ID: 965624281

View in Genome Browser
Species Human (GRCh38)
Location 3:170671576-170671598
Sequence GTGAATAAATGAATGGACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 678
Summary {0: 1, 1: 0, 2: 5, 3: 83, 4: 589}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965624281 Original CRISPR GTGAATAAATGAATGGACTA AGG Intronic
900498136 1:2985870-2985892 GTGAATGAATGGATGGATGATGG - Intergenic
900498167 1:2986011-2986033 GTGAATGAATGGATGGAGGATGG - Intergenic
900763855 1:4490683-4490705 GTGAATAAATGAATGTCGGATGG + Intergenic
902158491 1:14509597-14509619 GTGAATGAGAGAATGGACTTAGG - Intergenic
903019573 1:20384663-20384685 GTGAAGAAAGGAATTGAATATGG - Intergenic
903231518 1:21925255-21925277 GTGAACAAATGAGTGGACAGAGG + Intronic
903234459 1:21940659-21940681 ATGAATGAATGAATGGACAAAGG - Intergenic
903516740 1:23916251-23916273 GTGAAGGAATGAATGAACGAAGG + Intergenic
903864987 1:26391595-26391617 ATGAATGAATGAATGAACAACGG + Intergenic
904059018 1:27692797-27692819 TTGGCTAAATGAATGGCCTATGG - Intergenic
904304526 1:29579293-29579315 TTGAATAAATGAATGGACCGAGG - Intergenic
906523703 1:46481761-46481783 GTAATTAAATGCATGGACTCTGG - Intergenic
906873156 1:49506721-49506743 GTAATTAAAAGAATGGAATATGG + Intronic
906938184 1:50232860-50232882 ATGAATAAATGAATGAATTTTGG + Intergenic
907114002 1:51952669-51952691 ATGAATAAAGGAATGAACAAAGG + Intronic
907592030 1:55684404-55684426 CTGAATAAATGAGTGAACTGGGG - Intergenic
907822583 1:57985559-57985581 GTGAATAAATAACTGGTGTAAGG + Intronic
907833056 1:58083467-58083489 CTGAATAATGGAATGGACAAAGG + Intronic
908400654 1:63770058-63770080 GTGATTAAGAGAATGGACTCGGG - Intergenic
908965666 1:69759214-69759236 ATGAATAAATGAATATACTTAGG - Intronic
909111630 1:71485813-71485835 GTGAATGAATAAATAAACTAAGG - Intronic
909260262 1:73479730-73479752 GTGAATTACTGAATGGACACAGG + Intergenic
909491249 1:76229054-76229076 CTGATTATATGAATGGACAATGG + Intronic
910038327 1:82816348-82816370 GCAAATAAATAAATGGAGTATGG + Intergenic
910347502 1:86257186-86257208 ATGAATAAATTCAGGGACTATGG + Intergenic
911015399 1:93326511-93326533 GTGGAAGAGTGAATGGACTAAGG + Intergenic
911451522 1:98067658-98067680 GTGAATAAATTAATGTACTCTGG - Intergenic
911627331 1:100139517-100139539 ATGAAGAAATGAATGGAGGAAGG + Intronic
911715344 1:101126279-101126301 GTGAATAAATGAATAAATTAAGG + Intergenic
911807168 1:102224586-102224608 GTGAAAAACTGAATGGGCCAGGG + Intergenic
912380278 1:109243861-109243883 ATGAATACATGAATGGAGGATGG - Intergenic
912574216 1:110650140-110650162 AAGAATAAATGAATAGACAAAGG + Intergenic
913139769 1:115929280-115929302 GTGAATGAATGAATGCATAAAGG + Intergenic
915849252 1:159303519-159303541 GTGAATGAATGAGTGAATTATGG - Intronic
916578183 1:166085573-166085595 CTGAATGAATGAATGAACCAGGG + Intronic
918012420 1:180600300-180600322 GTGAATAAATGAAAGAATTAGGG + Intergenic
918319379 1:183350182-183350204 GTGAATAAATGAATGGGGAGAGG + Intronic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918823048 1:189284255-189284277 ATGAATAAATGAATGAAATAGGG - Intergenic
918904961 1:190479200-190479222 GCAAATAAATGAATGGAGTGGGG - Intergenic
920507700 1:206528103-206528125 GTGAAGAGATGAATAAACTATGG + Intronic
920722271 1:208398896-208398918 ATGAATGAATGAATGGATGATGG - Intergenic
921210019 1:212887016-212887038 AGGAATAAATGAATGAAATATGG + Intronic
921577156 1:216848718-216848740 GTGAATAATTGACTGCACTTCGG + Intronic
921768804 1:219008329-219008351 ATGAATAAGTGAATGGATAATGG + Intergenic
921893321 1:220374349-220374371 ATGAATAAATGAATAAGCTATGG + Intergenic
922720515 1:227897913-227897935 GTGAACAAATGATTGAACAAAGG + Intergenic
923236966 1:232043365-232043387 GTGAATAAATAAATAAACAATGG - Intergenic
923271392 1:232358301-232358323 GTGAGAAAATGAATTGACTGGGG + Intergenic
923384811 1:233455330-233455352 TTGGACAAATGAATGGGCTAAGG + Intergenic
923512627 1:234665539-234665561 GTGGTTAAAAGAATGGACTTTGG - Intergenic
923717721 1:236439227-236439249 GTGAATAGATAAATAGACTGTGG - Intronic
923823635 1:237475133-237475155 TTTAATAGATGAAGGGACTAAGG + Intronic
924031838 1:239893508-239893530 GTGAAGAAATGGATGTACCAAGG - Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
1063438323 10:6052464-6052486 CTGAATGAATGAATGAACAAAGG + Intronic
1063457693 10:6195833-6195855 GAGAATAAGTGAATGGAAAATGG - Intronic
1064126363 10:12664539-12664561 CTGAATGAATGACTGGACTCTGG + Intronic
1064606772 10:17050066-17050088 GAGAAGAACTGAATGGAGTAGGG - Intronic
1064642441 10:17428344-17428366 GTGAATGAATGAAAGTATTAGGG - Intronic
1064885037 10:20102444-20102466 GTGATTAGATTTATGGACTAAGG - Intronic
1064947464 10:20806768-20806790 GTGACTAAATGAATGAATGATGG + Intronic
1065343450 10:24726078-24726100 GTGAATAAAAGAATGGACTCTGG - Intergenic
1065371168 10:24987892-24987914 ATAAATAAATGAATGAACAAAGG + Intronic
1065526369 10:26625363-26625385 GTGAATGAATAAATGAACTGTGG - Intergenic
1065529958 10:26658944-26658966 GGGAATGAATAAATGAACTATGG - Intergenic
1066230820 10:33431270-33431292 ATGAATAAAAGAATGTACAAGGG + Intergenic
1066573410 10:36798928-36798950 ATGAATAAATGAATGAATGAGGG + Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067093849 10:43285753-43285775 GTGAATTAATGAATGGAGGGAGG + Intergenic
1067565512 10:47333437-47333459 GAGAATAATTGAATGAACTGTGG + Intergenic
1067692487 10:48510822-48510844 GAGACTAAATGACTTGACTAAGG - Intronic
1067780041 10:49195368-49195390 GTGAGCAACTGAATGGACTTTGG + Intergenic
1070580371 10:77714448-77714470 GTGAATGAATGAATGGTTGATGG - Intergenic
1071421744 10:85507144-85507166 ATGAATAAATAAATGAATTATGG - Intergenic
1071810627 10:89177108-89177130 GTGGGAAAATGAATGAACTACGG - Intergenic
1071815960 10:89232918-89232940 GTGAAGAAAGGAATGGCCTGTGG + Intronic
1072935694 10:99711029-99711051 GTGAATGCATGAATGGAAAATGG - Intronic
1073205422 10:101766896-101766918 CTGAATGAATGAATGGAATTAGG + Intergenic
1073543429 10:104330181-104330203 CTGAATACATGAATGGAGTTAGG + Intronic
1073840545 10:107494362-107494384 ATGAGTAAATGAATGAACAAAGG - Intergenic
1076091790 10:127692987-127693009 GTGAATGAATGAATGAATGAAGG - Intergenic
1076676720 10:132150900-132150922 ATGGATAAATGGATGGATTAAGG - Intronic
1077463441 11:2722272-2722294 GTGAAGATAGGAAAGGACTATGG + Intronic
1078120686 11:8505768-8505790 GTGAACAAATGAATGAAGGAAGG + Intronic
1078412618 11:11139352-11139374 GGGAATAAAGTAATGGAGTAAGG - Intergenic
1078450134 11:11434720-11434742 GTGAAAGAATGAAGGGAATAGGG + Intronic
1078548661 11:12264801-12264823 CTGAATAAATGAATGCATAAAGG - Intergenic
1078552218 11:12288679-12288701 CTGAATCAATGAATGAAGTAAGG + Intronic
1079602893 11:22331433-22331455 ATGGATAAATGAATGGAAGAAGG - Intergenic
1079748611 11:24165325-24165347 GTGAATAAATGTTTGGAAAAGGG - Intergenic
1079780859 11:24602437-24602459 GAAAATAAATAAATGCACTATGG + Intronic
1079978292 11:27120819-27120841 ATGAATAAATGAATGTACTGGGG - Intronic
1079980573 11:27147446-27147468 GTGAATGAATAAATAAACTATGG + Intergenic
1080108912 11:28543659-28543681 GTAAATAAATGTATGGAATCTGG - Intergenic
1080146308 11:28988480-28988502 GAGAATTAATGAATGGTATAGGG - Intergenic
1080453087 11:32394891-32394913 GGGAATAAATGAAGGCAATATGG - Intronic
1080873845 11:36259436-36259458 GTGAGTGAGTGAATGGACTTAGG - Intergenic
1081086278 11:38805446-38805468 AACAATAAATGATTGGACTATGG - Intergenic
1081154408 11:39671504-39671526 GTAAATAAATGAATAAACAAAGG + Intergenic
1084705318 11:70812990-70813012 GTGAATGAATGAATGGAGAAAGG - Intronic
1084849834 11:71929703-71929725 GTGAATAAATGCATGAATTCCGG - Intronic
1085032777 11:73282751-73282773 ATGAATGAATGAATGGAGGAGGG + Intronic
1085370218 11:75996358-75996380 ATGAATAAATGAATTGACAAAGG - Intronic
1085734426 11:79026949-79026971 GTGAGTAAGTGAGTGGGCTAGGG + Intronic
1086021215 11:82232053-82232075 TTGTATACATGAATGTACTAAGG - Intergenic
1086087806 11:82972515-82972537 GTGAATAAATGGATGGGTGAAGG + Intergenic
1086219307 11:84422206-84422228 ATGAATAAATGAATTGACTCTGG + Intronic
1086246802 11:84762670-84762692 ATGACTAAATGAATGGACACAGG - Intronic
1086576177 11:88341237-88341259 GTTAATAGATTAATGGATTATGG - Intergenic
1086928956 11:92671409-92671431 ATGAATTAATGAATGAATTATGG - Intronic
1087882903 11:103439780-103439802 CTGAATGAATGAATGAACAAAGG + Intronic
1088025174 11:105171104-105171126 GTGAATTAATGCAGGCACTATGG - Intergenic
1088884706 11:113997751-113997773 GGCAATGAATGAATGGACTGGGG + Intergenic
1089029407 11:115308836-115308858 TTGAATAAATGAATAAAATAAGG - Intronic
1089663854 11:120004289-120004311 GTGAATAGATGAATAAATTATGG - Intergenic
1089739554 11:120572964-120572986 GTGAATGAGTGAATGGAGTATGG - Intronic
1090138179 11:124222464-124222486 TTGAATAAATGAATGAATTGTGG - Intergenic
1090191132 11:124769678-124769700 TTGAATAAATGAGCAGACTAGGG + Intronic
1090237171 11:125157951-125157973 GTGAATAAATGAATGGATGAGGG + Intergenic
1090527261 11:127550916-127550938 ATGAATGAATGAATGAAATAGGG - Intergenic
1090544007 11:127741626-127741648 GTGAATAGATAAACAGACTATGG - Intergenic
1090544140 11:127744190-127744212 GTGAATGAATAAATGAACTATGG - Intergenic
1090675174 11:128985678-128985700 ATGAATGAATGGATGGACAAAGG - Intronic
1091442628 12:523282-523304 GTGAATGAATGAATGAAGGAAGG - Intronic
1091452546 12:582235-582257 GTGAATGAATGAATGGACGCAGG + Intronic
1091452550 12:582275-582297 GTGAATGAATGAATGGACGCAGG + Intronic
1091452554 12:582315-582337 GTGAATGAATGAATGGACGCAGG + Intronic
1091452559 12:582355-582377 GTGAATGAATGAATGGGCGCAGG + Intronic
1091452563 12:582395-582417 GTGAATGAATGAATGGACGCAGG + Intronic
1091452566 12:582431-582453 GTGAATGAATGAATGGACGCAGG + Intronic
1091452571 12:582471-582493 GTGAATGAATGAATGGGCACAGG + Intronic
1091452575 12:582511-582533 GTGAATGAATGAATGGACGCAGG + Intronic
1091452579 12:582551-582573 GTGAATGAATGAATGGACGCAGG + Intronic
1091452584 12:582591-582613 GTGAATGAATGAATGGGCGCAGG + Intronic
1091452589 12:582631-582653 GTGAATGAATGAATGGGCGCAGG + Intronic
1091452593 12:582671-582693 GTGAATGAATGAATGGACGCAGG + Intronic
1091452596 12:582707-582729 GTGAATGAATGAATGGACGCAGG + Intronic
1091452599 12:582743-582765 GTGAATGAATGAATGGACGCAGG + Intronic
1091452603 12:582783-582805 GTGAATGAATGAATGGACGCAGG + Intronic
1091452609 12:582823-582845 GTGAATGAATGAATGGGCGCAGG + Intronic
1091452615 12:582863-582885 GTGAATGAATGAATGGGCGCAGG + Intronic
1091452619 12:582903-582925 GTGAATGAATGAATGGACGCAGG + Intronic
1091452624 12:582943-582965 GTGAATGAATGAATGGGCGCAGG + Intronic
1091452629 12:582983-583005 GTGAATGAATGAATGGGCGCAGG + Intronic
1091452634 12:583023-583045 GTGAATGAATGAATGGGCGCAGG + Intronic
1091452639 12:583063-583085 GTGAATGAATGAATGGGCGCAGG + Intronic
1091452644 12:583103-583125 GTGAATGAATGAATGGGCGCAGG + Intronic
1091452659 12:583223-583245 GTGAATGAATGAATGGGCGCAGG + Intronic
1091695724 12:2626907-2626929 ATGAGTAAATAAATGGACGAAGG + Intronic
1091791045 12:3272373-3272395 ATGAATAAATGAATGAATGATGG - Intronic
1091825939 12:3512789-3512811 ATGAATAAGTAAATGAACTATGG + Intronic
1092836284 12:12492194-12492216 GAGAAAAAGTGAATGGACTGGGG - Intronic
1092841354 12:12544972-12544994 TGGAATAAATGAATGGATAATGG - Intronic
1093088319 12:14891516-14891538 GTGAAGACATGAAGGGAGTAGGG + Intronic
1093118568 12:15240925-15240947 GTGAATATATAAATGAATTAAGG - Intronic
1093126359 12:15333507-15333529 TTGAATAAATAAATGGAGTGAGG + Intronic
1093257812 12:16892901-16892923 GTGAATAGTTGAATGGAATGAGG - Intergenic
1093347302 12:18054068-18054090 GTGAATAAAATAATGGAATTAGG - Intergenic
1093957162 12:25233495-25233517 ATGAATGAATGAATGAACGAAGG + Intronic
1094156804 12:27346050-27346072 GTGAACAAATGAATGAGCTTGGG + Intronic
1094179593 12:27577787-27577809 TTGAGTAAATGAATGAACCACGG - Intronic
1094355590 12:29574194-29574216 GTGAATGAATGAATGGAGGAAGG - Intronic
1094615653 12:32034097-32034119 GTGAAGAAAGGACTGGACAAAGG + Intergenic
1095314944 12:40748657-40748679 GTGATTAAATGAATACACTGAGG - Intronic
1095604950 12:44055510-44055532 GTGAATAAAAGCATGGACTGTGG + Intronic
1095890504 12:47231326-47231348 GTGAAGAAATGACAGGACAAAGG + Intronic
1097395372 12:59066741-59066763 GTGATTAATTGAATGACCTAGGG - Intergenic
1097405337 12:59182417-59182439 CTGAATAAATGAGTGCAGTAGGG + Intergenic
1097757416 12:63422221-63422243 TTGAATAAATGAATGGATTAGGG - Intergenic
1098226322 12:68328921-68328943 ATGAAGGAAGGAATGGACTAGGG - Intronic
1098280125 12:68854278-68854300 CTGAATGAATGAATGAACAAGGG - Exonic
1099451160 12:82808557-82808579 ATGAAGAAATGAAAGGAGTAAGG - Intronic
1100423941 12:94464580-94464602 GTGAATGAATGAACAGACTATGG + Intergenic
1100705530 12:97196469-97196491 ATGAGTAAATGGATGAACTAAGG - Intergenic
1100963477 12:99988089-99988111 ATTAATAAAAGAAGGGACTAGGG + Intergenic
1101011700 12:100457430-100457452 GTGAATTAATGGATGAATTAGGG + Intergenic
1101201302 12:102439193-102439215 ATGAATAAATGAATGGAGAAGGG + Intronic
1101208384 12:102512029-102512051 GAGAATAAATGAAAGGTTTATGG + Intergenic
1102051225 12:109863499-109863521 ATGAGTGAATGAATGGACTGTGG + Intronic
1102456894 12:113076777-113076799 GTGCTTAAATTAATGAACTAAGG + Intronic
1103371453 12:120422659-120422681 ATGAATAAATGAATGAATAAAGG + Intergenic
1103728364 12:123010266-123010288 CTGAATGAATGAATGCACCAAGG - Intronic
1104340541 12:127944778-127944800 TTGAATAAATGTAAGGACTCAGG + Intergenic
1105786535 13:23755323-23755345 CTGAATAAATGAATGGCTGAAGG + Intronic
1105786537 13:23755363-23755385 CTGAATAAATGAATGGCTGAAGG + Intronic
1106107917 13:26750336-26750358 GTAAATAAATTAAAAGACTATGG + Intergenic
1107096342 13:36540993-36541015 ATGACAAAATGAATGGACTCAGG - Intergenic
1107404837 13:40102753-40102775 GTGAATAAACAAATTCACTAAGG - Intergenic
1107836957 13:44420070-44420092 ATGAATGAATGAATGGAAAAGGG - Intergenic
1108217218 13:48197139-48197161 GTTAATAGATGAATGAACTGTGG - Intergenic
1108436674 13:50407468-50407490 GTAAATACATGAATGGGCTTTGG - Intronic
1108468116 13:50739409-50739431 GTGAATCCATGAATGAACAAAGG + Intronic
1108869794 13:54969783-54969805 GTGAATAGATAAATAAACTATGG + Intergenic
1109117948 13:58413513-58413535 GTGAATAAATATATGCAGTAGGG + Intergenic
1109365097 13:61344177-61344199 TTGAATATATGAATGCACTTGGG + Intergenic
1109375115 13:61482623-61482645 GTGAATAAATAAATAAACTGTGG + Intergenic
1110615031 13:77532128-77532150 GTGAATAAATAAATAAACTGTGG + Intergenic
1110885799 13:80633460-80633482 GTGAAAAGATGAATGGAATTTGG + Intergenic
1110897709 13:80776143-80776165 GTGTTTAAATGAATGGAGAATGG - Intergenic
1112188791 13:97154772-97154794 CTGAATAAATAAATGGTATAAGG + Intergenic
1112218207 13:97458414-97458436 GTGAATAAATGAAGGGAAGAAGG + Intronic
1112727064 13:102317019-102317041 ATGAATTAATGAATGGAAAATGG - Intronic
1113090149 13:106609598-106609620 GTGAGAAAATAAATGGAATAGGG - Intergenic
1113456886 13:110455669-110455691 GCGAATGAATGAATGAGCTATGG + Intronic
1113525802 13:110974847-110974869 GAAAATAAATGAATGAACAAAGG - Intergenic
1113975352 13:114224162-114224184 GTGCATAAAGGAATGAAATAAGG - Intergenic
1114347422 14:21810903-21810925 ATGAATAAATGAATGGTCTTTGG - Intergenic
1114587764 14:23830146-23830168 CTGAATGAATGAAGAGACTAGGG - Intergenic
1115281831 14:31671790-31671812 GGGATTCAATGAATGGAATATGG + Intronic
1116143942 14:41038974-41038996 ATTAATAAATTAATGGAGTAGGG - Intergenic
1116477224 14:45354535-45354557 TTGTATAAATGAATGGACAAAGG + Intergenic
1116723405 14:48529569-48529591 GTGAATAAATAAATAAACTGTGG - Intergenic
1116846737 14:49871471-49871493 ATGAATGAATGAATGCACAAAGG - Intergenic
1116866323 14:50034647-50034669 GTGGTTAAATGTATGGACTCTGG + Intergenic
1116974220 14:51097510-51097532 ATGAATGAATGAATGAACAAAGG - Intergenic
1117419712 14:55532173-55532195 GTGAATAAATGAATGGTTCTTGG - Intergenic
1117474393 14:56079067-56079089 ATGAATAAATGAATGAATTCTGG + Intergenic
1118823964 14:69363683-69363705 ATGAATGAATGAATGGAATGAGG + Intergenic
1119737198 14:76990619-76990641 GTGAATGAGTGAATGAACTGTGG - Intergenic
1120499171 14:85272696-85272718 TTGAATAAATAAATGAACAATGG + Intergenic
1120734712 14:88040094-88040116 ATGAATGAATGAATGAATTATGG - Intergenic
1120890578 14:89487551-89487573 GTGGATAAATTAATGATCTAAGG - Intronic
1121398231 14:93646953-93646975 GTGAATGAATGAATGAATAAAGG - Intronic
1121449357 14:93997612-93997634 GTGAATAAATGCATGGATGGGGG + Intergenic
1121490796 14:94359048-94359070 TTGAATAAATGAAATGACCATGG + Intergenic
1121856003 14:97270815-97270837 GTGAAGAAATAAATGGAGTGAGG - Intergenic
1122320986 14:100855641-100855663 GTGAATGAATGAAGGGATGAAGG - Intergenic
1124395756 15:29300133-29300155 GTGAGTAAATGGATGGATAATGG + Intronic
1125007266 15:34831640-34831662 CTGAATATATGAATAGACTTGGG + Intergenic
1125348899 15:38747152-38747174 GAGAATATCTGAATGGAGTATGG - Intergenic
1125991198 15:44110005-44110027 GTGAATAAATAAATAAACCATGG - Intronic
1126022527 15:44416702-44416724 ATGAATGAATGAATGTTCTAAGG + Intergenic
1126491821 15:49245587-49245609 GTGACCAAATCAATGGCCTAGGG + Intronic
1128678704 15:69630536-69630558 GTGAATAAATGAATGACCGCAGG - Intergenic
1129047163 15:72745894-72745916 GTGAATAAATGAATAAACTGTGG + Intergenic
1129266100 15:74394008-74394030 ATGAATGAGTGAATGGATTAGGG + Intergenic
1129307517 15:74677859-74677881 GTGAATGGATGAATGAACTATGG + Intronic
1129604991 15:77020525-77020547 GTGACTAAATGGATGGAGGATGG - Intronic
1130204624 15:81864529-81864551 GTGAATGGATGAATAAACTATGG + Intergenic
1130353625 15:83111358-83111380 GTGAATAGATGGATGGATGATGG - Intronic
1130376954 15:83337826-83337848 ATGAATAAATGAATAGATGAAGG + Intergenic
1130396063 15:83502538-83502560 ATGAATAAATGAATGGGCCTGGG + Intronic
1130402872 15:83573752-83573774 ATGAATAAATAAATGAACAAAGG - Intronic
1130446858 15:84010477-84010499 ATGCATAAATGAATAAACTAGGG - Intronic
1130743028 15:86621730-86621752 GAGAATAAATAACTTGACTAAGG - Intronic
1132406828 15:101546798-101546820 ATGAATGGATTAATGGACTATGG + Intergenic
1133204914 16:4227449-4227471 GTGGATAAGTGAATGGATGATGG + Intronic
1134125778 16:11615064-11615086 GAGAATGAATGAATGAACAAAGG + Intronic
1134754907 16:16658402-16658424 TTGAATAAATTAATGTACTGGGG - Intergenic
1134991155 16:18700731-18700753 TTGAATAAATTAATGTACTGGGG + Intergenic
1135433498 16:22408037-22408059 ATGAATAAATGAATAGCTTATGG - Intronic
1135538601 16:23313141-23313163 ATGAATAAATGAATGAATGATGG + Intronic
1135940265 16:26816301-26816323 GTGAATGAATTAATGTCCTAGGG + Intergenic
1136533630 16:30886495-30886517 ATGAATACATGAATGGGCTGGGG - Intronic
1137397974 16:48130360-48130382 GTGAATAAATGAATGAATAAAGG + Intronic
1137569442 16:49555752-49555774 GTGAATAAATAAATGGATGGAGG + Intronic
1137608575 16:49803712-49803734 GTGAATGAATGAACAAACTACGG + Intronic
1137682189 16:50358547-50358569 GAGAGTAAATGAATTGCCTAAGG - Intronic
1137748823 16:50842978-50843000 ATGAATAAATGAATGAATGAAGG + Intergenic
1137751585 16:50864843-50864865 GTGAATAAAAGTCTGGACTTTGG + Intergenic
1138647695 16:58437206-58437228 ATGATTAAATGAATGGACTTTGG + Intergenic
1139422383 16:66856652-66856674 GTGAATAAGGGAAAGGACTTAGG - Intronic
1140308133 16:73822928-73822950 ATGAATAAATGCATGAACTAAGG - Intergenic
1140949646 16:79804509-79804531 GTGAATAAATGAGTAAACCATGG - Intergenic
1140970831 16:80010625-80010647 GTGAATAAAGGAATGGATGGTGG - Intergenic
1141385450 16:83619121-83619143 ATGAATGAATGAATGTACTTTGG - Intronic
1141761231 16:86029882-86029904 GTGAATGAGTGAATGAATTATGG - Intergenic
1142177862 16:88653146-88653168 GAGAGCAAATGAATGGACAAAGG + Intronic
1144102148 17:11951219-11951241 GGGAAAAAATGAATGCAGTATGG + Intronic
1144359026 17:14473803-14473825 GTGAATGGATGAATAAACTATGG - Intergenic
1144767832 17:17742447-17742469 GTGAATGAATGAATGAATAAAGG + Intronic
1145358539 17:22187710-22187732 ATCAATAGATGAATGGACAAAGG - Intergenic
1146545047 17:33731072-33731094 GTGAATGAGTGAATGGATGAGGG + Intronic
1147046607 17:37756955-37756977 ATGAATAAATGAATGTAATCTGG - Intergenic
1147844504 17:43395270-43395292 GTGAATTAATGAATGCATGATGG - Intergenic
1148229133 17:45920325-45920347 GTGAAGAAATGAGAGGACTCAGG - Intronic
1148241394 17:46001689-46001711 ATGAATAAAGGAATGAAATAAGG - Intronic
1149354202 17:55822964-55822986 GTGAATAAATGAATTAATTCAGG - Intronic
1149382789 17:56110646-56110668 GTGAATGAATGAATGAATGAAGG + Intergenic
1149420439 17:56505516-56505538 GTCAACAAAGGAATGGACTAAGG - Intronic
1149644038 17:58226566-58226588 GTGAATTAATTAATGAATTATGG - Intronic
1150150380 17:62804095-62804117 GCGATTATATGAATGGACCAGGG + Intronic
1150214284 17:63457986-63458008 TAGAATAAATAAATGGACTAGGG + Intergenic
1150450837 17:65266472-65266494 ATGAATAAATGAATAAAATAGGG - Intergenic
1151265086 17:72948854-72948876 GTAAATAAATGAATCCACAATGG + Intronic
1152324738 17:79629002-79629024 TTGAATCAATGAATGAACAAAGG - Intergenic
1152375189 17:79915182-79915204 GTGAATGAATGAATGAAGTGGGG - Intergenic
1152581493 17:81167331-81167353 GTGAATGAATGAGTGGATGAGGG - Intergenic
1152605841 17:81289623-81289645 ATAAATAAATAAATGGAATAAGG + Intronic
1153718832 18:7880680-7880702 GTGGAGAAATAAATGAACTACGG - Intronic
1155367602 18:25064012-25064034 ATGAATAAATGAATGAACATCGG - Intronic
1155388689 18:25309366-25309388 ATGAACAAATCAATGGACTAAGG + Intronic
1155499164 18:26470095-26470117 GTAAATAGATGAATGGAGTGAGG - Intronic
1155546207 18:26918635-26918657 GTGAATGAATGAATGGAATTAGG + Intronic
1158397675 18:57092248-57092270 ATGAATGAATGAATGAACGAAGG + Intergenic
1159336211 18:67070742-67070764 ATGAATAAATGAATGAAGAAGGG - Intergenic
1161433846 19:4250276-4250298 ATGAATAAATGAATGAATGAGGG - Intronic
1161498906 19:4602542-4602564 GTGGATGGATGAATGGATTATGG + Intergenic
1161498931 19:4602660-4602682 GTGGATAAATATATGGATTATGG + Intergenic
1162091584 19:8283771-8283793 GTCAATCAATGAATGGAGAAAGG - Intronic
1162093821 19:8298620-8298642 GTCAATCAATGAATGGAGAAAGG - Intronic
1162184602 19:8895080-8895102 GGCAATAAATGAATTGCCTAAGG + Intronic
1162203342 19:9037175-9037197 GTGAATAGATGAATAGAAGATGG + Intergenic
1162321281 19:9972286-9972308 GTGAATGAATGGATGAACGAGGG - Intronic
1164799946 19:31068076-31068098 TTGAATGAATGAATGAACAAAGG - Intergenic
1165476079 19:36032030-36032052 GTGAATGAATGAATTAACGAGGG + Intronic
1165649487 19:37473171-37473193 GTGAAGGGATGAATGGACTAGGG + Intronic
1165768602 19:38365570-38365592 GTGAATGAATGAAAGGAGTTAGG - Intronic
1166345951 19:42165938-42165960 ATGAATGAATGAATGAACAAAGG - Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1167704466 19:51071070-51071092 CTGAATAAATAAATGAACTATGG + Intergenic
1168330961 19:55568266-55568288 ATGAATAGATGGATGGATTATGG + Intergenic
1168330970 19:55568324-55568346 GTGAATGGATGAATGGATAATGG + Intergenic
925489250 2:4373838-4373860 ATGGATAAATGGATGGAATAAGG - Intergenic
926656508 2:15413090-15413112 GAGAATAAAGGAATGGGTTAGGG - Intronic
927136846 2:20103453-20103475 ATGAATAAATGAAATGATTATGG + Intergenic
927223761 2:20740657-20740679 GTGAATGAATAAATACACTACGG - Intronic
927806064 2:26147850-26147872 GTGAATGAATGAATGCATGAAGG + Intergenic
928638143 2:33269094-33269116 ATGAATGAATGAATGGAGTCTGG - Intronic
929292883 2:40213582-40213604 GTGAAGAAATGAAGGGACTTTGG - Intronic
929688800 2:44057650-44057672 ATGAACAGATGAATGTACTAGGG - Intergenic
930219078 2:48727308-48727330 ATGAATGAATGACTGGGCTAAGG - Intronic
930976175 2:57464356-57464378 GTTGATTAATAAATGGACTAAGG - Intergenic
931945016 2:67296768-67296790 ATGAATGAATGAATGAACAAGGG - Intergenic
932470767 2:71954051-71954073 GTGAATAAATAAATAAACTGTGG - Intergenic
932907021 2:75765177-75765199 GTCAATAAATGACTGGATGACGG + Intergenic
935415403 2:102811625-102811647 GTGAATAAATGAATAGGGAAAGG - Intronic
935494838 2:103767675-103767697 GTGAATACATGAATGAATTCTGG + Intergenic
935529050 2:104210524-104210546 ATAAATAAATGAATGGATAAAGG - Intergenic
935579912 2:104747624-104747646 GTGAAAAAATAAAAGGGCTAAGG - Intergenic
935637136 2:105257998-105258020 ATGAATGAATGAATGGAAAATGG + Intergenic
936906487 2:117541398-117541420 TTAAATACATGAATGAACTAAGG + Intergenic
937871042 2:126786488-126786510 GTGAGTAAATGAATGTGCCAAGG + Intergenic
938687054 2:133748824-133748846 ATGAATGAATGAATGGACACTGG - Intergenic
939116231 2:138064394-138064416 GTGAATAGAAGAATGGAATGGGG + Intergenic
939299870 2:140321599-140321621 TTGAATAAATAAATGGATTTTGG + Intronic
939780966 2:146446956-146446978 GTGAATAAATAAATAAACTGTGG - Intergenic
939922202 2:148129781-148129803 CTGAATAAGTGAATAGACAAAGG + Intronic
940098338 2:150004389-150004411 TTAAATAAATGGCTGGACTAAGG - Intergenic
940136147 2:150437606-150437628 GTGAATAAAGGAAAGGAGAAAGG + Intergenic
940597208 2:155810472-155810494 GGGAATAAGTGAGTGAACTAGGG - Intergenic
941517261 2:166494520-166494542 GTGAAGGAATGAAGGGGCTAGGG + Intergenic
941644346 2:168024161-168024183 GAGAAGAAATGGATGGACTGTGG + Intronic
942218021 2:173741608-173741630 ATGAATAAATGAATGGTTTGAGG - Intergenic
942672670 2:178392950-178392972 GTGAATAAGGGAATGGAGAAAGG - Intronic
942985284 2:182133795-182133817 GTGAATAAATGAATGAAGGCAGG - Intergenic
943041385 2:182809346-182809368 GTGAATGAATGAATGGGATAGGG + Intergenic
944125205 2:196284527-196284549 GTGAATAAAGCAAAGCACTAAGG - Intronic
945279925 2:208026348-208026370 CTGAATAAATGAATGAACAAAGG + Intergenic
945661814 2:212695467-212695489 GTGTGTAAATGTATGTACTATGG - Intergenic
945836260 2:214839070-214839092 GTGAGGAAATGAATGAAGTAAGG + Intergenic
945977654 2:216283255-216283277 ATGAATAAATGAATGCAGAAAGG - Intronic
946016088 2:216605278-216605300 ATGAATAAATGAATGGGCATTGG + Intergenic
947017697 2:225639646-225639668 GTGAATAAATGAATAAACCTGGG - Intronic
947722304 2:232377653-232377675 GTGAATCAATGAATTAATTAAGG + Intergenic
947973906 2:234347503-234347525 TTGAATAAATGAATTGCCTGTGG + Intergenic
948087070 2:235259749-235259771 CTGAATGAATGAATGGACCCAGG - Intergenic
948626264 2:239270235-239270257 GTGTAAAAATGAATGGATGACGG + Intronic
1169008044 20:2225335-2225357 TTGAATAAATGAATGAAGAATGG + Intergenic
1169696736 20:8397136-8397158 GTGAATACATTAATGCAGTAAGG - Intronic
1170152820 20:13243076-13243098 GTGATTAAAAGCATGGACTCTGG - Intronic
1170519320 20:17167553-17167575 GTGAATGCATGAATAAACTATGG - Intergenic
1171176833 20:23057581-23057603 TTGAATGAATGAATGGAATGTGG + Intergenic
1171358699 20:24570944-24570966 GAAAAAAAATGAATGAACTATGG + Intronic
1171476683 20:25415300-25415322 GTAAATCAATGAATGGCTTAGGG - Intronic
1172498939 20:35411301-35411323 TTGAATAAATGAATGAAGTAAGG - Intronic
1173119801 20:40278265-40278287 GTGAATAAATGAAGATACCATGG - Intergenic
1173175410 20:40761202-40761224 GTGAATGGATAAATAGACTATGG - Intergenic
1173217376 20:41097858-41097880 CTTAATAAATGAATAGAATAGGG + Intronic
1174738836 20:52992257-52992279 ATGAATGAATGAATGAACAAGGG + Intronic
1175063802 20:56268091-56268113 TTGAATGAATGAATGGATGAAGG - Intergenic
1175165266 20:57039088-57039110 ATGAATAAATGGATGGATAATGG + Intergenic
1176039544 20:63057183-63057205 GTGAATGAATGAATGAAAAAAGG - Intergenic
1176047150 20:63098702-63098724 ATGGATAAATGAATGGATGATGG + Intergenic
1177351534 21:19948594-19948616 TTAAATAAATGAATGTGCTATGG + Intergenic
1177480231 21:21676612-21676634 CTGAACAAATGAGGGGACTAGGG + Intergenic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1178876824 21:36420331-36420353 ATGAATGAATGAATGAACAAAGG - Intergenic
1181186409 22:21109086-21109108 GTGAATAAATAAATAAACCATGG + Intergenic
1181536967 22:23551361-23551383 GTGAAAAGATGAATGGGGTATGG - Intergenic
1182581778 22:31317909-31317931 GTAAATAAATGAATATACTGTGG + Intergenic
1182766530 22:32761731-32761753 GTAAATAAATAAATGGAGGAAGG - Intronic
1182840314 22:33383990-33384012 ATGAACAAATGAATGAACAAAGG + Intronic
1182879947 22:33724696-33724718 ATGAATAAATGAATGAGCCAAGG - Intronic
1182945089 22:34314531-34314553 GTGAAGAAATGACAGGACAAAGG + Intergenic
1183270000 22:36855953-36855975 GTGAATAAATGAATGAATGAGGG + Intergenic
1183733853 22:39632713-39632735 ATGAATGAATGAATGAACGATGG + Intronic
1183902684 22:41018381-41018403 GTGAATGAATGAATGAATGAAGG - Intergenic
1183999160 22:41659677-41659699 ATGAATGAATGAATGTACTGAGG - Intronic
1184186258 22:42867325-42867347 GTGAATGAATGACTGCACAATGG + Intronic
1184321293 22:43744030-43744052 ATGAATGAATGAATGGGTTATGG + Intronic
1184653345 22:45929349-45929371 GTGAATAGATGGATGGATAAAGG - Intronic
1185167171 22:49268624-49268646 ATGAATGAATGAATGAACGAAGG + Intergenic
1185193492 22:49453432-49453454 GTGAATGAGTGAATGGATGATGG + Intronic
1185307698 22:50130438-50130460 GAGAATGAATGAATGGACTACGG + Intronic
1185353090 22:50348427-50348449 GTGAGAGAATGAATGGACTCAGG + Intronic
950020974 3:9787388-9787410 GTGAATGAATGAATGAAGCATGG - Intronic
950192447 3:10987001-10987023 TTGAATAGATGAAGGCACTAAGG - Intergenic
950526920 3:13529589-13529611 TTGAATAAATAAATGGATAAAGG - Intergenic
950649352 3:14397585-14397607 GTGAATGAATAAATGTACTGTGG + Intergenic
950888253 3:16379573-16379595 GTGATTAAAAGAATGAACTTTGG - Intronic
951023060 3:17801429-17801451 GTGAATAAAGTAATGTGCTAGGG - Intronic
951048076 3:18063444-18063466 TTGAATAAATGAATGAATGATGG - Intronic
951234800 3:20221793-20221815 TTGAATAAATGAATGGGATGTGG - Intergenic
951635659 3:24772924-24772946 ATGAATGAATGAATGAACGATGG + Intergenic
952357911 3:32601723-32601745 GAGAATTAATGAATGGAAAAGGG - Intergenic
952464203 3:33563931-33563953 GTGTGTAAATGAATGGAGTGGGG - Intronic
952905664 3:38137908-38137930 ATGAGTAAATGAATGAACCAGGG + Intergenic
953715380 3:45312938-45312960 ATGAATATATGAATGGATAATGG + Intergenic
953888476 3:46733548-46733570 GTGAATAAAGGAATGAATGAAGG + Intronic
956099621 3:65753784-65753806 GTGATTAAAAGAATGGGCTTTGG - Intronic
957324318 3:78672876-78672898 GTGATTAAATGCACGGACTTTGG + Intronic
957364529 3:79205298-79205320 GAGGATAAATGATTGGATTAGGG + Intronic
958047293 3:88301696-88301718 GTGAATAAATAAATGAATCAAGG - Intergenic
959230852 3:103648972-103648994 GTGAATGAATGAATGGACCTGGG - Intergenic
959758457 3:109927858-109927880 ATGATTAAATGAATGGAAGATGG + Intergenic
959980027 3:112505685-112505707 GTACATAAATGAATAAACTATGG - Intergenic
960242752 3:115364994-115365016 TTGAATAAATGAATGGTGTCAGG + Intergenic
960932610 3:122869090-122869112 ATGAACAAATGAATGGACAGCGG - Intronic
961797551 3:129420618-129420640 ATGAACAAATGAATGAACAATGG + Intronic
962083814 3:132169462-132169484 ATCAATAAATGAATGAACAATGG - Intronic
962718791 3:138152791-138152813 ATGAATAAATGAGTGGTCTAGGG + Intergenic
963035833 3:141027916-141027938 ATGAGTAAATGAATCAACTAGGG - Intergenic
963059815 3:141216309-141216331 ATGAATGAATGAATGGATGATGG + Intergenic
963565952 3:146930951-146930973 GTGAATAAATGAATGAAATTTGG - Intergenic
963715454 3:148797790-148797812 ATGAATAAATGAAAAGACCAAGG - Intronic
964210607 3:154222849-154222871 GGGAATAAATCAAGGGAATAAGG + Intronic
964474202 3:157084024-157084046 ATGAATGAATGAATGAATTATGG - Intergenic
965624281 3:170671576-170671598 GTGAATAAATGAATGGACTAAGG + Intronic
965838077 3:172872904-172872926 GTGAATAAATGAGAGAACAAAGG + Intergenic
967300478 3:188007741-188007763 ATAAATAAATGAATGGAATAAGG - Intergenic
967579539 3:191136165-191136187 CTGAATAAATGTATGTACTTAGG - Intergenic
967970693 3:194996930-194996952 CTGAATAAATGAAGGGAGGACGG + Intergenic
968192320 3:196677748-196677770 CTGAATAAATGAATGTCTTAGGG - Intronic
968542802 4:1176813-1176835 GTGAATGAATGAATGAACTGTGG - Intronic
969510486 4:7614781-7614803 GTGGATGGATGAATGGATTATGG - Intronic
970100108 4:12511784-12511806 GTGAATGGATAAATAGACTATGG - Intergenic
970263026 4:14249477-14249499 GTGAATAAATGAAAGAATGAAGG + Intergenic
970507962 4:16752040-16752062 GCGAATAAATGCATGGTCCAGGG + Intronic
970668244 4:18363241-18363263 GTGAATAAATAAACAAACTATGG - Intergenic
971481508 4:27118792-27118814 GTCAATACATGAGTGGACTCTGG - Intergenic
971491510 4:27217099-27217121 GTGAATAAATAAATGTTCTAGGG + Intergenic
972356913 4:38288053-38288075 GTGCATAGATGAATTGCCTAAGG + Intergenic
973160796 4:47013659-47013681 GTCAATAAAAGAATGAACAATGG - Intronic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
973770986 4:54206220-54206242 GTGAATGAATGAATGAATGAAGG + Intronic
975124590 4:70767442-70767464 TTCAGTAAATGAATGGACAATGG - Intronic
977064611 4:92298329-92298351 ATGAATAGATGAATGAATTAAGG - Intronic
977426721 4:96875916-96875938 ATGAATAGATGAATGAACAAAGG + Intergenic
977437050 4:97011448-97011470 GTGAAGAAATGACAGGACAAAGG - Intergenic
977900833 4:102420568-102420590 TTCAATAAATGAATGGATGAGGG + Intronic
978878179 4:113667298-113667320 CTGAATAAATGAATGAAGGATGG + Intronic
979323797 4:119355159-119355181 GTGAATAAATGCATGGAAAATGG - Intergenic
979341678 4:119532166-119532188 ATGAATCAATGAATGGATTCTGG - Intronic
979819554 4:125153754-125153776 GTGAATAAATCTATTGACAAAGG - Intergenic
981250162 4:142591468-142591490 TTGAATAAATAAATGGAGAAAGG + Intronic
981672743 4:147306148-147306170 GTAAATCAATGAATGAATTAGGG - Intergenic
981775577 4:148363367-148363389 GTGAATAAATGACTGAAAAATGG - Intronic
981873288 4:149511919-149511941 TTGAATAAATGAATGAATAAAGG - Intergenic
981910342 4:149972721-149972743 GTGAATAAATAAGTAGACTATGG + Intergenic
982100228 4:151960036-151960058 GGGAATGAATGAATGAACTCTGG + Intergenic
982892901 4:160878347-160878369 GTGAATGAGTGAATGAACTGTGG + Intergenic
983706955 4:170673305-170673327 TTGAATAAGTGAATGGATGATGG + Intergenic
984016991 4:174438613-174438635 TTGAATAAATTAATGAATTATGG + Intergenic
984268955 4:177527573-177527595 GTGAACACATGACTGGAGTAGGG - Intergenic
984338327 4:178420571-178420593 GTGACTACATGAATGAACTAGGG + Intergenic
984551441 4:181164379-181164401 GTGATTAAATTAAATGACTAAGG - Intergenic
985193327 4:187401427-187401449 GTGAATAAAAGCATGGACACCGG - Intergenic
985749274 5:1665097-1665119 GTGAATGAATGAATGAATGAAGG + Intergenic
986699941 5:10396609-10396631 GGGCATGAATGAATGGACTTGGG + Intronic
987615785 5:20272702-20272724 GGAAAAAAATGAATGGACTTTGG - Intronic
990256497 5:53976064-53976086 ATTAATAGATGAATGAACTAAGG - Intronic
990683034 5:58267411-58267433 GTGAATAAATGAAGGAAGGAAGG + Intergenic
990793520 5:59512500-59512522 ATGAATAGATGAATGAACTTGGG + Intronic
990841384 5:60083206-60083228 CTGAATAAATAAATGAACTCAGG + Intronic
991008156 5:61852592-61852614 GTGAATGAATGAATAAACTGTGG + Intergenic
991531166 5:67616376-67616398 GTGAATGAATAAACAGACTATGG + Intergenic
991539501 5:67711103-67711125 GTGAATGGATGAATAGACTGTGG + Intergenic
992224616 5:74607998-74608020 GTGAAGAAATGACAGGACAAAGG + Intergenic
993148567 5:84129451-84129473 ATAAATAAAGGAATTGACTATGG - Intronic
993174863 5:84470886-84470908 CTGGAGAAATGAATGGACTGGGG - Intergenic
993185074 5:84607064-84607086 GTGAATGAATGAATAAACTATGG + Intergenic
995469856 5:112489985-112490007 GTGATTAAAAAAATGGTCTATGG - Intergenic
995550117 5:113273045-113273067 GTGAAAACATTAATGAACTAAGG + Intronic
995707601 5:115001114-115001136 GTGAGTAATTGAATGGCCCAGGG + Intergenic
996307702 5:122068816-122068838 ATGAATAAATAAATGGAGAATGG + Intronic
996402174 5:123074511-123074533 GTGAATGAATGAATGAACAAGGG - Intergenic
996431160 5:123379151-123379173 GTGAGAAAATGAATTGACTAGGG + Intronic
996810026 5:127506419-127506441 ATAAATAAATGAATGCACCAAGG - Intergenic
997720950 5:136078072-136078094 GTGAATAAATGAATCAAGTAGGG + Intergenic
998602586 5:143600272-143600294 TTGAATGAATAAATGGATTAAGG + Intergenic
998609705 5:143674561-143674583 GTGAATAAAGGAGTGGCCGAGGG + Intergenic
998910924 5:146959539-146959561 ATGAATAAATGCATGCACTGTGG + Intronic
999085651 5:148886744-148886766 GTGATAAAATGGATGGATTAGGG + Intergenic
999379306 5:151109161-151109183 GTGGCTAAAAGAATGGACTTGGG - Intronic
999429990 5:151517648-151517670 GTGAATAGAAGAATGGCCTGTGG + Exonic
999476966 5:151908982-151909004 GTTTGTAAATGAAGGGACTAAGG - Intronic
999477293 5:151912187-151912209 TTGAATAAATGTATTGAATATGG - Intronic
999861283 5:155649353-155649375 GAGAATAAATAAATGAACAACGG + Intergenic
1000686509 5:164256061-164256083 TTGAATAAATGAATGAATGAAGG - Intergenic
1001249493 5:170135888-170135910 GAGAATAATAGAAAGGACTATGG + Intergenic
1001840347 5:174870956-174870978 GTGAATGAGTGAATAGACTTGGG - Intergenic
1002272813 5:178083814-178083836 GTGAAGAAAGGAAAGGAATAGGG + Intergenic
1003366111 6:5476542-5476564 ATGAATGAATGAATGGAGTGAGG + Intronic
1003411694 6:5869623-5869645 GTGAATGAATGAATGAAAAATGG - Intergenic
1004408331 6:15356182-15356204 ATGAATAAATGAACGAAATATGG - Intronic
1004672930 6:17814734-17814756 TTAAATAAAAGACTGGACTATGG + Intronic
1005321853 6:24663408-24663430 GTGAATAAGAGCATGGACTCTGG - Intronic
1005735837 6:28745000-28745022 CTGAAGAAATGAATGGAGGAGGG + Intergenic
1007796794 6:44355378-44355400 GTGAATGAATAAATAAACTATGG - Intronic
1008097471 6:47353785-47353807 GTGAATAAAGGTATGGATGATGG - Intergenic
1008368538 6:50709185-50709207 AAGAATAAATGAATAAACTAGGG + Intergenic
1009553081 6:65125206-65125228 TTGAATAAATGAAGGGAAAAAGG - Intronic
1010230832 6:73533641-73533663 ATGAATAATTGAATGGATAAAGG + Intergenic
1010409706 6:75546954-75546976 GTGAATTGATTAATGGGCTATGG - Intergenic
1010645616 6:78384947-78384969 GTGAACAAATGGGTGGAATAAGG - Intergenic
1011307324 6:85942650-85942672 ATGAATACATGAATGAATTAGGG - Intergenic
1011731395 6:90267649-90267671 GGGAATAATTGAATAAACTATGG + Intronic
1012226310 6:96707402-96707424 TTGAATAAATGAATGGACCTTGG + Intergenic
1012411444 6:98962623-98962645 CTGAATAATTGAATGAATTATGG - Intergenic
1012877895 6:104751080-104751102 TTGAGTGAATGAATGAACTAGGG - Intronic
1012972803 6:105749691-105749713 GTGAATAAATGATTTGAATTGGG + Intergenic
1013224686 6:108112293-108112315 TCCAATAAATGAATGGATTAGGG + Intronic
1013572529 6:111443810-111443832 ATGAATAAATGAACAGCCTATGG - Intronic
1013879947 6:114885283-114885305 TTGATTAAATAAATGGACTGGGG + Intergenic
1014682135 6:124444180-124444202 GTGAATACATTAATGAATTATGG + Intronic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014932464 6:127350310-127350332 GTGAACTAATTAATGCACTATGG + Intergenic
1014998773 6:128188810-128188832 GTGAACAAATGAAAGGAATTTGG - Intronic
1015420718 6:133004768-133004790 GTGATTAACTGTATGGACTCTGG + Intergenic
1015700254 6:136028132-136028154 ATGAATTAATGAATGAATTAAGG + Intronic
1016121671 6:140350315-140350337 GTGAATAAATGCATGAATGAAGG - Intergenic
1016196892 6:141354742-141354764 CTGTATAAATGAATGAAATAAGG - Intergenic
1016250869 6:142040658-142040680 GTATATAAATGACTAGACTATGG - Intergenic
1016491912 6:144614571-144614593 GTAAATGAATGAATGAACAAGGG + Intronic
1017237807 6:152135601-152135623 GTGAATAAATGAATGAATGAAGG - Intronic
1017621395 6:156302903-156302925 GTGAATAAATAAATAAACTGTGG + Intergenic
1017897129 6:158690237-158690259 GTGAATAAATAAATTGAGCAGGG + Intronic
1017991481 6:159492988-159493010 ATGAATAAAGGAAAGGACAAGGG + Intergenic
1018186529 6:161269798-161269820 TTGAATAAATGAAGGGATTGGGG + Intronic
1018270578 6:162073149-162073171 GTAAATGAATGAATGGAGCAAGG + Intronic
1019515244 7:1437001-1437023 GTGAATAAGTGAATGAAGGAAGG + Intronic
1020365839 7:7379665-7379687 ATGAATAAATGAATGGAGAAAGG + Intronic
1020661587 7:10990565-10990587 GTTAATAAAAGAATGGAAAATGG + Intronic
1020868674 7:13599565-13599587 TTGATTAAATGAATGAATTAGGG - Intergenic
1021128041 7:16877152-16877174 GTTAAGAAATGAATGTACTTGGG + Intronic
1021827213 7:24567158-24567180 GTAAATAAATGAATGAAAGATGG - Intergenic
1022060908 7:26794265-26794287 GTGGCTAAAGGAATAGACTAGGG + Intronic
1022149110 7:27581100-27581122 GGAAAAGAATGAATGGACTAAGG + Intronic
1023617495 7:42034799-42034821 GGGAACAAATGAATGAACAAAGG - Intronic
1024170841 7:46784036-46784058 ATGAATAAATGAATGTAGAAGGG + Intergenic
1024356461 7:48418060-48418082 ATGAATAGATAAATAGACTATGG - Intronic
1024937857 7:54729854-54729876 GTGCATGAATGAAAGGATTATGG - Intergenic
1025113153 7:56236189-56236211 ATGAATGAATGAATGAAATAGGG + Intergenic
1027502999 7:78978923-78978945 CTGAATAAATGAATGGTGGATGG + Intronic
1028335640 7:89651190-89651212 GTGAATAAAAGGATGGACTTTGG - Intergenic
1030610018 7:111679276-111679298 GTGACTAAATCAATGTATTATGG - Intergenic
1031231382 7:119111954-119111976 GAGAATAAAGGAATGGAAAAGGG - Intergenic
1031699747 7:124908959-124908981 GAGAATAAATAAATGATCTAAGG + Intronic
1032254709 7:130287761-130287783 GAGAATAAGTGACTGGACCATGG - Intronic
1032347530 7:131130646-131130668 GTGAATAATATAATGGACCATGG + Intronic
1032953863 7:136948164-136948186 ATGCATAAAGTAATGGACTATGG + Intronic
1033180867 7:139176759-139176781 GTGAATGAATGAATGAAATGGGG - Intronic
1033391148 7:140928647-140928669 GTGAATACATGAATGCCTTAGGG - Intergenic
1036519579 8:9477924-9477946 GTGATTGAATAAAAGGACTAGGG - Intergenic
1036724621 8:11208771-11208793 GTGTACAAATCAATGGACCAGGG - Intergenic
1036823850 8:11961026-11961048 ATGAATAAATGAATGAATTTTGG + Intergenic
1038120468 8:24608692-24608714 ATGAATGAATGAATGGACGAAGG - Intergenic
1038330253 8:26602647-26602669 ATGAATAAATGAACGGATGAAGG - Intronic
1038395047 8:27240404-27240426 GTGAATGAATGAATGAATGATGG - Intronic
1038478003 8:27882269-27882291 GTGAATGGATGAATAAACTATGG - Intronic
1038608803 8:29039541-29039563 GGGAATAAATGAATGGGAAAAGG - Intronic
1038608806 8:29039561-29039583 TTGAATAAATGAATACATTAGGG - Intronic
1038948250 8:32385389-32385411 GAGAATGAATGAATACACTAGGG - Intronic
1038969381 8:32615175-32615197 GTGAAGAAATCAATGAATTATGG - Intronic
1040363308 8:46688100-46688122 GGGAATAAAATAATGGACTAAGG - Intergenic
1040673811 8:49725072-49725094 TTGAACAAATGAATGGACGATGG + Intergenic
1041413749 8:57584678-57584700 ATGAATGAATGAATGGAGAACGG + Intergenic
1041594374 8:59629911-59629933 GGGAATAAATGAATGAATAAAGG + Intergenic
1041867200 8:62588937-62588959 GAGAATCAATGATTGGACTATGG - Intronic
1042056729 8:64771943-64771965 GTGGATGAGTGAATGGAGTAGGG - Intronic
1042075243 8:64986884-64986906 GAGAATAAATGACTGGATAAAGG + Intergenic
1042078237 8:65019404-65019426 GTGAGAAAATGGATGGACTAGGG - Intergenic
1043028057 8:75096166-75096188 GTTAATAACTGCATAGACTAAGG + Intergenic
1043685039 8:83073694-83073716 GTGAATAAAGGATTGGCCTGTGG - Intergenic
1044037118 8:87320530-87320552 GTTAATCAATGATTGAACTAAGG - Intronic
1044160669 8:88910658-88910680 GTGATTGAGGGAATGGACTAGGG + Intergenic
1044219438 8:89651535-89651557 GTGAATAAATGCTTGTATTATGG + Intergenic
1044236293 8:89834530-89834552 GTTTATAAATGAATGGATAAAGG + Intergenic
1044363760 8:91319118-91319140 GTAACTCAATGAATGGAGTATGG + Intronic
1044386045 8:91589955-91589977 GTGAAGAAGTGAATGGCCTAAGG + Intergenic
1045102443 8:98858942-98858964 GTGAATAAATAAAAGGACTAAGG + Intronic
1045540257 8:103077571-103077593 TTGAACAAATGAAGGAACTATGG - Intergenic
1045836353 8:106525993-106526015 GTGAATAAAAGATTAAACTAAGG + Intronic
1046104979 8:109654263-109654285 GTGAGTACATGAGTGGAGTAGGG - Intronic
1046159315 8:110339459-110339481 GTAAAAAAATGAATAGACAAGGG - Intergenic
1046293698 8:112195004-112195026 GAGAAGAAAGGAATGGACAAAGG - Intergenic
1046537391 8:115532817-115532839 GTGAATAAATGAAGGGCTTTGGG + Intronic
1046542410 8:115603542-115603564 AAGGATAAATAAATGGACTACGG + Intronic
1046792807 8:118340038-118340060 TTGAATAAATGAATGAACAAAGG - Intronic
1047292564 8:123542161-123542183 GTGAATAAGTGAATGGATACGGG + Intergenic
1047364217 8:124197528-124197550 CTGAATAAATGAATGAACAAAGG + Intergenic
1047703913 8:127478431-127478453 GTGAATAAATGAATGAATAATGG - Intergenic
1048180077 8:132186188-132186210 GGGAAGAAAGAAATGGACTAAGG + Intronic
1048324984 8:133432031-133432053 ATGAATAAATGAATGTTCTATGG + Intergenic
1048598224 8:135889550-135889572 GTGAATAAATGAATGAATGGAGG + Intergenic
1048723896 8:137359965-137359987 ATGAATAAATGAATAGAATATGG - Intergenic
1048941301 8:139403070-139403092 CTGAATATATGAATGGACAGTGG + Intergenic
1049176303 8:141194624-141194646 GTGAGTGAATGAATGAAGTAAGG - Exonic
1049474926 8:142792728-142792750 GTGAATGGATGAATGGAGGATGG - Intergenic
1050404187 9:5290558-5290580 GTGAATGAATAAATAGACTGTGG + Intergenic
1050967235 9:11821181-11821203 GTACACAAATGACTGGACTAGGG - Intergenic
1051007620 9:12366477-12366499 GTGAGTAAATAAATGAACTGTGG + Intergenic
1051719579 9:20022393-20022415 GTTGATAAATTAAAGGACTAAGG + Intergenic
1052462367 9:28782342-28782364 GTGAATGAATGAAGGGAGGAAGG - Intergenic
1053401972 9:37832772-37832794 GTGAATAACTCACAGGACTAAGG + Intronic
1055145944 9:72934795-72934817 GTTTATAAATGAATAGACTATGG + Intronic
1055559184 9:77505582-77505604 GTGAATGAATGAACGAACTAAGG + Intronic
1056327911 9:85495968-85495990 GTGAATAAGTGAATGTAATGAGG + Intergenic
1057821622 9:98335837-98335859 GTGCATGAATGAATGGATGATGG - Intronic
1057834851 9:98436093-98436115 TAGAATAAATGAATGAACAAAGG + Intronic
1058490004 9:105488403-105488425 GTGTATAAATGAATAAACCATGG - Intronic
1058550301 9:106107470-106107492 GTGAACAAATGGATGAACTGGGG + Intergenic
1058712899 9:107696568-107696590 GGGAATGAATGAATGAACTCAGG - Intergenic
1058800489 9:108540518-108540540 ATGAATGAATGAATGAACAAAGG + Intergenic
1059008595 9:110431864-110431886 TTGAATAAAAGAATGGAATTAGG + Intronic
1059195945 9:112370978-112371000 GCTAATAAATGAATTTACTAAGG - Intergenic
1059409101 9:114120926-114120948 ATAAATAAATGAATGGATGATGG + Intergenic
1059751539 9:117252392-117252414 TTGATTAAATGAATGAACGAGGG - Intronic
1059796030 9:117697899-117697921 ATAAATAAATGAATGAATTATGG + Intergenic
1060014285 9:120072976-120072998 TTGAATGAATGAATGAACAAAGG - Intergenic
1060119994 9:120979912-120979934 ATGAATAAATGAATGAATAACGG + Intronic
1060552554 9:124492496-124492518 ATGAATGAATGAATGGGCAAAGG - Intronic
1061300149 9:129699610-129699632 GTGAATGAATGAATGGATTTTGG - Intronic
1061876645 9:133547410-133547432 GTGAATGAATGAATGGGGGAGGG - Intronic
1062247979 9:135579411-135579433 GTGAATAAATGGATGGTGTATGG - Intergenic
1062248072 9:135579929-135579951 GTAAATAAATGGATGGACAATGG - Intergenic
1062458522 9:136652778-136652800 ATGAATGAATGAATGAACCATGG + Intergenic
1185876639 X:3707264-3707286 ATAAATAAATGAATGGATGATGG - Intronic
1186273075 X:7910418-7910440 GTGAATGAATGAATGAAAGATGG + Intronic
1186497325 X:10021964-10021986 ATGAATAAATGAATGAACAGAGG - Intronic
1186782953 X:12931481-12931503 GTGAATGAATGAATGAGCAAAGG + Intergenic
1187039402 X:15577859-15577881 GTAACTGAATGAATGGACTTGGG - Intronic
1187247554 X:17566565-17566587 ATGAGTAAATGAATGAATTATGG + Intronic
1187268687 X:17760398-17760420 GTGAATGAATGAATGAACCGTGG - Intergenic
1187310982 X:18142297-18142319 GTGAATGGATGAATAAACTATGG + Intergenic
1187320797 X:18235951-18235973 GTGAATGAATGAATGAACCGTGG + Intergenic
1187370047 X:18697624-18697646 ATGAATAAATGAAAGCAATATGG - Intronic
1187370706 X:18703550-18703572 ATGAATGAATGAATGAACAAAGG - Intronic
1187760011 X:22572295-22572317 ATAAATAATTGAATGAACTATGG + Intergenic
1188110550 X:26192667-26192689 GGAAAAAAATGAATGGACTTTGG - Intronic
1191097824 X:56692571-56692593 GAGAATAAAATAATGGACTTTGG + Intergenic
1192952238 X:76029297-76029319 GTGAGAGAATAAATGGACTAAGG + Intergenic
1193435091 X:81464264-81464286 ATAAATAAATGAATAAACTAAGG - Intergenic
1193741596 X:85223863-85223885 GTGACTGAAGTAATGGACTAGGG + Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194577532 X:95631391-95631413 TTGAATAAATGAATGACTTATGG + Intergenic
1194620994 X:96171660-96171682 GTGAATAAATGTATGATCAAAGG + Intergenic
1194933926 X:99924443-99924465 GTGAAGCAAGGAATGGAGTATGG - Intergenic
1195814730 X:108872502-108872524 TTGAATAAATGAATGAATTATGG - Intergenic
1196235356 X:113273879-113273901 ATGAATAAGTGAATGGAAAAAGG + Intergenic
1196300968 X:114049628-114049650 TTGAAGAAATGAATGCACGATGG + Intergenic
1196894161 X:120318073-120318095 ATGAATCAATGAATACACTAGGG + Intergenic
1196908043 X:120458019-120458041 GTGACTAAATGCATTGGCTAAGG + Intronic
1197573095 X:128174291-128174313 GTGAATAGATAAATAAACTATGG + Intergenic
1197627058 X:128813969-128813991 GTGAATGAATGAATAAATTATGG + Intergenic
1197770854 X:130088340-130088362 GTAAAGAAATTGATGGACTATGG + Intronic
1197862312 X:130984048-130984070 TTGAATAGATGAATGAACTAGGG - Intergenic
1198472605 X:136962477-136962499 GTTTATAAATGAAGGCACTAGGG - Intergenic
1198848674 X:140941487-140941509 GTGAATGAATGAATTCACTGGGG - Intergenic
1200112898 X:153751816-153751838 ATAAATAAATGAATAAACTACGG + Intergenic
1200241504 X:154497274-154497296 GTGAATAAATCAAATGACCATGG + Intergenic
1200379141 X:155816171-155816193 GTGAATACATGAATAAACTGTGG + Intergenic
1200788722 Y:7281139-7281161 ATAAATAAATGAATGGATGATGG + Intergenic
1200835950 Y:7731351-7731373 GTGATTAAAAGAATGAACTTTGG - Intergenic
1201586288 Y:15564610-15564632 GAGAATCAATGAATGGATGAGGG - Intergenic
1202099300 Y:21288906-21288928 GTGAAAAAATGCATGGAATTTGG + Intergenic