ID: 965626883

View in Genome Browser
Species Human (GRCh38)
Location 3:170690563-170690585
Sequence TCCCCCTAGTGGCGGTGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965626876_965626883 4 Left 965626876 3:170690536-170690558 CCACCACAGGAAGTGCAGGGACC 0: 1
1: 0
2: 1
3: 21
4: 199
Right 965626883 3:170690563-170690585 TCCCCCTAGTGGCGGTGTGCCGG 0: 1
1: 0
2: 0
3: 4
4: 55
965626872_965626883 10 Left 965626872 3:170690530-170690552 CCACCACCACCACAGGAAGTGCA 0: 1
1: 1
2: 2
3: 29
4: 393
Right 965626883 3:170690563-170690585 TCCCCCTAGTGGCGGTGTGCCGG 0: 1
1: 0
2: 0
3: 4
4: 55
965626874_965626883 7 Left 965626874 3:170690533-170690555 CCACCACCACAGGAAGTGCAGGG 0: 1
1: 0
2: 2
3: 32
4: 402
Right 965626883 3:170690563-170690585 TCCCCCTAGTGGCGGTGTGCCGG 0: 1
1: 0
2: 0
3: 4
4: 55
965626877_965626883 1 Left 965626877 3:170690539-170690561 CCACAGGAAGTGCAGGGACCCCG 0: 1
1: 0
2: 1
3: 19
4: 192
Right 965626883 3:170690563-170690585 TCCCCCTAGTGGCGGTGTGCCGG 0: 1
1: 0
2: 0
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965626883 Original CRISPR TCCCCCTAGTGGCGGTGTGC CGG Intronic
903577078 1:24345642-24345664 GCCCCCCAGTGGGGGTGTGTTGG - Intronic
906238739 1:44228659-44228681 GCCCCCAAGTGGCTGTGAGCTGG - Intronic
906658916 1:47568829-47568851 TCCCCCAAGGGGCAGGGTGCAGG + Intergenic
908740078 1:67318327-67318349 TTCCAATAGTGGTGGTGTGCAGG + Intronic
910604195 1:89065698-89065720 GCCCCCTCCTGGCTGTGTGCTGG - Intergenic
921182745 1:212644501-212644523 TCTACCCAGTGGCTGTGTGCAGG + Intergenic
1069837582 10:71319113-71319135 TCCCCCTTCTGGCGCTGAGCTGG - Intergenic
1070218952 10:74420026-74420048 TCCCCCTGGTGGCAGTGTCTGGG - Intronic
1077895099 11:6448299-6448321 TGCACCTACTGGCTGTGTGCTGG + Intergenic
1084427365 11:69092406-69092428 TCGCCCTTGCGCCGGTGTGCGGG - Intergenic
1088369897 11:109077620-109077642 TCCCCCTCTTGGCTGAGTGCTGG + Intergenic
1097880027 12:64678470-64678492 ACCTCCTAGTGGCAGTGTGATGG + Intronic
1107717722 13:43217114-43217136 TCTCCCTGGTGGAGGTGGGCAGG - Intronic
1124641611 15:31399640-31399662 TCCGCCTCGTGGCTGGGTGCGGG + Intronic
1128760773 15:70214830-70214852 TCACCCTAGGGGTGCTGTGCAGG + Intergenic
1129350781 15:74955026-74955048 TTCCCTTAGTGGCGATGTACAGG + Exonic
1130236501 15:82139973-82139995 TCCCCCTAGTGGCGGTTATTAGG + Intronic
1133276182 16:4639657-4639679 TCCCCGTATTGGGGGTGTGGAGG + Intronic
1136557741 16:31018069-31018091 TCCTGCTGGTGGCCGTGTGCGGG + Intergenic
1136671143 16:31859534-31859556 GCCCTCTAGTGGCCCTGTGCAGG - Intergenic
1141744254 16:85915067-85915089 TCCACCTAGAGGTGGTGGGCAGG - Intronic
1142942920 17:3397964-3397986 TCGCCCTGGTGGCGCTGTCCTGG - Exonic
1143908277 17:10227040-10227062 TCCCCCTAGTGGCCGTGGCCGGG + Intergenic
1165065762 19:33226957-33226979 TCCCCCCAGTGGCGGCCTCCGGG + Intergenic
1166368466 19:42289104-42289126 GCCCCCTAGTGGGGGTGGGCAGG + Intronic
1168039480 19:53746492-53746514 GCCCTCTAGTGGCCGTGTCCGGG + Intergenic
932411158 2:71548811-71548833 TCCACCTAGTGGCCGTGTCCAGG - Intronic
933396533 2:81739376-81739398 TCCACCTAATGGCAGTGTGATGG + Intergenic
947521294 2:230848067-230848089 GCCCCCTTGTGGCAGTCTGCAGG - Intergenic
1184253697 22:43275312-43275334 TCCCTCTCCTGGCGGTGGGCTGG + Intronic
950868986 3:16212795-16212817 TCCTGCTAGTGGCCCTGTGCTGG - Intronic
953398801 3:42593890-42593912 GCCCCCTAGTAGGAGTGTGCCGG + Intronic
954326141 3:49865190-49865212 TCTCCCCAGTGGAGGAGTGCAGG - Intronic
955422420 3:58751873-58751895 TCCTCCTGGTGGTGGTGTGAGGG + Intronic
957426835 3:80051020-80051042 TCCCCACAGTGGTGGTGGGCGGG - Intergenic
965626883 3:170690563-170690585 TCCCCCTAGTGGCGGTGTGCCGG + Intronic
968912690 4:3484094-3484116 TCCACCTCGTGGCTGTGTGATGG + Intronic
985784948 5:1888421-1888443 CCCCATTAGTGGCGATGTGCGGG + Intergenic
986586222 5:9320865-9320887 TTCCCTTAGAGGAGGTGTGCTGG - Intronic
991920601 5:71653004-71653026 TCCCCCTAGTTGAGGTGTCTGGG + Intronic
995106577 5:108382205-108382227 TTCCCGTAGTGCCGGTGTGACGG - Intergenic
1002105170 5:176876463-176876485 TCCCTCTAGAGGTGGTGAGCAGG - Intronic
1003854266 6:10256298-10256320 TCCCCCTGGTGGAGGCGTGAGGG - Intergenic
1012448941 6:99334702-99334724 TCCCTCTGGTGGCAGTGTGGAGG - Intronic
1012535526 6:100292130-100292152 TCCCCCAACTGGCCGAGTGCTGG - Intergenic
1013049741 6:106520814-106520836 TCCCATTAGTGTTGGTGTGCAGG - Exonic
1016792124 6:148077073-148077095 TCCCCAAAGTGGAGGTGTGCAGG - Intergenic
1017044378 6:150333771-150333793 TCCTCCCAGTGGAGGTGAGCAGG + Intergenic
1018188370 6:161287408-161287430 TTACCCAAGTGGCGATGTGCTGG + Intergenic
1023833931 7:44057570-44057592 TCCCCCTTGGGGCAGTGTCCTGG + Intronic
1025810031 7:64869807-64869829 TCCCCAAAGAGGCTGTGTGCAGG - Intergenic
1026858406 7:73769639-73769661 TCACCCTCGTGCCGGTGTCCTGG - Exonic
1050160842 9:2717661-2717683 TCCTCCTAGAGGCAGTGAGCAGG + Exonic
1051004747 9:12329565-12329587 GCCCTCTAGTGGCCCTGTGCGGG + Intergenic
1055368495 9:75571862-75571884 TAAACCTAGTGGTGGTGTGCTGG + Intergenic
1059783632 9:117556420-117556442 GCCCCCTAGTGGAGGTGAGTGGG + Intergenic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1190714398 X:53091568-53091590 TCCCCCAGTTGGGGGTGTGCAGG + Intergenic
1197316123 X:124967849-124967871 TGACCCTAGTGGCAGTGTGGAGG - Intergenic
1198441397 X:136666836-136666858 CCCCTCTAGTAGCTGTGTGCTGG - Exonic