ID: 965635889

View in Genome Browser
Species Human (GRCh38)
Location 3:170780080-170780102
Sequence GATATGTTCTGGGTTGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965635889 Original CRISPR GATATGTTCTGGGTTGCTGT AGG Intronic
901121925 1:6902524-6902546 GCTGTGGACTGGGTTGCTGTGGG + Intronic
904430904 1:30463351-30463373 GATCTGTTCTGGGTTTCAGGGGG + Intergenic
904715129 1:32462106-32462128 GATCTGTTGTGGTCTGCTGTGGG - Intergenic
904972565 1:34430475-34430497 GATATGTTCCTGACTGCTGTGGG - Intergenic
905395979 1:37666914-37666936 GAAAGGTTCTGGGGTGCTGATGG - Intergenic
909452609 1:75815169-75815191 GATATGATATTGGTAGCTGTGGG - Intronic
915107509 1:153543550-153543572 GATATGTTGTGGGGTGGTGGTGG - Intergenic
917937022 1:179878415-179878437 GATTTGTCCTGAATTGCTGTAGG - Intergenic
919407978 1:197208661-197208683 TAAATGTTCTGGTTTTCTGTTGG + Intergenic
920284830 1:204871909-204871931 GATGTGTACTGGTTTGTTGTTGG + Intronic
924302115 1:242650415-242650437 GACATTTACAGGGTTGCTGTTGG + Intergenic
1066143771 10:32535168-32535190 TTTATGTTCTGGGTTGTTGCTGG + Intronic
1066285709 10:33964151-33964173 GAAATGTTCTGAGTTGGTTTTGG - Intergenic
1067660943 10:48235798-48235820 GATATGTTCTGGGGAGCTCAGGG + Intronic
1070606360 10:77901187-77901209 GATAAGTTGTGCCTTGCTGTGGG - Intronic
1073548737 10:104377330-104377352 CATCTTTTCAGGGTTGCTGTAGG + Intronic
1076587731 10:131560833-131560855 GAGGTGTCCTGGGGTGCTGTGGG + Intergenic
1077558437 11:3239794-3239816 GGCATTTTCTGGCTTGCTGTGGG - Intergenic
1081414890 11:42802471-42802493 GATTTGTTTTGGTTTGTTGTGGG + Intergenic
1084964731 11:72738679-72738701 TGTATGTTCTTGGTTCCTGTTGG - Intronic
1085294696 11:75424557-75424579 GATTTGTTATAGGCTGCTGTGGG - Intronic
1087596772 11:100263941-100263963 GATAGGTACTGGATTGCTATGGG - Intronic
1089322845 11:117638108-117638130 GATGTGTTCTGGGTGGCTCCAGG + Intronic
1089610717 11:119667060-119667082 GATATGTACTGGGCAGCTGCTGG - Intronic
1091224889 11:133951293-133951315 GAAATGCTCTGAGGTGCTGTCGG - Intronic
1091489108 12:917413-917435 AAAATGTTCTGGATTTCTGTAGG - Intronic
1091520114 12:1230539-1230561 GATATGTTTTCTGCTGCTGTTGG + Intronic
1095545214 12:43360066-43360088 TATATGTTCTGGTCTTCTGTTGG - Intronic
1096867397 12:54572936-54572958 GACATGTGCTGGGATGCAGTGGG + Intronic
1101112470 12:101499576-101499598 GATGTGTTCTGGGGGGCTCTAGG - Intergenic
1102420890 12:112802039-112802061 GAAATACTCTGGGTTGCTGGAGG - Intronic
1103434629 12:120915243-120915265 GACTTGTTCTGGGATGGTGTGGG + Intergenic
1106249973 13:27975877-27975899 GACATGCTCTCGGTTTCTGTCGG - Intergenic
1107096728 13:36545512-36545534 GGTCTCTTCTGGGTTGCTCTAGG - Intergenic
1111171198 13:84528470-84528492 GCTATGTGGTTGGTTGCTGTGGG + Intergenic
1118911786 14:70067781-70067803 GTTATACCCTGGGTTGCTGTTGG - Intronic
1119651059 14:76383424-76383446 GATGTGTTCTTGGTTTCTGAAGG + Intronic
1120485627 14:85110149-85110171 GATATCAGCTGGGTTGCTGACGG - Intergenic
1120712508 14:87807451-87807473 GTTATCTCCAGGGTTGCTGTGGG + Intergenic
1121491495 14:94364338-94364360 GATATTTTCAAGGTGGCTGTAGG + Intergenic
1121526604 14:94623755-94623777 AAGATGTTCTGGGTGTCTGTAGG - Exonic
1123113242 14:105882596-105882618 GAGAAGTTCTGGGTTCCTGGGGG + Intergenic
1123115595 14:105892747-105892769 GAGAAGTTCTGGGTTCCTGGGGG + Intergenic
1123402576 15:20003032-20003054 GAGAAGTTCTGGGTTCCTGGGGG + Intergenic
1123511914 15:21009686-21009708 GAGAAGTTCTGGGTTCCTGGGGG + Intergenic
1124366641 15:29076550-29076572 GATATGTTCTGTGTCACTCTTGG + Intronic
1124619925 15:31267865-31267887 GATATGTTCTGTGTCCCTGAGGG + Intergenic
1126868820 15:52965610-52965632 GGTGTGTTCTGGGTTTTTGTGGG - Intergenic
1127469533 15:59278045-59278067 AGCATTTTCTGGGTTGCTGTTGG + Intronic
1127930417 15:63592879-63592901 GATGTGTTCTGGGAAGATGTGGG - Intronic
1128248163 15:66147182-66147204 GATATGGACTGGGCTTCTGTGGG - Intronic
1129166770 15:73782954-73782976 CATATGCTCTGGGTTGCTACTGG - Intergenic
1129945649 15:79537481-79537503 GATAGGTCCTGGGTGGCTGGGGG + Intergenic
1131232893 15:90672306-90672328 GATGTCTTCTGGGTTGCAGATGG - Intergenic
1131917714 15:97288594-97288616 AATCTGTTCTGGGTGACTGTGGG + Intergenic
1134623019 16:15703902-15703924 GCTTTGTTCTGGGTTGTTGTTGG + Exonic
1141205926 16:81933119-81933141 GAGCTGTTCAAGGTTGCTGTTGG + Intronic
1146324500 17:31874144-31874166 GACATGACCTGGGTAGCTGTGGG - Intronic
1147709329 17:42451028-42451050 GATTTTTTCTGGCTTACTGTGGG - Intergenic
1148056902 17:44804512-44804534 GTTATCTTCAGGGATGCTGTTGG - Exonic
1153602261 18:6792575-6792597 GAAGTGTTCTGGAATGCTGTGGG - Intronic
1158045784 18:53154037-53154059 GGTATTTTCTGTCTTGCTGTAGG + Intronic
1162838843 19:13340751-13340773 GTTCTGTTGTGGGTTGCAGTGGG + Intronic
1165221423 19:34319858-34319880 TTTAGGTTGTGGGTTGCTGTTGG - Intronic
925322503 2:2985352-2985374 CACATGTTCTTGCTTGCTGTGGG + Intergenic
926978449 2:18538721-18538743 GAGAGCTTCTGGGTTGCTGAAGG + Intergenic
928292534 2:30052212-30052234 GATATGCTCTGTGTTGATGCGGG - Intergenic
931541302 2:63332348-63332370 GAAATTTTCTGTGTTGCTCTTGG - Intronic
932179391 2:69632236-69632258 TATATGTTCTGGTCTTCTGTTGG - Intronic
932714657 2:74092611-74092633 GATATGTTCTGGGCTGAACTGGG + Intronic
935111370 2:100097492-100097514 GAGTTGTTCTGGGTTGCTCAAGG - Intronic
936123598 2:109767672-109767694 GAGTTGTTCTGGGTTGCTCAAGG + Intergenic
936221088 2:110603794-110603816 GAGTTGTTCTGGGTTGCTCAAGG - Intergenic
939824048 2:146993162-146993184 AATATGTACTCTGTTGCTGTTGG - Intergenic
940169884 2:150816680-150816702 GATATCTTGGGGTTTGCTGTAGG - Intergenic
945918996 2:215736341-215736363 GCTGTGTTTTGGGTTGATGTTGG - Intergenic
946198882 2:218058907-218058929 AATGTGTTCTGGGATGCTCTAGG - Intronic
947088833 2:226486947-226486969 GATGTTTTCTGCATTGCTGTAGG - Intergenic
947598961 2:231433159-231433181 GTTGTGTTTTAGGTTGCTGTAGG - Intergenic
1173653096 20:44680020-44680042 GATAGGTACAGGGTTTCTGTGGG - Intergenic
1174077569 20:47948745-47948767 GAGATTTGCTGGGCTGCTGTAGG + Intergenic
1176614841 21:9018384-9018406 GTTCAGTTCTGGGTTCCTGTGGG + Intergenic
1178428274 21:32496867-32496889 GATATATTCAGAGTTGATGTTGG + Intronic
1178816143 21:35931359-35931381 GCTATGTGCAGAGTTGCTGTGGG - Intronic
950023674 3:9806577-9806599 TATACGTTATTGGTTGCTGTGGG + Intronic
950423824 3:12914190-12914212 GGCATGTTCAGGGTAGCTGTGGG - Intronic
950449961 3:13059925-13059947 GGTATGCTCAGGGTTGCTGTGGG + Intronic
953211966 3:40884199-40884221 GATATATTCTGGGATGCTGCTGG - Intergenic
954771968 3:52978978-52979000 AATATGTACAGGGTTGCTTTTGG + Intronic
955011328 3:55018116-55018138 ACTGTGTTCTGGGTTGCTGTGGG + Intronic
956706532 3:72003907-72003929 GATATTTTCTGGGTTGGGTTGGG - Intergenic
957567654 3:81905571-81905593 GATATTTTCTGGGCTGCTTGTGG - Intergenic
958501616 3:94917712-94917734 GATGTTTTCTGTGTTGATGTGGG + Intergenic
961064775 3:123866149-123866171 GTTATGCTCTGGGGTTCTGTGGG - Intronic
962342600 3:134597881-134597903 CATATGATCTGTGCTGCTGTTGG + Intronic
962974813 3:140436772-140436794 GATAAGTTCTTGGTTGGTGGAGG + Intronic
965635889 3:170780080-170780102 GATATGTTCTGGGTTGCTGTAGG + Intronic
967612772 3:191527588-191527610 GCTATAATCTGGTTTGCTGTGGG - Intergenic
968729785 4:2264263-2264285 GATTTGTTCTGTGTGGCAGTGGG + Intergenic
969073852 4:4561448-4561470 GATGTTTGCTGGGTTGCTCTAGG - Intergenic
969839765 4:9872238-9872260 GAGATGGTCTGGGATGCTCTTGG - Intronic
970559661 4:17270092-17270114 GATGTGCTCTGGGCTCCTGTGGG - Intergenic
971869850 4:32220549-32220571 CATCTCTCCTGGGTTGCTGTGGG + Intergenic
980198283 4:129620351-129620373 GACATGTTCTGGGTAGCTGTTGG + Intergenic
982083035 4:151808564-151808586 GTTATGATCTGGGTGGCAGTTGG + Intergenic
986263458 5:6169905-6169927 GATATGTATTCTGTTGCTGTTGG - Intergenic
986538146 5:8814273-8814295 GATCTGTGCTTGGTTGCTGCAGG - Intergenic
986615962 5:9617838-9617860 CATGTGTGCTGGGATGCTGTTGG - Intergenic
986621822 5:9683795-9683817 GCTATGTTTTGGGTTGGGGTTGG - Intronic
987713059 5:21529030-21529052 AATATGTTCTAGTTTGCTCTTGG + Intergenic
988051677 5:26039212-26039234 ATTAAGTTCTGGATTGCTGTAGG + Intergenic
990689324 5:58345872-58345894 GTTACGTTCTGGGGTGCTGAGGG + Intergenic
1002155729 5:177277557-177277579 GATTTGTTTTGGTTTGCTTTTGG + Intronic
1002892159 6:1344053-1344075 AATATGTTCTCTGTTGTTGTTGG - Intergenic
1008475345 6:51930313-51930335 GACAGGTTCTGAGTTGCTGGTGG - Intronic
1009003662 6:57752881-57752903 AATATGTTCTAGTTTGCTCTTGG - Intergenic
1014318739 6:119898949-119898971 GAGTTGGCCTGGGTTGCTGTGGG - Intergenic
1014516858 6:122389646-122389668 GATATATTCTGTATTGCTTTTGG - Intergenic
1016449843 6:144170995-144171017 GCTATGTTCTGTATTGTTGTAGG - Intronic
1019109737 6:169700269-169700291 GAAATGTTCTGTGTTGCACTAGG + Intronic
1019880150 7:3852332-3852354 GATATGTGCTGCATTGCTGTGGG + Intronic
1020447925 7:8288765-8288787 GAAATGTTCTGGAATGATGTGGG - Intergenic
1024465881 7:49711304-49711326 CATGAGTTCTGGGTGGCTGTGGG + Intergenic
1027974853 7:85138921-85138943 GATATGCTCTGGCTTTCTATTGG + Intronic
1028134632 7:87212374-87212396 CATATTTTCTGAGTTGCTGAAGG - Intronic
1033242540 7:139692251-139692273 GTTATGTTCTAGGTAGTTGTTGG - Intronic
1037005349 8:13772058-13772080 GAAATGTTCTTTGTTGCTTTAGG + Intergenic
1037115032 8:15215581-15215603 GACATTTTTTAGGTTGCTGTGGG + Intronic
1041978526 8:63828120-63828142 CAGATGTTTTGGGTTGCTGTGGG + Intergenic
1043079644 8:75750021-75750043 GTTTTGTTTTGTGTTGCTGTGGG - Intergenic
1048435747 8:134415661-134415683 GATATATTCTGGCTTGCTCCTGG - Intergenic
1050893522 9:10855607-10855629 GAAATGTTCTGGGATTCTGTAGG - Intergenic
1056069161 9:82967957-82967979 GTTCTGTTCTGAGTTGCTTTGGG - Intergenic
1059975201 9:119708550-119708572 GATATGCTATGGGGTGCTATGGG - Intergenic
1059985003 9:119813114-119813136 GATTTGTTCTTGGGAGCTGTGGG + Intergenic
1060878311 9:127099218-127099240 GAAATGTTCTGGGGGGCTCTTGG + Intronic
1186630311 X:11341230-11341252 GATTTGTTCTGGGTTGACATGGG - Intronic
1187092797 X:16115030-16115052 GATATATATTTGGTTGCTGTGGG + Intergenic
1188796762 X:34476469-34476491 GATATTTTCTTGCTTTCTGTAGG + Intergenic
1189301132 X:39953082-39953104 GTTCTGTTCTGGGCTGCAGTGGG - Intergenic
1191038856 X:56057454-56057476 GTGATGTGCGGGGTTGCTGTTGG + Intergenic
1193591672 X:83395987-83396009 TATTTGATCTGGTTTGCTGTGGG - Intergenic
1195034338 X:100957872-100957894 GGAATGTGCTGGGCTGCTGTTGG + Intergenic
1199446027 X:147922621-147922643 GCTATTTTCAGGGTAGCTGTTGG + Intronic