ID: 965630196

View in Genome Browser
Species Human (GRCh38)
Location 3:170725119-170725141
Sequence ACCTGATCACACAGCAGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965630196 Original CRISPR ACCTGATCACACAGCAGCTT TGG (reversed) Intronic