTTGTGG + Exonic
953216318 3:40922258-40922280 CCTTTGCCACCTCAGGACTGGGG - Intergenic
953493018 3:43365726-43365748 CCTCCTCCACCTCAGAGATGGGG - Intronic
953610064 3:44440069-44440091 CAGCTGCCACCCCAGGACTGGGG - Exonic
954361884 3:50126491-50126513 CCCCATGCACTCCAGGAATGTGG - Intergenic
954963697 3:54591199-54591221 ACTTTTCCACCCTAGGAATTTGG - Intronic
955062548 3:55505823-55505845 CCTCTCCCACCTCAGGGTTGGGG + Intergenic
956615770 3:71170974-71170996 CTTCTTCCAAACCAGGAAGGCGG + Intronic
957720633 3:83993493-83993515 ACTCTTCCAAACCATGAATGTGG + Intergenic
959088607 3:101878143-101878165 CTTATTCAGCCCCAGGAATGAGG - Intergenic
959496172 3:107054747-107054769 CCCCTTCCACAGCAGCAATGAGG + Intergenic
960054563 3:113267971-113267993 CTGCTTACACCCCAGAAATGGGG - Intronic
960078974 3:113520315-113520337 AGTCTTCCAACCCACGAATGAGG - Intergenic
961272497 3:125699619-125699641 CCTCTTCCACCCTGGATATGAGG + Intergenic
961439920 3:126946537-126946559 CCTCTCCCACCTGAGGGATGGGG + Intronic
962396541 3:135019331-135019353 CGGCTTCCACCCCAGGACTCTGG + Intronic
965385247 3:168038042-168038064 GCTCTTCCACCCCAAGAGTGAGG + Intronic
965622387 3:170654635-170654657 CCTCTTCCACCCCAGGAATGGGG + Intronic
966355241 3:179072258-179072280 CCACTTCCGCCCCAGGATGGAGG + Exonic
966450799 3:180059105-180059127 CTTCTTCCACTCCAGGAAAGAGG + Intergenic
971126634 4:23761760-23761782 CCACTTCCACCCCATGATTCTGG - Intronic
971606706 4:28667232-28667254 CCTCCTTCCCCCCAGGTATGAGG + Intergenic
972640849 4:40923663-40923685 CCTCTTCCCCTGAAGGAATGAGG - Intronic
972780483 4:42282902-42282924 CCCCTTCCAGCCCAGGATTAGGG + Intergenic
974194467 4:58554093-58554115 CCTCCTCTACCCCACAAATGGGG + Intergenic
974898060 4:67963306-67963328 CCTCTTACACATCAGGAATCCGG + Intronic
975746186 4:77477312-77477334 GTTCTTCCAACCCAGGAGTGTGG - Intergenic
975816591 4:78223266-78223288 CATCTTCACCCCCAGGGATGTGG - Intronic
976011762 4:80497152-80497174 CCTCTGCCACCCCAGTAGTTAGG - Intronic
979218352 4:118193091-118193113 CCTCTTCTACCCCTGGAAAATGG + Intronic
980075091 4:128286978-128287000 CCCCATCCATCCCAGGAATCAGG + Intronic
980855167 4:138431350-138431372 CCTCCTCCACCCAAGGGAAGTGG + Intergenic
982265049 4:153530821-153530843 CCTCTGCCACATCAGGAAAGTGG - Intronic
985840152 5:2299972-2299994 CCTCTTCCACTCCAGCAGTGCGG + Intergenic
988453042 5:31362353-31362375 ACACTTCCACTCCAGGATTGGGG + Intergenic
988683357 5:33503914-33503936 CCTCTTCCACTCCCAGCATGGGG + Intergenic
989102426 5:37835173-37835195 CCGATTGCCCCCCAGGAATGGGG - Intronic
991561516 5:67958514-67958536 ACACTTCCACTCCAGGAACGTGG - Intergenic
993020520 5:82585257-82585279 CCTCTCCCACCCCAGGGAGGTGG - Intergenic
993816813 5:92558728-92558750 CCTCCTGCACTGCAGGAATGAGG - Intergenic
994833715 5:104820441-104820463 CCTCTTCCACCTCAGCAGTAGGG - Intergenic
996085909 5:119305005-119305027 CCTCCTCCCTCCCAGGAATGTGG - Intronic
996342534 5:122454502-122454524 CCTTTCCCACCCCAGGCATTGGG - Intronic
996709088 5:126526127-126526149 CCTCTTCTACAGCAGGAAGGAGG - Intergenic
997184373 5:131866677-131866699 CCTCTTCAGCCCCAGGAGGGAGG + Intronic
1001564847 5:172693293-172693315 CATGTTCCACCCCAGAAATTTGG - Intergenic
1001697873 5:173685822-173685844 CCTCCTCCACCCCAGTCAAGTGG + Intergenic
1004577385 6:16910220-16910242 CCTCTGCAACCACAGGGATGAGG + Intergenic
1005360579 6:25027642-25027664 CCTCTTTCTCCCCAGCACTGGGG - Intronic
1005438648 6:25841212-25841234 CCTCTTCCCCACCAGGACTTTGG - Intronic
1008641984 6:53473808-53473830 CCACTACCACCCCAGGCTTGTGG + Intergenic
1010038327 6:71352343-71352365 CCCCTCCTACCCCAAGAATGAGG + Intergenic
1011149326 6:84252794-84252816 CCACTTCCAGCCCAGAAATGGGG - Intergenic
1013080053 6:106804622-106804644 CCTGTTTCTCTCCAGGAATGCGG - Intergenic
1013415673 6:109922425-109922447 CCTGTTCCACGCCAGGAAGAAGG - Intergenic
1013949047 6:115757267-115757289 CCTCTGCCTCCCAAGTAATGGGG - Intergenic
1015456935 6:133436937-133436959 CCTCTTCAAACCCAAGAAAGGGG - Intronic
1015683886 6:135837908-135837930 CCTCTACCACCCCCGCAATGTGG + Intergenic
1016335571 6:143001420-143001442 CCACTACCTGCCCAGGAATGTGG - Intergenic
1016561964 6:145406243-145406265 CATCTTCCACAACAGGAAGGTGG + Intergenic
1016756985 6:147697956-147697978 CATCTCCCACCCCAGGACTCTGG - Intronic
1017874610 6:158514453-158514475 GCTCTTCCGTCCCAGGATTGTGG + Intergenic
1019142374 6:169956918-169956940 CCTATTCCCCCCCAGACATGGGG - Intergenic
1019636479 7:2078736-2078758 CCCCTTCCTCCTCAGGGATGTGG - Intronic
1021596671 7:22324625-22324647 CTTCTTCCTCCCCACAAATGTGG + Intronic
1022853657 7:34293876-34293898 CCATTACCACCCCAGGAGTGGGG + Intergenic
1023980914 7:45069483-45069505 CCTATCCCAGCCCAGGAAAGAGG - Intronic
1024315224 7:48009852-48009874 CCTGTTCCTCACCTGGAATGGGG + Intronic
1025239058 7:57256586-57256608 GCTCCTCCCACCCAGGAATGCGG + Intergenic
1028046067 7:86120479-86120501 CCTCTCCCAGCTCAGTAATGTGG - Intergenic
1029514523 7:101017322-101017344 CCGCTTCCACCCCGTGCATGTGG + Intronic
1031134601 7:117872469-117872491 CCTTTTCCACCCAGGAAATGTGG + Intronic
1031479574 7:122261924-122261946 CCTCAACCACCCCATGAATTGGG - Intergenic
1033482644 7:141757408-141757430 CCTCTTCCACCCCTGCATTCAGG - Intronic
1033601360 7:142891287-142891309 CACCTCCCACCCCAGGGATGGGG + Intergenic
1034707009 7:153154833-153154855 CCTCTGCCACCTCAGAGATGAGG - Intergenic
1035309268 7:157954723-157954745 CCACTTCCACCCCTGAAAAGGGG - Intronic
1035476732 7:159149226-159149248 CCCCTCCCACCCCAGGCAGGTGG + Intergenic
1035592222 8:824774-824796 TCTCCTGCACCCCAGGGATGTGG + Intergenic
1036666565 8:10747441-10747463 CGTCTTCCAGGCCATGAATGTGG + Intronic
1040067745 8:43161909-43161931 CCTCTGCCAGCCCAGGCATCTGG + Intronic
1040898104 8:52389548-52389570 CTCCTTCCACCCTAGGCATGAGG + Intronic
1041124653 8:54622883-54622905 CCTCTTCAGGCCCAGGGATGTGG + Intronic
1041172239 8:55156078-55156100 CCGCTTCAAACCCAGGAAGGTGG + Intronic
1045008110 8:97933535-97933557 CCTATTCGACACCAGGATTGCGG - Intronic
1045112725 8:98949231-98949253 CCTATTCCACCCCAAGCAGGGGG + Exonic
1046326555 8:112654771-112654793 CCCATTCCACCCAAGGTATGTGG - Intronic
1047915022 8:129573757-129573779 CTTCTTACCCCTCAGGAATGCGG - Intergenic
1048801374 8:138197448-138197470 CCTCCTCCACACAAGGGATGGGG - Intronic
1048946863 8:139456744-139456766 CCTCTTTGATCCCAGGAATGAGG - Intergenic
1049475085 8:142793601-142793623 CCTCCTCCACCCAAGTCATGTGG - Intergenic
1049509853 8:143021977-143021999 CATCATCCACCCCAGAAGTGAGG - Exonic
1049562227 8:143317542-143317564 CCTCCTCCTCCCCAGGACTCTGG + Intronic
1049774331 8:144397591-144397613 CCTCTTCAGCCCCAGCAAGGAGG - Exonic
1049831663 8:144704847-144704869 CCTCTCCCACCCCCGGAGTTTGG - Intergenic
1049974130 9:845724-845746 CTCCCTCCACCCCAGGAATCAGG + Intronic
1050027863 9:1354492-1354514 CCTCTTACCCCTCAGGACTGTGG + Intergenic
1051600319 9:18865889-18865911 GCATTTCCACCCCAGGAAAGAGG - Intronic
1052243117 9:26298999-26299021 CTTCTTCCACTCCTGGAATCTGG + Intergenic
1052761489 9:32596752-32596774 TCTCTTCCACCACAGGAACTTGG - Intergenic
1053393339 9:37751817-37751839 CCTCGGCCATCCCAGGAAGGGGG - Intronic
1055563847 9:77548839-77548861 CCTCAACCACCCCAGAAGTGTGG + Intronic
1055817088 9:80219521-80219543 CCTCATCTACCCCAGGTGTGAGG + Intergenic
1056547844 9:87627698-87627720 ACTCTTCAACCACAGGAGTGTGG + Intronic
1057300761 9:93880265-93880287 CATCTACCACCCAAGGACTGAGG + Intergenic
1057389306 9:94629636-94629658 CCCCTACCTCCCCAGGAGTGGGG - Intronic
1057560858 9:96126927-96126949 CACCTTCCACCCCAGGTCTGCGG + Intergenic
1057851185 9:98568120-98568142 CCCCTTCCACCAAAGGAGTGGGG + Intronic
1058352443 9:104041818-104041840 CTGCTTCCACCCAATGAATGAGG + Intergenic
1059670032 9:116482889-116482911 CATCCCCCACCCCAGGAATCAGG + Intronic
1062488260 9:136791696-136791718 CCTCTGCCACCCCAGGGACTCGG + Exonic
1062540594 9:137040148-137040170 CCCCTGCCACCCCAGGGCTGAGG - Intronic
1185642908 X:1598303-1598325 GCTCTGCCACCCCAAGAAGGGGG - Intronic
1186785168 X:12950391-12950413 CATCTTACACACCAGGAAAGAGG - Intergenic
1187235997 X:17468008-17468030 CCACTGCCACCCCAGGGATTTGG + Intronic
1187386400 X:18852530-18852552 GCTCTTCCTGCCCAGGAATAGGG - Intergenic
1190358476 X:49627330-49627352 CCGCTTCCACCCCATGCAAGTGG + Intergenic
1190447138 X:50537512-50537534 GTTCTTCCACCCCAGGAGTCAGG - Intergenic
1194247581 X:91534934-91534956 CCTCCCCCACCCCAGGCTTGGGG - Intergenic
1194574619 X:95596628-95596650 CCACCTCCACCCCAGCCATGAGG - Intergenic
1196714962 X:118801984-118802006 TCTCATCTACCCCAGGGATGAGG - Intergenic
1196908538 X:120462763-120462785 GCTCTTCCACTCCAGGAATGGGG - Intronic
1197348081 X:125348727-125348749 GCTCTTCCACCTTAGGAATTAGG + Intergenic
1197612432 X:128654297-128654319 TTTCTTCTACCCCAAGAATGGGG - Intergenic
1198185050 X:134246706-134246728 TCACTTCCACCCAAGGATTGAGG - Intergenic
1198958333 X:142156566-142156588 CCTCTTCCACCCCAAGAACTTGG - Intergenic
1200092000 X:153640355-153640377 CCTCTTCATCCCCAGGGCTGGGG - Intergenic
1200101299 X:153690141-153690163 CCTCTGCCACCCAGGGAATAGGG + Intronic
1200566603 Y:4776467-4776489 CCTCCCCCACCCCAGGCTTGGGG - Intergenic
1200687686 Y:6271937-6271959 CCTCATCCTCACCAGAAATGAGG + Intergenic
1200895011 Y:8366293-8366315 CAACTTCTACCCCAGGATTGAGG + Intergenic
1201047584 Y:9902766-9902788 CCTCATCCTCACCAGAAATGAGG - Intergenic
1201780922 Y:17721971-17721993 TCTCTTCGACCCAAGGAATATGG + Intergenic
1201820631 Y:18184019-18184041 TCTCTTCGACCCAAGGAATATGG - Intergenic