ID: 965622520

View in Genome Browser
Species Human (GRCh38)
Location 3:170655551-170655573
Sequence TGGTACAGGCTGATGGTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 120}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965622501_965622520 29 Left 965622501 3:170655499-170655521 CCACCCCTTCGCTCCTGGAAGGT 0: 1
1: 0
2: 2
3: 20
4: 162
Right 965622520 3:170655551-170655573 TGGTACAGGCTGATGGTACAAGG 0: 1
1: 0
2: 0
3: 9
4: 120
965622506_965622520 24 Left 965622506 3:170655504-170655526 CCTTCGCTCCTGGAAGGTTGGGA 0: 1
1: 0
2: 0
3: 6
4: 123
Right 965622520 3:170655551-170655573 TGGTACAGGCTGATGGTACAAGG 0: 1
1: 0
2: 0
3: 9
4: 120
965622511_965622520 16 Left 965622511 3:170655512-170655534 CCTGGAAGGTTGGGATTGGGGGG 0: 1
1: 0
2: 0
3: 36
4: 310
Right 965622520 3:170655551-170655573 TGGTACAGGCTGATGGTACAAGG 0: 1
1: 0
2: 0
3: 9
4: 120
965622504_965622520 25 Left 965622504 3:170655503-170655525 CCCTTCGCTCCTGGAAGGTTGGG 0: 1
1: 0
2: 0
3: 5
4: 128
Right 965622520 3:170655551-170655573 TGGTACAGGCTGATGGTACAAGG 0: 1
1: 0
2: 0
3: 9
4: 120
965622502_965622520 26 Left 965622502 3:170655502-170655524 CCCCTTCGCTCCTGGAAGGTTGG 0: 1
1: 0
2: 0
3: 18
4: 205
Right 965622520 3:170655551-170655573 TGGTACAGGCTGATGGTACAAGG 0: 1
1: 0
2: 0
3: 9
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965622520 Original CRISPR TGGTACAGGCTGATGGTACA AGG Intronic
902082255 1:13829117-13829139 TGGTTAAGGCTGAAGTTACAAGG + Intergenic
906810936 1:48826357-48826379 TAGTTCATGGTGATGGTACATGG - Intronic
907159969 1:52362537-52362559 GGGCACAGGCTGGTGGTAGAGGG - Intronic
907183010 1:52587334-52587356 TGGTACTCACAGATGGTACAAGG + Intergenic
911255088 1:95624050-95624072 TGGTACATTCTACTGGTACAGGG + Intergenic
912533314 1:110341730-110341752 TGGGAGAGGCTGATGCCACAGGG - Exonic
916783886 1:168068264-168068286 TGGTACTGGCTGATTGTTTACGG + Intronic
1069657654 10:70102054-70102076 TGGCACTGACTGAGGGTACAAGG - Intronic
1069903908 10:71721108-71721130 TGGTGCAGGCTGCTGGAGCAGGG + Intronic
1072472956 10:95731419-95731441 TGGTGAGGGCTGAGGGTACATGG - Intronic
1077430250 11:2512703-2512725 TGGTCCAGCCTGCTGTTACAGGG + Intronic
1079523914 11:21362295-21362317 TGCTCCAGGCTGGTGGTAGAGGG + Intronic
1080636243 11:34126018-34126040 TGCTACAAGCTGATGGGCCAGGG - Intronic
1081203848 11:40251368-40251390 TGATACAAACTGAAGGTACAAGG + Intronic
1087073633 11:94106940-94106962 TGGTACAGCTTGATGCTAGAGGG - Intronic
1087808346 11:102581011-102581033 AGATACAGTCTGATGGTACTGGG + Intronic
1088821336 11:113460299-113460321 TGCCACAGGCTGATGGAACAGGG + Intronic
1094789267 12:33891906-33891928 TTTTACTGGATGATGGTACAGGG + Intergenic
1097018511 12:56004036-56004058 AGGTACAGGCAGATGGTTCCGGG - Exonic
1102689056 12:114746298-114746320 TGGTACAGGATGATGTTATGGGG + Intergenic
1103977848 12:124715326-124715348 TTGTACAGGGTGATGGCACAGGG + Intergenic
1114349082 14:21830083-21830105 TGGTACAGGCTGCAGGTGCTGGG - Intergenic
1114359152 14:21950665-21950687 TGGTACAGGCTGCAGGTGCTTGG - Intergenic
1120910169 14:89659075-89659097 TAGTACAGGCTTAGAGTACAGGG + Intergenic
1121411807 14:93753433-93753455 TGGGAGGGGCAGATGGTACAGGG + Intronic
1122365646 14:101193489-101193511 TGGACCAGGCTGAAGGGACAGGG - Intergenic
1124854908 15:33378317-33378339 TGGGACAGGCAGAGGGGACATGG - Intronic
1127525592 15:59789752-59789774 TTTTACAGGCTCATGGTAGAAGG + Intergenic
1129047989 15:72753968-72753990 TGGTGCAGGCTGCTGGTAGTTGG + Intronic
1129687668 15:77695802-77695824 GGGGACAGGCTGATGGTGCTGGG - Intronic
1132318062 15:100904736-100904758 TGGGTCAGGCTGGTGGCACAGGG + Intronic
1132906494 16:2285255-2285277 GGGTAAAGGCTGAGGGTGCAGGG + Intronic
1133329142 16:4960571-4960593 TGTTACAGGCAGATGGTTCTAGG + Intronic
1133416357 16:5610160-5610182 TGGGACAGACTGATGGTAACGGG - Intergenic
1134035971 16:11031789-11031811 TGGGGCAGGCTGAGGGTAGAGGG + Intronic
1134068174 16:11243105-11243127 TGATACACGCTGATGTTTCAAGG - Intergenic
1135391113 16:22094126-22094148 TGGTGCAGGCTGATGGAGAAGGG - Intronic
1140113271 16:72021337-72021359 TGGGACAGGCTGGTGGGACAGGG - Intronic
1150285280 17:63950622-63950644 AGGCTCAGGCTGATGGTGCAGGG + Intronic
1155849463 18:30752817-30752839 TGGTACAGGCAGATGCTAGCAGG - Intergenic
1157175700 18:45450001-45450023 TGAGACAGGCAGATGGTTCATGG - Intronic
1158810778 18:61031476-61031498 AGGTAAAGGCTGATGGTATGTGG - Intergenic
1168241227 19:55089851-55089873 TGGTGCAGGCAGATGGTTGAAGG - Intergenic
925000191 2:398781-398803 TGGAACAGGCTGGGGTTACATGG + Intergenic
925000224 2:398911-398933 TGGAACAGGCTGGGGTTACATGG + Intergenic
925000250 2:399015-399037 TGGAACAGGCTGGGGTTACATGG + Intergenic
925000302 2:399223-399245 TGGAACAGGCTGGGGTTACATGG + Intergenic
925000315 2:399275-399297 TGGAACAGGCTGGGGTTACATGG + Intergenic
925000352 2:399431-399453 TGGAACAGGCTGGGGTTACATGG + Intergenic
925000402 2:399639-399661 TGGAACAGGCTGGGGTTACATGG + Intergenic
925000415 2:399691-399713 TGGAACAGGCTGGGGTTACATGG + Intergenic
925000452 2:399847-399869 TGGAACAGGCTGGGGTTACATGG + Intergenic
925000517 2:400107-400129 TGGAACAGGCTGGGGTTACATGG + Intergenic
925000572 2:400314-400336 TGGAACAGGCTGGGGTTACATGG + Intergenic
925000610 2:400470-400492 TGGAACAGGCTGGGGTTACATGG + Intergenic
925000623 2:400522-400544 TGGAACAGGCTGGGGTTACATGG + Intergenic
925000636 2:400574-400596 TGGAACAGGCTGGGGTTACATGG + Intergenic
925000649 2:400626-400648 TGGAACAGGCTGGGGTTACATGG + Intergenic
925000674 2:400729-400751 TGGAACAGGCTGGGGTTACATGG + Intergenic
925000699 2:400832-400854 TGGAACAGGCTGGGGTTACATGG + Intergenic
925000712 2:400884-400906 TGGAACAGGCTGGGGTTACATGG + Intergenic
925768326 2:7259167-7259189 TGGCTCAGGCTGCTGGTCCAGGG - Intergenic
926233154 2:11019969-11019991 TGGTACAAGCTGATGGGGCAGGG + Intergenic
935538001 2:104316783-104316805 TGGTATAGGCTATTGGTACTAGG + Intergenic
940980058 2:159991406-159991428 TGGGACAGGCTGAAAGTGCAGGG + Intronic
948903069 2:240965859-240965881 TGGCCCAGGCTGAGGGTGCAAGG + Intronic
948937649 2:241178054-241178076 TGGCACAGGCTGCTTGTGCAGGG - Intronic
1169139341 20:3218295-3218317 TGGCACAGGCTGACGATACAAGG - Intronic
1170587110 20:17743057-17743079 TGGTAAAGGGTGTGGGTACAAGG - Intergenic
1171333563 20:24362358-24362380 TGGTGCAGGCTGTGGGGACATGG - Intergenic
1173557121 20:43974103-43974125 TGCTGCAGGCTGAGGGTCCAGGG + Intronic
1175647693 20:60689006-60689028 TGGTAAAAGATGCTGGTACATGG - Intergenic
1180144240 21:45910407-45910429 TGGGACAGGCCGATGGCTCAGGG - Intronic
1183005230 22:34895681-34895703 TGGTACAGGATGTAGGAACAGGG + Intergenic
1184664038 22:45978182-45978204 TGCTGCAGGCGGATGGGACAGGG + Intergenic
954110960 3:48432807-48432829 TGGTACATGCTGCTGGGCCAGGG - Exonic
955954016 3:64269717-64269739 TGTTACAAGCTCATGGTAAAAGG - Intronic
957857745 3:85899762-85899784 TGGTTCTGGCTGATGGTAATAGG + Intronic
958952937 3:100436006-100436028 TAGTAATGGCTGATGGAACAAGG + Intronic
962027885 3:131567830-131567852 AGGTACAGGCTAATGCTAGAAGG + Intronic
963685325 3:148426257-148426279 TGCTTAAGGCTGATGGTATAGGG + Intergenic
964630594 3:158805668-158805690 TAGTAAATGCTGATGGTATAAGG + Intronic
965155076 3:165041397-165041419 TGATAAAGGCTGTGGGTACAAGG - Intronic
965622520 3:170655551-170655573 TGGTACAGGCTGATGGTACAAGG + Intronic
970741888 4:19249437-19249459 AGGTACAGGCAGATGCTGCAGGG + Intergenic
971287412 4:25303817-25303839 TGATACAGGCAGATTGTACTGGG + Intergenic
978765295 4:112399148-112399170 TGGTACAGGCTGAGTGTCCCTGG + Intronic
982226274 4:153170409-153170431 AGCTTCAGGCTGATGGTGCAGGG + Intronic
983952604 4:173660559-173660581 TTGTACAAGCTCATTGTACAAGG + Intergenic
985869782 5:2545181-2545203 TGGTACAGTCTGAGTGTGCAGGG + Intergenic
987316603 5:16730364-16730386 CGGTACAGTCTGTTGGTAGATGG + Intronic
988507205 5:31833883-31833905 GGGTACAGGTTGATGGGCCAAGG - Intronic
991471269 5:66971362-66971384 TGGCCCAGGCTGAGGGAACAAGG - Intronic
993929271 5:93917924-93917946 TGGTACAGGGAAATGGGACAAGG - Intronic
994474095 5:100245354-100245376 AGGTACAGGCAGAAGCTACATGG - Intergenic
996818432 5:127598740-127598762 TGCTAGAGGCTGATGGTGTATGG - Intergenic
999803236 5:155057304-155057326 AGGTACAGGAAGAAGGTACAGGG - Intergenic
1002573284 5:180156223-180156245 AGGTGCATGCTGATGGTGCAAGG + Intronic
1006338838 6:33434773-33434795 TGGAACAGACTGATGATGCAGGG + Intronic
1008099192 6:47372917-47372939 TTCTACAGGCTGTTGGTTCATGG - Intergenic
1010824133 6:80452100-80452122 TGGTACAGTCTGGTGGCAGAGGG + Intergenic
1017015484 6:150096188-150096210 TGCAACAGGCTAATGGTACCTGG - Intergenic
1018863863 6:167732590-167732612 TGGCACAGGCGGAAGGTACTTGG - Intergenic
1019036889 6:169068719-169068741 TGGCAGAGGCTGGTGGTACGGGG + Intergenic
1020073570 7:5243160-5243182 TGGCAGAGGCTGAGGGAACAGGG + Intergenic
1022625678 7:32033586-32033608 TGGTTCAGGGTGAAGATACAAGG - Intronic
1022907557 7:34871568-34871590 TTTTACAGGCTGATGGTGGAAGG - Intronic
1023351396 7:39323498-39323520 AGGTAGAAGCTGATGGTGCATGG - Intronic
1024040173 7:45546962-45546984 GGGTACAGGATAATGGTAGAAGG - Intergenic
1029032241 7:97480851-97480873 CAGAACAGGCTGATGGTACAAGG - Intergenic
1030470186 7:109953688-109953710 TGGAACAGGCTGATTCTAGAGGG + Intergenic
1031970203 7:128059254-128059276 TGGTACAGGCAGCAGGTACTAGG - Intronic
1035855723 8:2974103-2974125 TGGTAGAGGATGATGGTAGAGGG + Intronic
1037078117 8:14747637-14747659 TGGTACAGGGAAAGGGTACAAGG + Intronic
1037493353 8:19416702-19416724 TGGTACAGGCTGTTGCTCCTAGG - Intronic
1038523441 8:28253019-28253041 TGATACAGGGTGATAGAACAAGG + Intergenic
1039228605 8:35418503-35418525 TGTTGCAGGCTGATGGAACCAGG + Intronic
1040023566 8:42761766-42761788 AGGTACAGGGTGATGGCACCAGG - Intronic
1043034313 8:75177777-75177799 TGGCTCAGGCTGCTGGTCCAGGG - Intergenic
1044897568 8:96908896-96908918 TGGGGCAGGCTGAGGGTAGAGGG - Intronic
1046821028 8:118634527-118634549 TGGTACAGGATGAAGGTTCTTGG + Intergenic
1050032349 9:1399816-1399838 TGATACATGCTGAGTGTACAGGG + Intergenic
1053095641 9:35325741-35325763 TGCTACAGGCTGGTGGAAAAGGG - Intronic
1054821741 9:69528716-69528738 TGGTACAGATTGATTGTACCTGG - Intronic
1060169222 9:121447255-121447277 AGCTACAGGCTGGCGGTACAAGG - Intergenic
1062458116 9:136649927-136649949 TGGTACATATTTATGGTACATGG + Intergenic
1186935482 X:14446113-14446135 TGCTACAGGCTGACTGTGCAAGG + Intergenic
1198028120 X:132728949-132728971 TGATACAGGCTGAAGGTGGAGGG - Intronic
1198500126 X:137236038-137236060 TGCTACAGGGTGATTGTACAGGG + Intergenic
1200032982 X:153311316-153311338 TGGTACAGGCACATGGTACTTGG - Intergenic