ID: 965634735

View in Genome Browser
Species Human (GRCh38)
Location 3:170769552-170769574
Sequence CAGGTCTAGGGGAGGGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 740
Summary {0: 1, 1: 0, 2: 9, 3: 67, 4: 663}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965634725_965634735 -4 Left 965634725 3:170769533-170769555 CCTCACTCCCAGAAGGAGGCAGG 0: 1
1: 1
2: 4
3: 48
4: 438
Right 965634735 3:170769552-170769574 CAGGTCTAGGGGAGGGCAGGAGG 0: 1
1: 0
2: 9
3: 67
4: 663

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965634735 Original CRISPR CAGGTCTAGGGGAGGGCAGG AGG Intronic
900087629 1:906003-906025 CGGGTCAAGGGCAGGGCTGGGGG - Intergenic
900105209 1:978167-978189 CAGGGTTAGGGTGGGGCAGGCGG - Intronic
900230361 1:1554015-1554037 CAGGTCCGGGGGACGTCAGGTGG + Intronic
900395192 1:2450592-2450614 CAGGCCGAGTGGGGGGCAGGTGG - Intronic
900490973 1:2949006-2949028 CAGGTGCCGGGGAGGGCAGACGG + Intergenic
900589451 1:3453311-3453333 CAGCTCTTGGGAAAGGCAGGTGG - Intergenic
901018484 1:6244627-6244649 AAGGTATAGGGGAGGGCTGGAGG + Exonic
901060050 1:6467793-6467815 CTGGACTGGGGTAGGGCAGGTGG - Intronic
901759038 1:11458899-11458921 CAGGCCCAGGAGGGGGCAGGAGG - Intergenic
901792599 1:11662139-11662161 CAGTTCTAGGGGTGGGGTGGGGG - Exonic
902332729 1:15738451-15738473 CAGGGCTGGGGGATGGCTGGAGG + Intronic
902816709 1:18920654-18920676 AAGGCCTTGGAGAGGGCAGGTGG - Intronic
903113372 1:21157478-21157500 CAGGTGTAGTGGTGAGCAGGAGG - Intronic
903358290 1:22761664-22761686 GAGGTCCAGGAGAGGGAAGGAGG - Intronic
903540971 1:24096177-24096199 AAGGTCCAGAGAAGGGCAGGAGG + Intronic
903585838 1:24414777-24414799 CAGGACTTTGGGAGGCCAGGAGG - Intronic
903588803 1:24438531-24438553 GCGATCTAGGAGAGGGCAGGGGG + Intronic
903764351 1:25724272-25724294 CAGGACTTTGGGAGGCCAGGTGG - Intronic
903827263 1:26155305-26155327 CAGGTCTCAGTGAGGGCAAGAGG - Intergenic
904039921 1:27577762-27577784 CAGGTCAGGGGGAGGGGAGCAGG - Intronic
904455710 1:30646901-30646923 CAGGGCTGTGGGAGGGGAGGTGG + Intergenic
904678902 1:32215340-32215362 CAGGTTCAGGGGAGGGAAAGGGG + Intronic
905013228 1:34760768-34760790 CAGGGCTGGGCCAGGGCAGGAGG - Intronic
905930598 1:41784154-41784176 CTGCTCTAGGGCAGGGGAGGTGG - Intronic
906491360 1:46271309-46271331 CAGTTGTTGGGAAGGGCAGGAGG - Intronic
906515268 1:46435389-46435411 CTGGACAAGGGGAGGCCAGGTGG - Intergenic
907301682 1:53490805-53490827 CAGGGTTGGGGGAGGGCAAGAGG - Intergenic
907816138 1:57919929-57919951 AAGGCCTAGGGGAGGTCAGGTGG + Intronic
907999720 1:59668353-59668375 CAGGGCAAGGGGAGGGAAAGTGG + Intronic
910280472 1:85495037-85495059 CAGTTCCAGCAGAGGGCAGGCGG + Intronic
912478901 1:109962474-109962496 ATGGACTAGGGGAGGGCAGGGGG + Intergenic
912559481 1:110539722-110539744 TGGGTCAAGGGGTGGGCAGGTGG - Intergenic
912758220 1:112342568-112342590 CAGGTCAAGGGAAGAGGAGGAGG - Intergenic
913172168 1:116243004-116243026 CAGCTCCGGGGGAGGGCGGGAGG - Intergenic
914648368 1:149675122-149675144 CCGGTCTGCGGGCGGGCAGGCGG + Intergenic
914753558 1:150550837-150550859 TAGGTCTCAGGGAGGGCAGTGGG + Intronic
915108853 1:153550286-153550308 CAACTCTGGGGGAGGGCAGATGG - Intergenic
915118450 1:153614387-153614409 CTGGGCTAGGGCAGGGGAGGAGG - Exonic
915553048 1:156646324-156646346 CAGGACTAGGGAAGGGCACTGGG + Intronic
915913147 1:159926459-159926481 CAGGTAAAGGGTAGAGCAGGTGG - Intergenic
917217712 1:172695228-172695250 TAGGTATAGGGTTGGGCAGGGGG + Intergenic
917738406 1:177940541-177940563 CATGTCTAGGGGTGGGAAGAGGG + Intronic
919787957 1:201272036-201272058 CAGGTCTAGGGCAGGGCCTAAGG - Intergenic
919827237 1:201512052-201512074 CAGGCCAAGGGGAGGGGAAGAGG - Intergenic
920031382 1:203039273-203039295 CAGGGCTAGAGGAGGGAAAGGGG - Intronic
921161132 1:212472775-212472797 CAGGTCCTGTGGAAGGCAGGAGG + Intergenic
922336552 1:224623123-224623145 CAGGTCCAGGGCAGGTCAGGGGG - Intronic
922473392 1:225890092-225890114 CAGGTCTAGGCTGGGGCAGGGGG + Intronic
922535008 1:226373169-226373191 CAGCTCTAAGGCAGGCCAGGAGG + Intronic
922717575 1:227885292-227885314 CAGGTGCAGCAGAGGGCAGGCGG + Intergenic
923039323 1:230308589-230308611 CAGGGCTAGGGGTGGGGAGGCGG + Intergenic
923151814 1:231240676-231240698 CAGGTCTTGGGGGTGGCATGGGG + Intronic
923215706 1:231845945-231845967 CAGGGCTCGGGGTGGGGAGGAGG + Intronic
1063474295 10:6315091-6315113 TTGGCCTAGGGGTGGGCAGGTGG - Intergenic
1064131477 10:12713680-12713702 CAGATGTGGGGAAGGGCAGGTGG + Intronic
1066097107 10:32083107-32083129 CAGGCCTTGGGGAAGGAAGGGGG + Intergenic
1067054446 10:43042810-43042832 CAGGCTGTGGGGAGGGCAGGAGG - Intergenic
1067343013 10:45419497-45419519 CGGGGCTGGGGGAGGGCCGGTGG - Intronic
1067382366 10:45786781-45786803 TAGGTGCAGGGGAGGGGAGGCGG - Intronic
1067456918 10:46425616-46425638 GAGGGCTGGGGGAGGGCCGGGGG - Intergenic
1067459619 10:46447985-46448007 CAGCTCAAGGGGGAGGCAGGTGG + Intergenic
1067563594 10:47321304-47321326 CAGGTTTAGGGGGGTGCAGGAGG - Intergenic
1067627569 10:47936628-47936650 CAGCTCAAGGGGGAGGCAGGTGG - Intergenic
1067630286 10:47959023-47959045 GAGGGCTGGGGGAGGGCCGGGGG + Intergenic
1067807600 10:49404078-49404100 GAGGTGTTGGGGAGGGCAGAGGG - Intergenic
1067890066 10:50127329-50127351 TAGGTGCAGGGGAGGGGAGGCGG - Intronic
1068805190 10:61187191-61187213 CAGGTGTGGAGAAGGGCAGGGGG + Intergenic
1069518673 10:69100649-69100671 CAGGGCCAGGGAAGGACAGGAGG - Intronic
1069832059 10:71287533-71287555 CGGGTTTGGGGGAGGGCAGAGGG + Intronic
1069853580 10:71426073-71426095 TCTGTCTTGGGGAGGGCAGGAGG + Intronic
1069913930 10:71775655-71775677 CTGGGCTTGGGGAGGGAAGGTGG - Intronic
1070501653 10:77078322-77078344 CAGCTTTAGGGGAGGGAAGGTGG - Intronic
1070933975 10:80279324-80279346 CAGGACGGGGGAAGGGCAGGAGG + Intronic
1070996514 10:80788369-80788391 CAGGACTAAGTGGGGGCAGGAGG + Intergenic
1071188268 10:83069497-83069519 GAGGTCTAGGGGAGAGAAAGTGG + Intergenic
1072429494 10:95358144-95358166 CACACATAGGGGAGGGCAGGAGG + Intronic
1073134910 10:101215139-101215161 CAGGTCCTGGGGAAGGCCGGGGG - Intergenic
1073141817 10:101253374-101253396 CAGGTTTGGGGCAGAGCAGGAGG + Intergenic
1073328452 10:102656168-102656190 CACATCCTGGGGAGGGCAGGGGG + Intronic
1073439481 10:103544150-103544172 CAGAGCCAGGGGAGGGAAGGAGG + Intronic
1074067072 10:110025821-110025843 CTGCTCTAGGGAAGGTCAGGTGG - Intronic
1075518974 10:123132815-123132837 AAGGACTCGGGGAGGGAAGGAGG - Intergenic
1075783684 10:125033693-125033715 CAGTGCTTGGGGTGGGCAGGGGG - Intronic
1075842073 10:125513473-125513495 CATGTCAAGAAGAGGGCAGGTGG + Intergenic
1075957177 10:126534086-126534108 CAGTTCCAAGGGAGGACAGGAGG - Intronic
1075960253 10:126562286-126562308 ACAGTCTAAGGGAGGGCAGGGGG - Intronic
1076040468 10:127243515-127243537 CAGGTAGAAGGAAGGGCAGGTGG - Intronic
1076203748 10:128578605-128578627 CAGGACTGGGGGAGCGGAGGAGG + Intergenic
1076597429 10:131632956-131632978 GAGGCCTTGGGGAAGGCAGGAGG - Intergenic
1076616552 10:131759045-131759067 CAGGGCTGGGGGAGGGTGGGCGG - Intergenic
1077015988 11:399400-399422 CAGGTGGAGGAGGGGGCAGGTGG - Intronic
1077016034 11:399513-399535 CAGGTGGAGGGGGGGACAGGTGG - Intronic
1077185783 11:1234766-1234788 CAGGGGGCGGGGAGGGCAGGGGG + Intronic
1077309953 11:1883863-1883885 CAGGTGCTGGGCAGGGCAGGAGG + Intronic
1078452809 11:11453028-11453050 CAGGGCTGGGTGAGGGCAGGGGG - Intronic
1079560062 11:21811080-21811102 CAGGCATGGGGGTGGGCAGGAGG + Intergenic
1080316605 11:30957069-30957091 CCGCTATAGTGGAGGGCAGGAGG - Intronic
1080920461 11:36703759-36703781 TAGGTCTAGGGTAGGGCCCGGGG + Intergenic
1081551257 11:44114637-44114659 CTGGTCTAGGGTAGAGGAGGAGG - Intronic
1081647241 11:44798623-44798645 AAGGCCAAGGGGAGGGCAGGGGG - Intronic
1081812660 11:45922463-45922485 CAGGACGAGGGGAGGGCTGGGGG - Intronic
1082167189 11:48963373-48963395 ATGGTCTAGGGAAGGACAGGTGG - Intergenic
1082242312 11:49886518-49886540 ATGGTCTAGGGAAGGACAGGTGG - Intergenic
1082609877 11:55283201-55283223 ATGGTCTAGGGAAGGACAGGTGG + Intergenic
1083579988 11:63818650-63818672 CAGGTGAAGGGGAGGCCCGGGGG + Exonic
1083697654 11:64453463-64453485 CAGGTAAAGGAGGGGGCAGGAGG + Intergenic
1083775163 11:64891102-64891124 CAGGGATAGGGGAGGGCCGGGGG - Intergenic
1083876225 11:65525556-65525578 GTGGCCTAGGGGAGGGCAGCGGG - Exonic
1084084730 11:66849797-66849819 CAGATCCAGGGGAGGGAGGGAGG + Exonic
1084313774 11:68331961-68331983 CTGGGCTGGGAGAGGGCAGGTGG + Intronic
1084487272 11:69455922-69455944 CAGGTCTGGGGTAGGGCCTGGGG - Intergenic
1084552075 11:69850477-69850499 CAGGACTCGGGGAGGGGATGGGG - Intergenic
1084674929 11:70628765-70628787 CCTGTCCTGGGGAGGGCAGGTGG - Intronic
1084945715 11:72637283-72637305 TAGGGCTGGGGGAGGGGAGGCGG - Intronic
1085041869 11:73331444-73331466 CAGGAGTGGGGGAGGGGAGGTGG - Intronic
1085049387 11:73372290-73372312 CAGGGCCTGGGGAGGGCATGGGG + Intergenic
1085427013 11:76413669-76413691 TGGGTCCAGGGGAGGGGAGGTGG - Intronic
1085813915 11:79715464-79715486 AAGGCCTAGGGGAGGGGATGGGG - Intergenic
1086370671 11:86152498-86152520 CAGGACTAGGGGAGGGAGGCAGG + Intergenic
1087187368 11:95215249-95215271 CAGGTCTAGGGGTGGGGGGTGGG + Intronic
1087304491 11:96472827-96472849 TATGTCCAGGGGAGGGCAGCAGG - Intronic
1089048602 11:115526205-115526227 CAGGTGTAGGGTCAGGCAGGGGG - Intergenic
1089192348 11:116662076-116662098 GGGGTCTGGGGCAGGGCAGGGGG + Intergenic
1089316476 11:117594623-117594645 CAGGTCTGCGGGATGTCAGGTGG - Intronic
1089430198 11:118417272-118417294 CCTGTCAAGGGGAGGGCAGAGGG + Intronic
1089641149 11:119848027-119848049 CAGGAGAAGGGGAGGGCAGAGGG - Intergenic
1089730059 11:120513710-120513732 CAGGTCCAGAGGAGGACAGAGGG - Intronic
1089777545 11:120848781-120848803 CAGAGCTAGGGTAGGGGAGGAGG + Intronic
1089789135 11:120929782-120929804 CGGGTCTGGGGCAGGGCAAGGGG + Intronic
1089834441 11:121357637-121357659 CAGGTGGTCGGGAGGGCAGGTGG + Intergenic
1090640594 11:128726200-128726222 CAGCTTCAGGGGAGGGCAGGGGG - Intronic
1090941610 11:131392607-131392629 CAGGTTGAAGAGAGGGCAGGAGG + Intronic
1093657279 12:21709691-21709713 TAGGTCCATGGGAGGGCAAGTGG + Intronic
1094311409 12:29087420-29087442 CAGGGCTAGGGGAGGGGCTGGGG - Intergenic
1095507381 12:42911726-42911748 GAGGTCAGGGGGAGGGCAGAGGG + Intergenic
1096071148 12:48776184-48776206 CAGGGCCAGGGCAGGGCTGGGGG - Intronic
1096114933 12:49050252-49050274 CAGGGCTGGGGCAGGGCTGGGGG + Exonic
1096677585 12:53233887-53233909 CACCACTAGGGCAGGGCAGGAGG - Intergenic
1096796768 12:54082610-54082632 CCGGGCTGGGGGAGGGGAGGCGG + Intergenic
1096803438 12:54126508-54126530 CGGCTCTTGGGGAGGGCAGGCGG - Intergenic
1097781017 12:63704325-63704347 CAGCTCTGGAGGAGGGCATGAGG + Intergenic
1098241670 12:68473378-68473400 CAGCACTAGGGGAAGGGAGGTGG + Intergenic
1098347726 12:69524066-69524088 CATGGCTGGAGGAGGGCAGGGGG + Intronic
1099119333 12:78668425-78668447 CAGGGCAAGGGGATGGGAGGTGG - Intergenic
1099625802 12:85071877-85071899 CACGTCAAGGGCAGGCCAGGTGG - Intronic
1100442527 12:94629738-94629760 CAGGTCTGGGGAAGGGTTGGTGG - Intronic
1100807674 12:98304633-98304655 CAGGTCTTGTGGAAGGCTGGAGG - Intergenic
1101536613 12:105623677-105623699 CAGTTCAAGGGGAGGAAAGGTGG + Intergenic
1101540542 12:105660962-105660984 CAGGTCTGTGGGAGGGGTGGTGG - Intergenic
1101604120 12:106234942-106234964 GAGAGCAAGGGGAGGGCAGGTGG - Intergenic
1102519319 12:113468975-113468997 CAGTTCTAGGGCAAGGCAAGGGG - Intronic
1102650674 12:114440015-114440037 CCGGCCTAGGGGAGGCGAGGAGG + Intergenic
1102822981 12:115923933-115923955 CATGTCAAGTGCAGGGCAGGTGG - Intergenic
1102895376 12:116594465-116594487 CAGCACTAGGGTGGGGCAGGAGG + Intergenic
1104015375 12:124958305-124958327 CAGGTCTGGGGGAAGGCAGGAGG + Intronic
1104042632 12:125140258-125140280 CTGGTGTGGGGGTGGGCAGGGGG + Intronic
1104674482 12:130703479-130703501 GAGGGATTGGGGAGGGCAGGCGG - Intronic
1105765406 13:23554091-23554113 GAGGACTAGGGGAGGAGAGGAGG - Intergenic
1106587447 13:31069727-31069749 CAAGTCTAGGGGATGGCAGGTGG - Intergenic
1107132072 13:36907418-36907440 CAGGGCTTTGGGAGGCCAGGTGG + Intronic
1107567710 13:41623032-41623054 CTGGTCTAGGGGAAGCCACGTGG + Intronic
1108137072 13:47376413-47376435 CAGGTATAGGTGAGGGCATATGG + Intergenic
1110404046 13:75128729-75128751 CAGGTCTAAGGGAGGGGAGGTGG + Intergenic
1110599549 13:77356709-77356731 CAGGTTTAGGTGAGGTCATGAGG + Intergenic
1111940538 13:94602074-94602096 TAGGTCTGGGGGCGGGGAGGGGG + Intronic
1112018771 13:95353505-95353527 CAGCACTAAGGGAGGACAGGTGG - Intergenic
1112643782 13:101306491-101306513 CAGGACAAGGGCAGGGCAGAGGG - Intronic
1113929044 13:113956843-113956865 CAGGGCGAGAGGAGGGCAGGTGG + Intergenic
1114319651 14:21536771-21536793 CAGGGCAAGGGGAGGGCACTCGG - Intronic
1114458427 14:22872134-22872156 CAGGGCTGGGGGCGGGGAGGCGG - Exonic
1114618228 14:24079802-24079824 CAGGCTAAGGGGAGGGCAGATGG - Intergenic
1114669600 14:24402024-24402046 CAGGACTGGGGGAGGGCTGATGG + Intronic
1114779273 14:25520297-25520319 CAGCACTTTGGGAGGGCAGGCGG - Intergenic
1114920150 14:27316255-27316277 CAGGTATAGTGGGGGGGAGGGGG - Intergenic
1115119994 14:29927650-29927672 CTGGGCTGGGGGAGGGCAAGGGG + Exonic
1117186753 14:53247542-53247564 CAGGGCCAGGGGAGGGCAGGGGG - Intergenic
1117341722 14:54797761-54797783 CATGCCTAGAAGAGGGCAGGAGG + Intergenic
1117717983 14:58600263-58600285 CTGGTATAGGGGAGGGGAAGTGG - Intergenic
1117735653 14:58765864-58765886 GAGGTCAAGGGGAAGGGAGGTGG + Intergenic
1118310089 14:64685741-64685763 CAGGCCTAGGGAAGGGATGGTGG - Intergenic
1119599646 14:75966926-75966948 CAGGTGTAGGAGAGGTCATGGGG + Intronic
1119862811 14:77948798-77948820 CAGGTAGTGGGGAGGGAAGGAGG - Intergenic
1119866808 14:77981140-77981162 CTGGGCTGGGGGAGGGCAGCAGG - Intergenic
1121320622 14:92989673-92989695 CAGGCCTCGGGGAGGGAGGGAGG - Intronic
1122113880 14:99518250-99518272 CAGGTCCAGGCCAGGGCGGGCGG - Intronic
1122750214 14:103927856-103927878 GGGTTATAGGGGAGGGCAGGCGG - Intronic
1122802719 14:104239602-104239624 CTGGGCCAGGGCAGGGCAGGGGG + Intergenic
1122882460 14:104696275-104696297 CAGATCTTGGGGACTGCAGGTGG + Intronic
1123931144 15:25172239-25172261 TAGGACTAGGACAGGGCAGGTGG - Intergenic
1123989088 15:25670018-25670040 CAGGGCTGGGGGAGGGAACGAGG + Intergenic
1124150905 15:27177232-27177254 CAGGTCCAGGGGAAGTCAGTTGG + Intronic
1124329534 15:28797795-28797817 CAGCTCTACTGGGGGGCAGGGGG - Intergenic
1124644040 15:31422517-31422539 CATGTCAAGGGCAGGGTAGGTGG - Intronic
1125502059 15:40245978-40246000 CAGGTCTAGCAGAATGCAGGGGG - Intronic
1125599920 15:40909890-40909912 AAGGTCAAGGGGAGGACAAGGGG - Intergenic
1125719671 15:41839292-41839314 CAGGTCCAGGGCAGTGCTGGAGG - Intronic
1125922223 15:43531792-43531814 CTGGTCTGGGGGAGGGAAGAGGG + Intergenic
1126646729 15:50882320-50882342 CAGCTCAAGGGGAATGCAGGTGG - Intergenic
1126797891 15:52275081-52275103 TGGCTCTTGGGGAGGGCAGGAGG + Intronic
1127260580 15:57323843-57323865 CAGATCCTGGGAAGGGCAGGAGG + Intergenic
1127979800 15:64026176-64026198 CAGGGCTCTGGTAGGGCAGGTGG - Intronic
1127995274 15:64150307-64150329 GAGGTCTTGGGGTGGGCAGGAGG - Intergenic
1128444115 15:67741590-67741612 CAGCTCTAGGGTATGGTAGGTGG - Intronic
1128516347 15:68344279-68344301 TAGGTCTAGGGGGGCACAGGAGG + Intronic
1128990057 15:72252207-72252229 CAGGGCAAGGGGATAGCAGGAGG + Intronic
1129065624 15:72901607-72901629 CAGGTCTTGAGGAGTGGAGGAGG + Intergenic
1129451209 15:75652285-75652307 CAGGAGTAGGGCAGGGGAGGTGG + Intronic
1130062095 15:80577568-80577590 CAGCTCTTGGGGAGGGTATGTGG + Intronic
1130260550 15:82350797-82350819 CAGGTCCAGGGTGGGGCCGGAGG - Intergenic
1130280682 15:82518207-82518229 CAGGTCCAGGGTGGGGCCGGAGG + Intergenic
1130472054 15:84234390-84234412 CAGGTCCAGGGTGGGGCCGGAGG + Intergenic
1130479548 15:84348961-84348983 CAGGTCCAGGGTGGGGCCGGAGG + Intergenic
1130492222 15:84439168-84439190 CAGGTCCAGGGTGGGGCCGGAGG - Intergenic
1130652891 15:85772380-85772402 CAGGGCCAGGGTGGGGCAGGGGG - Intronic
1130880459 15:88051214-88051236 GAGGTGTAGGGTTGGGCAGGTGG - Intronic
1131619289 15:94050145-94050167 CATGCCCAGGTGAGGGCAGGGGG + Intergenic
1132697254 16:1207489-1207511 CAGGTCGAGGGGAGGGGTGTGGG + Intronic
1132721320 16:1317597-1317619 CAGGTCTAGTGGGGGGTGGGTGG - Intronic
1132868443 16:2104963-2104985 AAGGGCTAGGGGAGGGGAGGAGG + Intronic
1132868455 16:2104988-2105010 AAGGGCTAGGGGAGGGGAGGAGG + Intronic
1132868469 16:2105013-2105035 AGGGGCTAGGGGAGGGAAGGGGG + Intronic
1132940059 16:2502016-2502038 CAGGGCCAGGGGAGGGCACGGGG - Exonic
1132986409 16:2769826-2769848 CATGTGTGGGGGCGGGCAGGAGG - Intronic
1133029164 16:3001482-3001504 CAGGTCCCTGGGAGGGGAGGAGG + Intergenic
1133171123 16:3983079-3983101 CAGGGCTCGGGGAGGACACGGGG + Intronic
1133647245 16:7775849-7775871 CAGGGAGAGGGGAGAGCAGGGGG + Intergenic
1134024806 16:10945469-10945491 CAGCTCTGGGGGAGGACAGGTGG + Intronic
1134523117 16:14927644-14927666 AGGGGCTAGGGGAGGGAAGGGGG - Intronic
1134523146 16:14927699-14927721 AGGGACTAGGGGAGGGAAGGGGG - Intronic
1134523187 16:14927779-14927801 AAGGTCTAGGGGAGGGGAGGAGG - Intronic
1134549449 16:15132286-15132308 AAGGTCTAGGGGAGGGGAGGAGG + Intronic
1134549514 16:15132414-15132436 AGGGGCTAGGGGAGGGAAGGGGG + Intronic
1134710784 16:16326295-16326317 AGGGGCTAGGGGAGGGAAGGGGG - Intergenic
1134710813 16:16326350-16326372 AGGGACTAGGGGAGGGAAGGGGG - Intergenic
1134710854 16:16326430-16326452 AAGGTCTAGGGGAGGGGAGGAGG - Intergenic
1134837917 16:17377362-17377384 CATGTCTAGCTGAGGACAGGGGG - Intronic
1134948747 16:18342215-18342237 AAGGTCTAGGGGAGGGGAGGAGG + Intergenic
1134948788 16:18342295-18342317 AGGGACTAGGGGAGGGAAGGGGG + Intergenic
1134948817 16:18342350-18342372 AGGGGCTAGGGGAGGGAAGGGGG + Intergenic
1134955733 16:18381440-18381462 AAGCTCTAGGGGAGGGGAGGAGG + Intergenic
1134955772 16:18381520-18381542 AGGGGCTAGGGGAGGGAAGGGGG + Intergenic
1134955801 16:18381576-18381598 AGGGGCTAGGGGAGGGAAGGGGG + Intergenic
1135041770 16:19122875-19122897 CAGGTGGAGAGGAGGGGAGGAGG + Intronic
1135074699 16:19383286-19383308 CAGCTCTGGGGGATAGCAGGTGG - Intergenic
1135119586 16:19754053-19754075 CAGGTCTAGGTGGGGTGAGGTGG + Intronic
1135553768 16:23418619-23418641 CACGTCTGGGAGAGGGCTGGGGG - Intronic
1136024805 16:27462509-27462531 CAGGGCTTGGTGGGGGCAGGAGG + Intronic
1136036494 16:27544458-27544480 CTGGGCTGGGGGAGGGGAGGAGG + Intronic
1136170727 16:28487642-28487664 CAGGTCTGGGTGAGGGTAGTGGG - Exonic
1136234544 16:28905684-28905706 AAGGTGAGGGGGAGGGCAGGGGG - Exonic
1136369215 16:29825554-29825576 CAGGTTTAGGGCATGGCAGGTGG + Intronic
1136449123 16:30342796-30342818 GAGACCTTGGGGAGGGCAGGTGG - Intergenic
1136561110 16:31039837-31039859 CAGGGCTGGGGCAGGCCAGGGGG - Intronic
1137026952 16:35486303-35486325 CAGGGCCAGGGTAGGGGAGGAGG - Intergenic
1137044041 16:35639760-35639782 CAAGTCTGGGGTAAGGCAGGAGG - Intergenic
1138657829 16:58501022-58501044 CAGGGCTAGGGGACCCCAGGTGG + Intronic
1138667747 16:58586357-58586379 GAGGGGGAGGGGAGGGCAGGGGG + Intronic
1139952087 16:70677436-70677458 TGGGTCTAGGGGAGGGGATGGGG + Intronic
1140035928 16:71371276-71371298 CAAGTCTCAGGTAGGGCAGGGGG + Intronic
1140825209 16:78699969-78699991 TTGGTCTTGGGGAGGGGAGGTGG + Intronic
1140870372 16:79100975-79100997 AAGGTCTTGTGGTGGGCAGGGGG + Intronic
1141382369 16:83588021-83588043 CAGGTGTACGGGATGGAAGGAGG - Intronic
1141634414 16:85306327-85306349 CAGGTCTGCGTGAGTGCAGGAGG + Intergenic
1141692478 16:85604172-85604194 TAGGGCTAGGGGAGGGGAGAGGG - Intergenic
1141788776 16:86218815-86218837 CAGGTTGAGGGAATGGCAGGAGG - Intergenic
1141930207 16:87197096-87197118 CAGCTCATGGGAAGGGCAGGTGG - Intronic
1142002599 16:87672021-87672043 CAGGTGTAGGGCTGGGCAGGTGG + Intronic
1142046303 16:87927264-87927286 TAGACCTTGGGGAGGGCAGGTGG + Intronic
1142194569 16:88733478-88733500 CTGGGCTTGGGGAGGGCAGTGGG + Intronic
1142200581 16:88759421-88759443 CAGGCCAGGGGGAGGGCAGCTGG - Intronic
1142280702 16:89146209-89146231 CAGGTAGAGACGAGGGCAGGGGG + Intronic
1142686046 17:1577460-1577482 CAGGCCTGGGGAGGGGCAGGCGG + Intronic
1143252360 17:5533021-5533043 AGGGGCTAGGGGAGGCCAGGCGG - Intronic
1143576138 17:7794380-7794402 CAGGACGAGGGGAGGGTAGGAGG + Intronic
1143627836 17:8121461-8121483 CAGGTGTTGGGGAGGGCAGTGGG - Exonic
1143894157 17:10123667-10123689 AAGCTCTAGGTGAGGGCTGGTGG - Intronic
1144642904 17:16948390-16948412 CAGCACTGGTGGAGGGCAGGTGG + Intronic
1145960138 17:28882445-28882467 CACGTCCTGGGGAGGGAAGGGGG + Exonic
1146537703 17:33667287-33667309 CAGCAGTATGGGAGGGCAGGAGG + Intronic
1146538376 17:33673148-33673170 CAGGTGCAGGGGAGTGCAGGAGG + Intronic
1146902834 17:36599607-36599629 CAGGTCTTGGGGAGGTCGAGGGG - Intronic
1147337390 17:39735793-39735815 CAGGTCTGGGGTTGGGGAGGAGG - Intergenic
1147419098 17:40313224-40313246 CAGGTCCTGGGCAGGGCAGGAGG - Intronic
1147594209 17:41706197-41706219 CAGGGCTTTGGGAGGCCAGGAGG + Intergenic
1147660117 17:42112883-42112905 CAGGTTAAGGTGAAGGCAGGAGG + Intergenic
1148110583 17:45143005-45143027 CAGGCCTGGGGCAGGGAAGGTGG - Intronic
1148205792 17:45779037-45779059 CAAGTATAGGGCAGGGGAGGGGG - Intergenic
1148332786 17:46821994-46822016 CAGGTCTTGGGGCTGCCAGGCGG + Intronic
1148777098 17:50101950-50101972 CAGGTCCTGGGGAGGGGTGGGGG + Intronic
1149526169 17:57357473-57357495 AAGGTCTGGGGCAGAGCAGGAGG - Intronic
1150219017 17:63485380-63485402 CAGGTTTGGGGGTGGGGAGGTGG - Intronic
1150295524 17:64005415-64005437 CAGCTCCACTGGAGGGCAGGGGG - Intronic
1150469834 17:65427515-65427537 CAGGTTTAAGGGAGGGGATGTGG + Intergenic
1151177282 17:72299231-72299253 CAGGTCAAGGGCAGGGAATGGGG + Intergenic
1151335908 17:73439603-73439625 CAGGTCAAGGGGACCTCAGGGGG + Intronic
1151549992 17:74817016-74817038 GAGGTCTTGGGGAGGGACGGGGG - Intronic
1151566013 17:74898643-74898665 CAAGTCTAGGGGAGGGTGGCTGG - Intergenic
1151683316 17:75633242-75633264 CAGGGCCTGAGGAGGGCAGGGGG - Intronic
1151683599 17:75634390-75634412 CTGCACTAGGGGAGGGCTGGGGG + Intronic
1151702433 17:75750513-75750535 CAGGACTAGGGCAGAGCAGGTGG - Intronic
1151880520 17:76891945-76891967 CAGGCCTTGAGGAGGGCAGGGGG + Intronic
1152275455 17:79354069-79354091 CATGTCATGGGGAGGGCAGGGGG - Intronic
1152351464 17:79786021-79786043 CAGGTCCAGGGGAGTCCAGTGGG + Exonic
1152504730 17:80741320-80741342 CAGGTGGAGGGCAGTGCAGGAGG + Intronic
1152608551 17:81304811-81304833 CAGGAAAAGGGGAGGGCAGAGGG - Intergenic
1152656227 17:81520239-81520261 AAGGCCTAGGGGAGGGGTGGGGG + Intronic
1152697070 17:81802849-81802871 CAGGTCTAGGGAAATGCAGGTGG + Intergenic
1152727391 17:81954357-81954379 CAGCTCTAGGGGAGTGGGGGTGG - Intronic
1152935815 17:83136044-83136066 CAGGCCAGGGTGAGGGCAGGTGG - Intergenic
1153910928 18:9706414-9706436 CAGAACTAGGGGAGGGGAGAAGG + Intergenic
1157594741 18:48857737-48857759 CAAGTCCAGGGGAAGGTAGGTGG + Intronic
1157968392 18:52236706-52236728 CTGGTGGAGGGGTGGGCAGGGGG + Intergenic
1158962975 18:62601666-62601688 CAGGGCGAGGAGAGGGCAGCTGG + Intergenic
1160208642 18:76858627-76858649 CAGGTGGAGGCGAGTGCAGGTGG + Intronic
1160657518 19:281221-281243 CTGGTCCAGTGCAGGGCAGGGGG + Exonic
1160663269 19:311357-311379 AAGGTCTAAGGAAGGGCAGAAGG + Intronic
1160754495 19:750600-750622 CAGGGCTAAGAGAGGTCAGGTGG + Intergenic
1160951346 19:1669038-1669060 CTGGTCCTGGGGAGGGCAGCTGG + Intergenic
1161054926 19:2185973-2185995 CGGCTCTTGGGGAGGACAGGAGG + Intronic
1161058914 19:2204667-2204689 CATGTCCAGTGAAGGGCAGGTGG + Intronic
1161086863 19:2339457-2339479 CAGGTGCAGGGCTGGGCAGGTGG + Intronic
1161320365 19:3638147-3638169 CAGGTCACAGGGAGGGCCGGAGG - Intronic
1161352661 19:3802563-3802585 CAGATCTCGGGCAGGCCAGGTGG - Intergenic
1161608304 19:5227021-5227043 CAGCTCTCTGGGTGGGCAGGAGG - Intronic
1162094806 19:8304028-8304050 CAGGGGCAGGGGAGGCCAGGGGG + Exonic
1162372831 19:10289509-10289531 CAGTTCTAGGGGAGGGTGTGGGG - Intergenic
1162414158 19:10524369-10524391 CAGGCCTGGGGGTGAGCAGGTGG + Intergenic
1162497399 19:11030913-11030935 CAGGTCGAGGAGAAGGAAGGGGG + Intronic
1162582885 19:11541052-11541074 TGGGGCGAGGGGAGGGCAGGGGG - Intronic
1162899749 19:13787720-13787742 CAGGTCGAGGCGGGGGAAGGTGG - Intergenic
1162971428 19:14183406-14183428 GAGGTCTGGGGCGGGGCAGGGGG + Intronic
1163047921 19:14658597-14658619 CAGGCAGAGGGGTGGGCAGGTGG + Intronic
1163518386 19:17778509-17778531 CACGTCGAGGGAAGGTCAGGGGG - Intronic
1163677807 19:18664061-18664083 AAGGGCTGGGGGAGGGGAGGGGG - Intronic
1164603802 19:29581390-29581412 CATGTCAAGGGCAGGCCAGGTGG - Intergenic
1164646014 19:29859067-29859089 CAGGTCGAGGGGAGGGGACATGG + Intergenic
1165064379 19:33220460-33220482 AAGGCCGAGGGGAGGCCAGGAGG - Intronic
1165275283 19:34745713-34745735 CAGGTCTATGGGAAGGAAGGAGG + Intergenic
1165710321 19:38006161-38006183 CTGGTCTAGGGGAGTGGTGGTGG + Intronic
1166001362 19:39879508-39879530 GAGGTCCCCGGGAGGGCAGGAGG - Intronic
1166004145 19:39895759-39895781 GAGGTCCCCGGGAGGGCAGGAGG - Intronic
1166083283 19:40458339-40458361 GAGGTGTAGGGGAGGGCCGTGGG + Intronic
1166154386 19:40899948-40899970 CAGGCACAGGGGAGGGCAGAAGG - Intergenic
1166201185 19:41238773-41238795 GGGGTCTAAGGGAGGGCATGGGG + Intronic
1166302624 19:41921113-41921135 CAGCTCTGGGGGAGGGGAGAGGG + Intronic
1166343626 19:42152405-42152427 GAGGTTTGGGGGAGGGCAGCCGG - Intronic
1166356520 19:42230512-42230534 GAGGTCTGGGGGAGGGGAGGGGG + Exonic
1166714424 19:44957554-44957576 CAGGGCTAGGCAAGAGCAGGAGG - Intronic
1167166674 19:47803657-47803679 CAGGGCCAGGGGAGGGCCTGGGG + Exonic
1167175163 19:47860107-47860129 CAGGGCCAGGGGAGGGCCTGGGG - Intergenic
1167381073 19:49138382-49138404 CAGGGCTAGGGGGTGCCAGGCGG - Exonic
1167464913 19:49645599-49645621 CAGTGCTGGGAGAGGGCAGGAGG + Intronic
1167492822 19:49801946-49801968 CAGGTCACGGTGAGGACAGGCGG - Intronic
925182499 2:1826351-1826373 CAGGTCCTGGGGAGGGCTGGGGG + Intronic
925216958 2:2104789-2104811 CATGGTTGGGGGAGGGCAGGAGG + Intronic
925225791 2:2183195-2183217 CTACTCTAGGGGAGGCCAGGAGG - Intronic
925306089 2:2849048-2849070 TAGGACTAGGGGAGGGCCTGTGG + Intergenic
925310944 2:2881162-2881184 CAGGCAGAGGGCAGGGCAGGAGG - Intergenic
925423067 2:3727179-3727201 CAGGGGGAGGGGAGGGGAGGAGG - Intronic
925678960 2:6396656-6396678 CATGTCAGGGGCAGGGCAGGTGG - Intergenic
926163105 2:10501873-10501895 CAGGCCCAGTGGAGGGAAGGAGG - Intergenic
926224887 2:10960776-10960798 CAGGGCTGGGTGAGGGGAGGTGG + Intergenic
926734086 2:16059259-16059281 GAGGTCTAGGGAAGAGGAGGAGG - Intergenic
927041367 2:19233993-19234015 CAGGCCTAGGGTAAGGCAAGTGG - Intergenic
927104403 2:19811136-19811158 CAGGACTAGGGTATGGAAGGTGG + Intergenic
927725051 2:25415627-25415649 CAGGCCTTGGGGAGGGGAGAGGG + Intronic
927928152 2:27027110-27027132 CAGGGGGTGGGGAGGGCAGGTGG - Exonic
927930102 2:27038409-27038431 CAGGGCTAATGGAGGACAGGAGG + Intronic
928315387 2:30240546-30240568 GAGGACAAGGGAAGGGCAGGTGG - Intronic
928604059 2:32927776-32927798 CAGGAATCAGGGAGGGCAGGAGG + Intergenic
929489635 2:42384858-42384880 CAGAGCTGGGGGAAGGCAGGTGG - Intronic
930768442 2:55108568-55108590 CAGCTCTAGTGGAGGGATGGGGG + Intronic
931746203 2:65293789-65293811 CAGGTCTGGGGGGGGCCAGGGGG + Intergenic
931932943 2:67161201-67161223 CATGTCTAGGGGAGGGGGTGAGG + Intergenic
931954992 2:67413025-67413047 GAGGTCTAAGAGAAGGCAGGAGG - Intergenic
932236558 2:70125234-70125256 CAGGGGTAGTGGAGGGCAGAGGG + Intergenic
933648376 2:84830284-84830306 CCGGTCAAGGGGAGGAGAGGAGG + Intronic
933974376 2:87496790-87496812 CAGGACTTGCTGAGGGCAGGGGG - Intergenic
934102527 2:88666671-88666693 CAGCAGTTGGGGAGGGCAGGAGG - Intergenic
934187921 2:89763126-89763148 CAGGTCTTGGGGAGAGATGGAGG - Intergenic
934654171 2:96108731-96108753 CAGCTCTCCGGCAGGGCAGGCGG - Intergenic
935389984 2:102540877-102540899 GAGGTTTCGGGGAGGGCGGGTGG + Intergenic
935943173 2:108262737-108262759 AAGTTCTAGGGGAGGCCATGGGG - Intronic
936319448 2:111454029-111454051 CAGGACTTGCTGAGGGCAGGGGG + Intergenic
936376766 2:111947704-111947726 CAGGTAGACGGGAAGGCAGGTGG + Intronic
936451363 2:112636152-112636174 CAGGTGCAGGGGAAGGAAGGTGG + Intergenic
936998283 2:118437794-118437816 CCTGTCTGGGGGAGGGCAGCAGG + Intergenic
937126313 2:119476983-119477005 CAGGGGTAGGGGAGGGAAGGTGG + Intronic
937231373 2:120400003-120400025 CACGTCCAGTGGAGGGGAGGAGG + Intergenic
937236984 2:120437028-120437050 CAGGGCTGGGGGAAGGCAGCAGG + Intergenic
937312050 2:120908614-120908636 CAGGTCTGTTGGGGGGCAGGGGG - Intronic
937470686 2:122171712-122171734 GAGCTGTAGGGGAAGGCAGGAGG - Intergenic
937696107 2:124810426-124810448 CAGATACAGTGGAGGGCAGGGGG + Intronic
943667772 2:190628226-190628248 AAGGTCTTGGGGAGGGCACTGGG + Intergenic
944101953 2:196036666-196036688 AAGGTCCAGGGTAGGGCAGGTGG - Intronic
944732309 2:202529164-202529186 CATGTCCTTGGGAGGGCAGGGGG + Intronic
945942748 2:215966136-215966158 CAGGTCTAGGGAGGGAGAGGGGG + Intronic
946200410 2:218068076-218068098 CAGACCTGGAGGAGGGCAGGGGG + Intronic
946404596 2:219485513-219485535 TGGGGGTAGGGGAGGGCAGGAGG - Intronic
946633413 2:221697174-221697196 AAGGTGTATGGGAGGGCAGAGGG + Intergenic
947811875 2:233009874-233009896 CAGGTGGAGTGGAGGGAAGGTGG - Intronic
948664148 2:239524030-239524052 CAGGGCTGGGGGTGGGCAGGGGG - Intergenic
948693930 2:239723256-239723278 CAGTTCTAGGACAGAGCAGGAGG - Intergenic
948827387 2:240579240-240579262 CAGGAAGTGGGGAGGGCAGGAGG + Exonic
948855250 2:240727312-240727334 AAGGGAGAGGGGAGGGCAGGAGG + Intronic
1168890660 20:1293767-1293789 CTGGCCTGGGGGAGGGAAGGGGG - Intronic
1169218083 20:3804803-3804825 AAGTTCTAGGGCAGGACAGGAGG - Exonic
1169308755 20:4517502-4517524 CAGGCCGAGGGAAGGACAGGAGG + Intergenic
1169352965 20:4884514-4884536 CAGGTCTGTGGGTGTGCAGGAGG + Intronic
1169603308 20:7287065-7287087 CAGCTCTTGTGGAGGGCAGTGGG - Intergenic
1170188296 20:13617549-13617571 CAGCTCTACTGGGGGGCAGGGGG + Intronic
1170792805 20:19521597-19521619 CAGGTCTGGGGGAGGAGAGGAGG + Intronic
1170973895 20:21142224-21142246 CAGACCTAAGGCAGGGCAGGGGG - Intronic
1171167707 20:22986547-22986569 CAGAGCCGGGGGAGGGCAGGGGG + Intergenic
1171848213 20:30290599-30290621 CCGGCCTGGGGGAGGGGAGGCGG + Intergenic
1171971766 20:31569315-31569337 CAGCTCCAGGACAGGGCAGGGGG + Exonic
1172175502 20:32969755-32969777 TCGGGCTAGGGGAGGGAAGGTGG + Intergenic
1173226272 20:41164019-41164041 CAGGGCTGGGGGAGGGAAGATGG + Intronic
1173646692 20:44637700-44637722 CAGGCCCAGGGGAGGCCAGCAGG + Intronic
1173707022 20:45117684-45117706 GAGGTCTATGGCAGGGCAGGTGG - Intergenic
1173809998 20:45949740-45949762 TAGGTCTTTGGGAGGGTAGGAGG + Intronic
1174543619 20:51308496-51308518 CAGGTCCAGGGGAGGGAAGAAGG + Intergenic
1174680752 20:52405736-52405758 AAGGGCTAGGGGAGGGGAAGGGG - Intergenic
1174736751 20:52972314-52972336 CAGGTCGCGGGGAGAGGAGGAGG + Intergenic
1174861923 20:54099096-54099118 TTGGTCTAGGGGTGAGCAGGTGG + Intergenic
1175271842 20:57739554-57739576 CAGGTCTAGGGTGGGGCCTGAGG + Intergenic
1175404100 20:58715995-58716017 CAGGACCTGGGGAGGACAGGGGG + Intronic
1175461318 20:59153666-59153688 GAGGTCAAGGACAGGGCAGGAGG + Intergenic
1175541379 20:59750245-59750267 CAGGTCCAAAGGTGGGCAGGAGG + Intronic
1175828828 20:61951115-61951137 CAGGGCTGGGGGAGGGGAGAGGG - Intergenic
1175828847 20:61951150-61951172 CAGGGCTGGGGGAGGGGAGAGGG - Intergenic
1175923935 20:62462885-62462907 CAGGTCCAGTGGGGGGCAGGTGG + Intergenic
1176098890 20:63356170-63356192 CAGGGCCAGGGCAGGGCAGCAGG + Intronic
1176125545 20:63473007-63473029 GAGGGGGAGGGGAGGGCAGGGGG + Intergenic
1176152589 20:63599819-63599841 CAGGTCTAGGCGGGGGCAAGGGG - Intronic
1176235858 20:64053195-64053217 CAACTCTGGGAGAGGGCAGGTGG + Intronic
1176305630 21:5121673-5121695 CAGGCCTCGGGGAGGGAGGGAGG - Intronic
1177207015 21:18021976-18021998 TAGGTTTAGGGGAGGTCATGAGG + Intronic
1178362538 21:31961104-31961126 CAGGGCTTAGGGAGAGCAGGAGG - Intronic
1178409375 21:32350873-32350895 GAGGCCAAGGGAAGGGCAGGGGG + Exonic
1178968949 21:37154002-37154024 CTGCTTTAGGGGAGGGCAGGGGG - Intronic
1179416249 21:41200817-41200839 CAGATCAAGGTGTGGGCAGGTGG - Intronic
1179487015 21:41716944-41716966 CAGGTGTAGGTGGGGGCGGGAGG - Intergenic
1179714303 21:43279882-43279904 CAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179714333 21:43279953-43279975 GAGGTAGAGGGGAGGGGAGGTGG + Intergenic
1179714412 21:43280145-43280167 GAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179714420 21:43280161-43280183 GAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179714428 21:43280177-43280199 GAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179714436 21:43280193-43280215 GAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179714490 21:43280315-43280337 GAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179714650 21:43280684-43280706 GAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179714693 21:43280782-43280804 GAGGTGGAGGGGAGGGAAGGTGG + Intergenic
1179714701 21:43280798-43280820 AAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179724681 21:43335511-43335533 CTGGGGTAGGAGAGGGCAGGAGG + Intergenic
1179834579 21:44021725-44021747 CAGGGCTAGATGAGGTCAGGAGG + Intronic
1179851427 21:44140358-44140380 CAGGCCTCGGGGAGGGAGGGAGG + Intronic
1179873556 21:44255963-44255985 CCGGTCTAGGGGAGGGGGTGGGG + Intronic
1180085627 21:45506829-45506851 CAGGCCTAGGAGGGGGCCGGTGG - Intronic
1180182628 21:46124731-46124753 CAGGTTGGGGGGAGGGCATGGGG - Intronic
1180226971 21:46399467-46399489 TGGGTCTAGGGGAGGGCATAGGG + Intronic
1180700743 22:17780307-17780329 GAGGTCAAGAGGAGGGCGGGAGG + Intergenic
1180704868 22:17803097-17803119 CAGGTCTGGGGCAGGGCCTGAGG + Intronic
1180782677 22:18529697-18529719 CAGGTCTGGGGGAGGAGAGGCGG - Exonic
1180793770 22:18592018-18592040 GAGGCCTTGGAGAGGGCAGGGGG - Intergenic
1180949532 22:19714886-19714908 CAGGGCTGGGTGAGGGCCGGCGG - Intronic
1181126237 22:20703724-20703746 CAGGTCTGGGGGAGGAGAGGCGG - Intergenic
1181227970 22:21403302-21403324 GAGGCCTTGGAGAGGGCAGGGGG + Intergenic
1181239567 22:21469035-21469057 CAGGTCTGGGGGAGGAGAGGCGG - Intergenic
1181250683 22:21531537-21531559 GAGGCCTTGGAGAGGGCAGGGGG - Intergenic
1181807806 22:25385585-25385607 CTGGGCTGGGAGAGGGCAGGTGG - Intronic
1182082876 22:27541881-27541903 AAGGTCCAGGGTCGGGCAGGGGG - Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182254802 22:29030733-29030755 CAGGGCTGGTGGAGGGGAGGAGG + Intronic
1182458873 22:30470366-30470388 CAGGTCCAGAGGAGGGAAGGGGG - Intronic
1183311465 22:37112158-37112180 CAGGGCTGGGCCAGGGCAGGAGG + Intergenic
1183498076 22:38161797-38161819 CAGGCTGAGGGGAGGGAAGGAGG + Intronic
1183508029 22:38220199-38220221 CAGGTCTAGAGGTGTGGAGGGGG + Exonic
1183536414 22:38404216-38404238 CAGTGCTAGGGGAGGGCGGGAGG - Intergenic
1184341158 22:43886633-43886655 CAGGGCCAGGGGAAGGCAGAAGG - Intronic
1184924498 22:47627351-47627373 CAGCTCCAGGGAAGGGCCGGTGG + Intergenic
1184981534 22:48099281-48099303 CAGTTCTGGGAGAGGGCAGGTGG - Intergenic
1185266544 22:49907039-49907061 AAGGTCCTGTGGAGGGCAGGGGG - Intronic
1185314793 22:50174337-50174359 CAGGACTGGGGGAGGGCCGGGGG + Intronic
1185324351 22:50218398-50218420 CAGGGCTGGCGGAGGGCAGAAGG + Exonic
952302734 3:32118417-32118439 CAGGTCTGGGGTAGGGCCTGAGG + Intronic
953729843 3:45437990-45438012 TAGGTTAAGGGGAGAGCAGGAGG + Intronic
953878035 3:46677377-46677399 CAGCTGTAAGGGAGGGCAGAGGG - Intronic
953885287 3:46711577-46711599 CATGTCAGGGGAAGGGCAGGTGG - Intergenic
954155678 3:48683773-48683795 CAGGGCCAGGGGAGGGCTGGGGG - Intronic
954366001 3:50146497-50146519 CATGACTAAGGTAGGGCAGGGGG + Intergenic
954381491 3:50221351-50221373 GGGAGCTAGGGGAGGGCAGGGGG - Intergenic
954578649 3:51691099-51691121 CAGGTCTAGGAGACTGCTGGGGG + Intronic
954630987 3:52047501-52047523 CAGGCCTGGGCGAGGGCAGCAGG + Intergenic
954760590 3:52870895-52870917 AAGGTCTGGGGGAAGGCGGGTGG + Intronic
954846849 3:53566732-53566754 GAGCTCTCGGGGAGGGCTGGTGG - Intronic
954955431 3:54514555-54514577 CAGGTCAGTGGGAAGGCAGGCGG + Intronic
955867070 3:63396399-63396421 CATGTCTAGGGGGAGGAAGGAGG + Intronic
956080215 3:65549351-65549373 CAGGAAGAGGGGAGGGGAGGGGG - Intronic
956785448 3:72638490-72638512 CAGATCCAGGGGAGCCCAGGGGG - Intergenic
957790743 3:84937654-84937676 CATGACTAGGGGAGGTCATGAGG + Intergenic
959360694 3:105387178-105387200 CTGCTATAGGGAAGGGCAGGCGG + Intronic
960338376 3:116445646-116445668 CACGTCGAGGGGAGGGCGGAGGG - Intronic
960811623 3:121632275-121632297 CATGTCCAGGGGAGGGTAAGAGG - Intronic
961076965 3:123991781-123991803 CAGGGCAAGGGGAAGGCAAGGGG - Intronic
961307612 3:125969519-125969541 CAGGGCAAGGGGAGGGCAAGGGG + Intronic
961401627 3:126650392-126650414 CAGCTCTTTGGGAGGCCAGGCGG + Intronic
961811877 3:129526831-129526853 CAGGGCTAAGGCAGGGCGGGTGG - Intergenic
962205248 3:133428801-133428823 CAGGTCAGAGCGAGGGCAGGCGG - Intronic
962389923 3:134962780-134962802 CAGGAGGAGGGGAGGGCAGAGGG - Intronic
962419709 3:135217103-135217125 CAGGTCTAGGGCCTGGCAGGAGG - Intronic
962649890 3:137477822-137477844 CAGGGCAATGGGAGGGGAGGGGG + Intergenic
962799384 3:138877259-138877281 CGGGTCTAGGGAGGGACAGGAGG - Intergenic
962977630 3:140459543-140459565 CAGCGCTAGGGGATGGCAAGAGG - Exonic
963867442 3:150378040-150378062 CATGTCTCAGGGAGGGCAGTTGG - Intergenic
963994002 3:151685401-151685423 CAGGTGTAGGGCAAGGCATGGGG - Intergenic
964584531 3:158282081-158282103 CAGGGCTGGGGGTGGGGAGGTGG - Intronic
965140856 3:164832475-164832497 GAGGTCAAGGGGAGGGCATGGGG - Intergenic
965634735 3:170769552-170769574 CAGGTCTAGGGGAGGGCAGGAGG + Intronic
965908457 3:173740522-173740544 CAGGGGTATGGGAGGGCATGAGG - Intronic
967171054 3:186824147-186824169 CCGTTCTAGGGCAGGGCAGAGGG - Intergenic
967422157 3:189285320-189285342 CAGGCCTAGGCGAGGAAAGGCGG + Intronic
967845313 3:194038234-194038256 CAGCTCATGGGGAGGGAAGGAGG - Intergenic
967864782 3:194181261-194181283 CAGCTCTAGGGGAGGGCCCTGGG - Intergenic
968065062 3:195753951-195753973 CAGGCATAGGGGAGGGGACGGGG - Intronic
968292162 3:197547279-197547301 CAGGCCTAAGGGAAGGAAGGCGG + Intronic
968523772 4:1046187-1046209 GAGGGCTCGGGGAGGGCTGGGGG - Intergenic
968523821 4:1046304-1046326 AAGGGCTCGGGGAGGGCTGGGGG - Intergenic
968607953 4:1544455-1544477 CAGGTTAAGGGGCGGTCAGGAGG + Intergenic
968703842 4:2069225-2069247 CAGGTGTAGGGGAGCCGAGGTGG - Intergenic
968907694 4:3462286-3462308 GGGGTCTAGGGTAGGGCATGTGG + Intergenic
968914735 4:3492454-3492476 GAGCTCTAGGGAAGGGGAGGAGG + Intronic
969137773 4:5044428-5044450 CAGGGCAAAGGGAGGGAAGGAGG - Intergenic
969196745 4:5569228-5569250 CAGGTGTGGGGCAGGGGAGGTGG + Intronic
969317468 4:6390775-6390797 CAGGACTAGGTGAGTGCAGAGGG - Intronic
969421186 4:7097102-7097124 CGGGGCTGGGGGAGGGCAGCTGG + Intergenic
969575591 4:8034421-8034443 CAGGTGCAGGTGAGTGCAGGTGG + Intronic
969677335 4:8621341-8621363 CAGGACTCGGGGTGTGCAGGTGG + Intergenic
969678290 4:8626979-8627001 CAGGACTCGGGGTGTGCAGGTGG + Intergenic
969679246 4:8632617-8632639 CAGGACTCGGGGTGTGCAGGTGG + Intergenic
973620683 4:52722509-52722531 CAGGCCTAGGGGTGGGCTTGAGG - Intergenic
973646572 4:52956428-52956450 CAGGCTGAGGGAAGGGCAGGTGG + Intronic
973772254 4:54217716-54217738 CAGTGCTGGGGGAGGGGAGGAGG - Intronic
974020386 4:56687736-56687758 AAGGTCTGGGGAAGGCCAGGTGG - Intergenic
974043671 4:56879318-56879340 CAGCACTATGGGAGGCCAGGTGG + Intergenic
974220352 4:58961361-58961383 CAGTGCTATGGGAGGGCTGGAGG - Intergenic
976122967 4:81803098-81803120 GAGATCTATGGGAGGACAGGAGG - Intronic
976788010 4:88844676-88844698 CAGGTAGAGGGCAGGGCAAGCGG + Intronic
977666766 4:99652558-99652580 CAGGTCTGAGGAAGGGCAGTGGG - Exonic
978886579 4:113772597-113772619 GGGGTCAGGGGGAGGGCAGGGGG - Intergenic
982110743 4:152051194-152051216 CAAGTCAAGGAGAAGGCAGGAGG + Intergenic
982194995 4:152902501-152902523 CGGGTCTCGGGGTGGGCGGGGGG + Intronic
982391467 4:154868947-154868969 CAGCTCTAGAGGAGGGCCGCTGG - Intergenic
982846523 4:160259751-160259773 CAGCTCTTTGGGAGGGGAGGAGG - Intergenic
983833932 4:172366689-172366711 CAAGGTTAGGGGAGGGGAGGAGG - Intronic
984557601 4:181233987-181234009 CAGGTTTGTGGGAGGACAGGAGG - Intergenic
984824278 4:183910499-183910521 CAGGGCTGGGGGAGGGGAGAGGG - Intronic
984873289 4:184345992-184346014 CAGGTTTAGGTGCAGGCAGGAGG - Intergenic
985784831 5:1887996-1888018 CAGGGTTAGGGGAGGGCATGGGG + Intergenic
985926934 5:3026294-3026316 CAGGCCAGGGGGAGTGCAGGAGG - Intergenic
985994859 5:3592271-3592293 CGTGTCTCGGGGAGCGCAGGGGG - Intergenic
987120186 5:14760053-14760075 CAGGTCGGGGAGAGTGCAGGAGG + Intronic
987232937 5:15913930-15913952 CGGGGGTTGGGGAGGGCAGGGGG + Intronic
989125012 5:38044603-38044625 CAGGGCTGGGGGAGGGGGGGTGG - Intergenic
992448002 5:76851089-76851111 CAGGTCTAGAGGAAAGCATGAGG + Intronic
992624565 5:78625493-78625515 CAGGTTTGGGGGTGGGTAGGAGG - Intronic
993503068 5:88683626-88683648 CAGGTGTAATGGATGGCAGGGGG + Intergenic
994899586 5:105753994-105754016 TAGGTTTAGAGGAGGGCTGGAGG - Intergenic
997360499 5:133291756-133291778 CAGGTGTAGGGGAGGTGGGGAGG + Intronic
997370000 5:133353479-133353501 AAACTCCAGGGGAGGGCAGGAGG - Intronic
997647087 5:135488964-135488986 CCGGCCTGGGGGAGGGGAGGAGG - Intergenic
997652730 5:135534747-135534769 GCCGTCTAGGGGCGGGCAGGAGG + Exonic
999177226 5:149640000-149640022 CAGCCCTGGGGGAGGGGAGGAGG + Intergenic
999305033 5:150514003-150514025 TAGGGCTAGGGGAGTGCAGTGGG + Intronic
999829713 5:155306960-155306982 CAGGTAGATGGGAGGGGAGGTGG + Intergenic
1000082524 5:157861428-157861450 CAGGCCCAGGGGAGGGAAGGTGG - Intergenic
1000105404 5:158054402-158054424 CTGGTCTAGGAGAGGTCAGGAGG - Intergenic
1001406433 5:171480504-171480526 GAGGACTTGGGGAGGGGAGGAGG - Intergenic
1002180712 5:177429677-177429699 CTGGCCTGGGTGAGGGCAGGTGG - Intronic
1002295205 5:178226760-178226782 CAGGTAAAAGGAAGGGCAGGAGG + Intronic
1002300054 5:178252781-178252803 CAGGCTTGGGGGAGGCCAGGAGG + Intronic
1002354530 5:178614448-178614470 CAGCTACAGGGGAGGGCAGTGGG + Intronic
1003107689 6:3228247-3228269 GAGGCCTGGGGGAGGACAGGTGG + Intronic
1003714985 6:8636079-8636101 GAGGTCTAGGGGAGTGGTGGTGG + Intergenic
1003967191 6:11264100-11264122 CAGGTCTGGGGCAAGGAAGGAGG + Intronic
1004332940 6:14737843-14737865 CAGGGCAAGGGGAGGGGAGTGGG + Intergenic
1004366803 6:15019773-15019795 CAGCACTTTGGGAGGGCAGGTGG - Intergenic
1004383929 6:15155879-15155901 CAGCACTTTGGGAGGGCAGGTGG - Intergenic
1005009367 6:21321485-21321507 CAGGTCCGGTGGAGGACAGGTGG + Intergenic
1005417705 6:25619338-25619360 AAGGTTTGGGGGAGGGGAGGGGG - Intronic
1005436964 6:25822961-25822983 CAGTGGTGGGGGAGGGCAGGAGG - Intronic
1006023615 6:31132987-31133009 AAGGTCTGGGGGCGGGCTGGGGG + Intronic
1006271498 6:32969878-32969900 CAGGACTGGGGGAGGGGATGAGG - Intronic
1006385996 6:33731246-33731268 CAGGGCCAGGGGAGTGCTGGAGG - Intronic
1006507515 6:34498976-34498998 CAGGGTTAGGGGAGGGTTGGGGG + Intronic
1006509159 6:34512425-34512447 CAGGGCTGGGGGCCGGCAGGTGG + Intronic
1007358938 6:41341812-41341834 CAGGTCGCGGGGAGTCCAGGAGG - Exonic
1007384698 6:41512789-41512811 CAGGGCTGGGGGAGAGCAGAGGG - Intergenic
1007751318 6:44073564-44073586 CAGGTCTCGGGGAGGGGCCGCGG + Intergenic
1007811053 6:44485913-44485935 CCGGTGATGGGGAGGGCAGGGGG - Intergenic
1008018617 6:46550292-46550314 CAGGTCTAGGTGCTGCCAGGTGG + Exonic
1008548562 6:52605280-52605302 CAGGGGCAGGGGAGGGTAGGAGG + Intergenic
1010142140 6:72623207-72623229 AAGGTCTAGAGGAGGCCAGCAGG + Intronic
1011746920 6:90415196-90415218 CAGGTAAAGGGGAGGGCATGTGG - Intergenic
1012283298 6:97356744-97356766 CAGGTCTAGTGGGGGACAGTGGG + Intergenic
1012631970 6:101481811-101481833 CGTGTCAAGGGGAGGCCAGGTGG + Intronic
1013166230 6:107594847-107594869 TTGCTCTGGGGGAGGGCAGGAGG + Intronic
1013273480 6:108561924-108561946 CAGGGCAAGGGGTTGGCAGGGGG + Intronic
1016350842 6:143165540-143165562 CAGGTGGAGCGGAGGGCTGGTGG - Intronic
1016396770 6:143632071-143632093 CAGGGCCAGGGAGGGGCAGGGGG - Intronic
1017010262 6:150058490-150058512 CGGGGCTAGAGGAGAGCAGGCGG - Intergenic
1018219836 6:161566774-161566796 CTGGTGGAGGGGAGGGGAGGAGG - Intronic
1018417446 6:163613331-163613353 CAGGTCCAGGGCAGGGCCTGAGG + Intergenic
1018957309 6:168418818-168418840 CAGGCCTGGAGGAGGGCAGTGGG - Intergenic
1019064335 6:169283530-169283552 CAGGTGAATGGGAGGGCATGAGG + Intergenic
1019166552 6:170101321-170101343 CAAGTCTGAGGGAGTGCAGGGGG - Intergenic
1019272211 7:156654-156676 CAGGACCAGGGCAGGGCAGAGGG - Intergenic
1019338458 7:496051-496073 CAGGGCTAGGGGCCGGGAGGGGG + Intergenic
1019508463 7:1405214-1405236 CAAGTCAAAGGGAGGCCAGGTGG + Intergenic
1019641439 7:2105842-2105864 CAGCTCCAGGGTAGGGCAGCAGG + Intronic
1019652941 7:2170389-2170411 CAGGGAAAGGGGAGGGCAAGTGG + Intronic
1019678404 7:2329770-2329792 CAGGTCTGGGGCAGGGGCGGTGG - Intronic
1019709033 7:2510006-2510028 CAGGCCAAGGGGTGGGCAGCTGG - Intergenic
1019936701 7:4262746-4262768 GAGGTAGAGGGGAGGGGAGGGGG - Intronic
1020014905 7:4825184-4825206 CAGTTCTAGAAGAGGGCAGAGGG + Intronic
1020026283 7:4902338-4902360 CAGGTCTGGCCAAGGGCAGGAGG + Intergenic
1020282362 7:6656070-6656092 CAGGGCTGGGGGCGGGTAGGAGG + Exonic
1022100150 7:27164662-27164684 CAGGGCTACGGGAGAGGAGGCGG - Intronic
1022505019 7:30904297-30904319 CAGCTCTCGGTGAGGACAGGAGG + Intergenic
1022513181 7:30955795-30955817 CTGATCTCGGTGAGGGCAGGGGG + Intronic
1023192360 7:37596398-37596420 TAGGTTTAGGTGAGGTCAGGAGG - Intergenic
1023860577 7:44215758-44215780 CAGGTGTGTGGGTGGGCAGGTGG - Intergenic
1023869084 7:44253019-44253041 CAGCTCTAGGGGAGGCCCAGTGG + Intronic
1024050841 7:45622322-45622344 CAGGTCTAGTGGAGGGCAGATGG + Intronic
1024273669 7:47660294-47660316 CTGGTCCTGGGGTGGGCAGGTGG + Exonic
1026806916 7:73434543-73434565 CAGGTCTCCGGGAGGGCGCGCGG - Exonic
1027453066 7:78354875-78354897 AAGGTCTAGGAGTGAGCAGGAGG + Intronic
1027681924 7:81232737-81232759 CAGCACCAGCGGAGGGCAGGAGG + Intergenic
1028350258 7:89838329-89838351 CATCTCAAGGGGAGGGGAGGGGG - Intergenic
1028484188 7:91340404-91340426 GAGGCCTAAGGGAGGGCAGCAGG - Intergenic
1029615017 7:101650794-101650816 CAGGTCTCGGGCAGGGTTGGGGG + Intergenic
1029625745 7:101719165-101719187 GAGTTCTAGGGGTGGGTAGGAGG + Intergenic
1030836750 7:114297088-114297110 CAGGGAGAGGGCAGGGCAGGGGG + Intronic
1031008430 7:116499667-116499689 CAGGGCTAGGCGAGGCGAGGGGG + Exonic
1032451728 7:132037220-132037242 AAGGTCCAGGGGAAGGAAGGTGG + Intergenic
1032459836 7:132102445-132102467 GAGGCCTGGGGGAGGGCATGGGG + Intergenic
1032609303 7:133393960-133393982 CTGGTCTAGGAGAAAGCAGGAGG - Intronic
1033019353 7:137707145-137707167 CAGGTCTAAGGGAGGAGTGGTGG - Intronic
1033590202 7:142802434-142802456 CAGGAGTAGGGCAGGGGAGGCGG - Intergenic
1034460254 7:151194113-151194135 CAGGGCCTGGGCAGGGCAGGAGG + Intronic
1035251392 7:157599849-157599871 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251397 7:157599865-157599887 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251402 7:157599881-157599903 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251412 7:157599911-157599933 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251417 7:157599927-157599949 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251430 7:157599975-157599997 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251435 7:157599991-157600013 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251440 7:157600007-157600029 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251445 7:157600023-157600045 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251450 7:157600039-157600061 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251468 7:157600101-157600123 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251473 7:157600117-157600139 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251486 7:157600165-157600187 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251491 7:157600181-157600203 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251496 7:157600197-157600219 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251501 7:157600213-157600235 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035625229 8:1066453-1066475 CAGGTCTGGGTGAGGACATGAGG + Intergenic
1035898866 8:3435683-3435705 GAGGTCTGGGTGAAGGCAGGAGG - Intronic
1035970973 8:4248668-4248690 AATGTCTAGGGCAGGACAGGAGG - Intronic
1036798001 8:11769802-11769824 CAGATCTACCGGAGGGCGGGCGG - Exonic
1037493152 8:19414294-19414316 GGAGTCTAGGGGAGGGAAGGAGG + Intronic
1037820665 8:22133299-22133321 CCGGCCCAGGGGAGGGCAGCAGG + Intronic
1037836866 8:22219799-22219821 GAGGGCCAGGGGAGGGCAGTGGG + Exonic
1038357124 8:26839780-26839802 CAGGTCTTGGGGTGGGATGGTGG + Intronic
1038486932 8:27942501-27942523 CATGGCCAGAGGAGGGCAGGTGG - Intronic
1038598384 8:28911801-28911823 CAGGGTTGGGGGAGGGCAGAGGG + Intronic
1039119594 8:34130844-34130866 CAGCTCTAAGGGAGGGCAAGAGG - Intergenic
1039604918 8:38872327-38872349 CAGGCAGAGGGGAGGACAGGGGG + Intergenic
1039838980 8:41280134-41280156 CAAGTCCAGGGGAGTGCAGGGGG + Intronic
1039847722 8:41337553-41337575 CAGGCCAAAGGGAGGGTAGGAGG - Intergenic
1039916524 8:41864441-41864463 CAGCTCTCGTGGTGGGCAGGAGG - Intronic
1039984599 8:42436856-42436878 CAGGGATAGGGGTGCGCAGGCGG - Intronic
1040387087 8:46921016-46921038 CAGTTACAGGGGAGGGGAGGAGG + Intergenic
1040552968 8:48453091-48453113 CCGGAATATGGGAGGGCAGGGGG - Intergenic
1042247203 8:66720052-66720074 CAGGGCTGGGGCATGGCAGGTGG - Intronic
1042314320 8:67409483-67409505 CAGGGCTTTGGGAGGCCAGGTGG + Intergenic
1044058734 8:87605721-87605743 AAGGTGGGGGGGAGGGCAGGGGG + Intronic
1044412325 8:91897499-91897521 CAGAACTAGGTGAGGGCCGGAGG + Intergenic
1045876739 8:106990590-106990612 TAGGTTTAGGGGAGGTCATGAGG + Intergenic
1045949923 8:107840069-107840091 CAGGTTTAGGTGAGGTCATGAGG + Intergenic
1046354129 8:113056727-113056749 CAGGTCTAGGTGAGACCATGGGG - Intronic
1047519041 8:125580353-125580375 GAAGTCTAGGGAAGGGCAGTGGG + Intergenic
1048216393 8:132499551-132499573 CAGCTCTGGGGGAGGACAGGAGG - Intergenic
1049471533 8:142777054-142777076 CAGGTCGAGGGGAGGGCTCTCGG + Intronic
1049603126 8:143517289-143517311 CAGGTGCAGGGGAAGGGAGGGGG + Intronic
1049767468 8:144361605-144361627 CAGGGCTAAGGGTGGACAGGGGG - Intergenic
1049817935 8:144616635-144616657 CAGGAGGTGGGGAGGGCAGGGGG + Intergenic
1050005922 9:1130386-1130408 CAGATCTAGGGTAGGGCACAGGG - Intergenic
1051617201 9:19017571-19017593 CAGGTATAGGAGAGGCCAGAAGG - Intronic
1054175062 9:61869195-61869217 CCGGCCTGGGGGAGGGGAGGCGG + Intergenic
1054449908 9:65398206-65398228 CCGGGCTGGGGGAGGGGAGGCGG + Intergenic
1054662475 9:67711598-67711620 CCGGCCTGGGGGAGGGGAGGCGG - Intergenic
1055656281 9:78453057-78453079 CAGTGCCAGGGCAGGGCAGGGGG + Intergenic
1056198503 9:84251784-84251806 CAGGGAAGGGGGAGGGCAGGAGG - Intergenic
1057198834 9:93129808-93129830 CATGTGGAGGGGAGGGCAGCAGG + Intronic
1057397099 9:94689965-94689987 CAGGGAGAGGGGAGGTCAGGTGG + Intergenic
1058393451 9:104523149-104523171 CAGGTCTAGAAGGGGGCTGGAGG - Intergenic
1059796985 9:117708494-117708516 CTGGTCTAGGAGAGGGGAGTTGG + Intronic
1061052798 9:128205960-128205982 CAGGCCCAGGGCAGGGGAGGGGG + Intronic
1061228163 9:129293224-129293246 CAGGTCGGGTGGGGGGCAGGGGG - Intergenic
1061630480 9:131869193-131869215 GAGGACTTGGGGAGGACAGGAGG - Intronic
1061946274 9:133909910-133909932 CAGGGCAAGGGCAGGGCTGGGGG + Intronic
1062004435 9:134232114-134232136 CAGCCCCAGGGGAGGGCAGGAGG - Intergenic
1062268529 9:135698510-135698532 CCCTTCTCGGGGAGGGCAGGAGG - Intronic
1062403774 9:136383863-136383885 CAGGAGGAGGGGAGGGGAGGGGG - Intronic
1062464119 9:136673712-136673734 CATGACCTGGGGAGGGCAGGTGG - Exonic
1062520556 9:136955954-136955976 CAGGCCTGGGAGAGGGGAGGCGG + Intronic
1062721123 9:138044696-138044718 CAGGTGGACGGGAGGGCAGAGGG + Intronic
1187412498 X:19063318-19063340 CAGGGCTAGGGGAGTGGAGAGGG - Intronic
1188907254 X:35803304-35803326 CAGGTCCAGGGTGGGGCTGGAGG + Exonic
1189230895 X:39451521-39451543 AAGGGATAGGGGAGGGAAGGTGG - Intergenic
1189280931 X:39819925-39819947 AAGGTCAAAGGGATGGCAGGTGG + Intergenic
1189281747 X:39824022-39824044 CAAGCCTAGAGGAGGGCAGGAGG - Intergenic
1189816716 X:44831945-44831967 GAGGTCAAGGGGAGGGGGGGTGG - Intergenic
1190515189 X:51216513-51216535 CAGAGCTTAGGGAGGGCAGGGGG - Intergenic
1191898617 X:66018977-66018999 CAGCTCTAGGCCAGGGCAGATGG + Intergenic
1192204808 X:69088756-69088778 CAGGGCTCGGGGAGGGCTGCGGG + Intergenic
1193196637 X:78639691-78639713 CAGGTGTGGGGGTGGGGAGGTGG + Intergenic
1193283767 X:79687157-79687179 CAGGTCTAGGGAAACGCAGCTGG + Intergenic
1193784684 X:85746442-85746464 CAGCACTTTGGGAGGGCAGGAGG + Intergenic
1195537512 X:106025535-106025557 TACTTCTAGGGGAAGGCAGGTGG - Intergenic
1198064500 X:133083110-133083132 AAGTTCAAGGGGAGGGGAGGAGG + Intronic
1198257037 X:134932872-134932894 CTGGTGTGGGGGAGGGCTGGTGG - Intergenic
1198586729 X:138129535-138129557 CAGGTGCTGGGGAGGGCTGGAGG + Intergenic
1199037965 X:143076165-143076187 GAGGTCTTTGTGAGGGCAGGTGG + Intergenic
1199199165 X:145066994-145067016 CAGCACTTGGGGAGGGCGGGTGG - Intergenic
1199818184 X:151418873-151418895 CAGGTCCAGGGCAGAGGAGGAGG + Intergenic
1200094202 X:153649712-153649734 CAGGCCTTGGGGAGGACAGGAGG - Intronic
1200152008 X:153955774-153955796 CAGGGCAAGGGGAAGGCAGGAGG + Intronic
1200397452 X:155999509-155999531 CAGGGGTAGGGATGGGCAGGAGG - Intronic
1202384851 Y:24315867-24315889 GAGGAGTAGGGGAGGGGAGGAGG + Intergenic