ID: 965636243

View in Genome Browser
Species Human (GRCh38)
Location 3:170784174-170784196
Sequence CTATTATCTCAGAAGGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965636243 Original CRISPR CTATTATCTCAGAAGGAACT TGG Intronic
900872829 1:5316728-5316750 CTATTATTTTAAAAGGAATTTGG + Intergenic
902842393 1:19083308-19083330 CTTTTAACTCACAAGGAAATGGG + Intronic
907496543 1:54849030-54849052 GTCTTATGTCAGAAGGAACCTGG - Intergenic
910300750 1:85705036-85705058 CTATTATCTCACAAGGATCATGG + Intronic
910475251 1:87598904-87598926 CTGGTGTCTCAGAATGAACTTGG - Intergenic
913063379 1:115227880-115227902 CTATCATATGAGAAGGAATTAGG - Intergenic
914931146 1:151934695-151934717 CTATTATCTAATTAGGGACTTGG + Intergenic
917914039 1:179682784-179682806 CAATAATCTCAGAAGGTATTAGG - Intronic
922930590 1:229386111-229386133 CTATTATTTCAGCAGGCTCTGGG + Intergenic
924605354 1:245529609-245529631 CTATTTTCACACAGGGAACTTGG + Intronic
924854243 1:247859653-247859675 TTATTAGGTCAGAAGGAACTTGG - Intronic
1064723020 10:18249121-18249143 CTATTTTCTCAGATGAAATTAGG - Intronic
1065408704 10:25397459-25397481 CTATTATCTGTGTAGGAATTTGG + Intronic
1067116315 10:43437706-43437728 CTATTTCCTCAGAAGGAACTGGG - Intronic
1067699571 10:48559176-48559198 TTTGTATCTCAGAAGGAACCAGG + Intronic
1067778738 10:49182237-49182259 CTATTGTCTTGGCAGGAACTTGG + Intronic
1068064724 10:52115117-52115139 CAATTATCTTAGAAGGATTTAGG + Intronic
1069082261 10:64100995-64101017 CTATAATCCCAGAAGGGATTGGG - Intergenic
1069820725 10:71226004-71226026 ATAATATCTCTGTAGGAACTAGG - Intronic
1071894968 10:90056084-90056106 TTTTGATCTCATAAGGAACTTGG + Intergenic
1077736397 11:4796161-4796183 CGCTTGTCTCAGAAGCAACTTGG + Intronic
1078440581 11:11362905-11362927 CTATGCTCTCAAAAGGAAATTGG + Intronic
1079298112 11:19253008-19253030 GGATTATCTCAGAATGATCTGGG + Intergenic
1080340143 11:31253320-31253342 CTAATATCTACGATGGAACTGGG - Intronic
1080503325 11:32890144-32890166 CAATAAACTCAGAAGGAAGTGGG - Intergenic
1083010193 11:59389403-59389425 ATATTATCCAAGAAGGAACATGG - Intergenic
1086918174 11:92555447-92555469 CTGTTATCCCAGAGGGCACTTGG - Intronic
1087374716 11:97326586-97326608 CTATGATGTCAGTAGCAACTTGG - Intergenic
1089377132 11:118002330-118002352 TTATTTTCTCAGAATGAACTGGG - Intergenic
1089529558 11:119117595-119117617 CTGTTGCCTCAGAAGAAACTGGG + Exonic
1091904805 12:4176191-4176213 TTATTGAGTCAGAAGGAACTAGG - Intergenic
1092469957 12:8768670-8768692 CTATTACTGCAAAAGGAACTAGG - Intronic
1098519002 12:71414290-71414312 CCATTATCTCAGAAGTAAGGTGG - Intronic
1099226252 12:79972922-79972944 GAAATATCTCTGAAGGAACTAGG + Intergenic
1099513301 12:83564960-83564982 CTTTTATCTCAGAAGGACTAAGG + Intergenic
1101694528 12:107112580-107112602 CAATTGCCTCAGAAGGAAGTAGG + Intergenic
1102778028 12:115537885-115537907 CTTATAGCTCACAAGGAACTGGG + Intergenic
1103280202 12:119751482-119751504 CTAGTCTCTCAGAAAGAACAAGG + Intronic
1105791469 13:23804014-23804036 CTATTTTCTCAAAAGGAATTAGG + Intronic
1107413557 13:40179436-40179458 CTAATCTCTCAGAAGCCACTGGG + Intergenic
1107733854 13:43375415-43375437 CAAATATCTCAGAAGGACCTAGG - Intronic
1107768667 13:43765769-43765791 CTATGATTTCTGAACGAACTGGG - Intronic
1107985155 13:45769401-45769423 CTATTATTTGACAAGGCACTGGG + Intergenic
1108067652 13:46595019-46595041 CTATAAACTCAGAAGAAGCTAGG - Intronic
1109143206 13:58743177-58743199 CAATTAAGTGAGAAGGAACTGGG - Intergenic
1111818597 13:93186046-93186068 CTTGTATCTTATAAGGAACTTGG + Intergenic
1112104111 13:96221703-96221725 CTCATATATCAGAAGGAACAAGG + Intronic
1114781773 14:25546154-25546176 CTTTTATTTCAAAAGGTACTAGG + Intergenic
1114950429 14:27744521-27744543 TTAGTATCTCTGAAGGAAATAGG - Intergenic
1115536523 14:34378454-34378476 CTATAAACTCAGAATGGACTAGG - Intronic
1115936754 14:38561048-38561070 CTTTTATCCAAGAAGGAACATGG + Intergenic
1118075679 14:62296039-62296061 CCAGTACCTCAGAAGGTACTGGG - Intergenic
1118260224 14:64239343-64239365 CTATAAACTCAGAGGGAACTAGG + Intronic
1118944693 14:70373462-70373484 CTATGATCTTATAGGGAACTTGG + Intronic
1119780746 14:77275443-77275465 CTTATTTCTCAGTAGGAACTTGG - Exonic
1121467705 14:94126709-94126731 CTATGATGTCAGGAGAAACTGGG - Intergenic
1124149648 15:27166132-27166154 CTTTTATTTTAGAAGGAAGTTGG + Intronic
1124452314 15:29806526-29806548 CTTTGCTCACAGAAGGAACTTGG - Intronic
1127522045 15:59752838-59752860 CTATTATCTCAGAATCAAGAGGG - Intergenic
1130890449 15:88128998-88129020 CTATCATCTCATAATGAACCTGG - Intronic
1131100448 15:89684892-89684914 TTATAATCTCAGAAGGGGCTGGG + Intronic
1135605090 16:23817317-23817339 CTATAATCTCAGAAACTACTTGG - Intergenic
1137464007 16:48691536-48691558 CTATGATCCCAGCAGGGACTTGG + Intergenic
1139025113 16:62806565-62806587 CTATTGTCAGAGAAGGTACTTGG + Intergenic
1139177861 16:64711346-64711368 CCTTTATCTCAGAAGTAAGTAGG - Intergenic
1141449470 16:84088256-84088278 CTATTATCTCTTAAGCCACTTGG - Intronic
1142545658 17:700800-700822 ATTTTATCTCAGAAGGAATTAGG + Intronic
1145902179 17:28496296-28496318 CTCTTCTCCCAGAAGGCACTGGG - Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1149977678 17:61283151-61283173 GTAAAATCTCTGAAGGAACTAGG - Intronic
1153188462 18:2511904-2511926 CTACTATATCAGAAGAAACTGGG + Intergenic
1153426529 18:4971141-4971163 GTATTATTTCAGAGAGAACTTGG - Intergenic
1153649779 18:7229723-7229745 CCAGTATCTCAGAAGGCGCTGGG - Intergenic
1155008877 18:21755170-21755192 CCATTTCCTCAGATGGAACTAGG + Intronic
1155670084 18:28359483-28359505 CTATTATCTGTCAAGGAAATCGG + Intergenic
1158506328 18:58049255-58049277 GCATTAGCACAGAAGGAACTGGG + Intronic
1159317993 18:66804759-66804781 CTAATGTCTGAGAAAGAACTTGG + Intergenic
1167196616 19:48033452-48033474 CCATGGTCTCAGAAGGAAATAGG + Intronic
926151636 2:10428842-10428864 CCATTGACTCAGAAGGCACTTGG - Intergenic
928690831 2:33797092-33797114 CTCTTAACTCAGAAGAAGCTGGG + Intergenic
931128752 2:59307697-59307719 CTATTATTTCAGCCTGAACTGGG - Intergenic
931766858 2:65464598-65464620 CTTTTATGTTAGAAGGAAATGGG + Intergenic
931966952 2:67545169-67545191 CTTTTATCCAAGAAGGAACATGG - Intergenic
931973461 2:67616174-67616196 CTGGGAACTCAGAAGGAACTAGG + Intergenic
932843848 2:75114484-75114506 CAATGGTCTCAGAAGGTACTAGG - Intronic
933468140 2:82682708-82682730 CTGTTTTCTCAGAGGGAAATTGG - Intergenic
939400701 2:141689619-141689641 CTATTATCTCAGATTAAATTTGG - Intronic
939561914 2:143742526-143742548 CTCTTATGTCAGAAGAAATTTGG + Intronic
942328865 2:174800599-174800621 CAAATAGCTGAGAAGGAACTGGG + Intronic
942740697 2:179174226-179174248 CTTTCATCTCCGAAGGTACTGGG - Intronic
944536776 2:200718044-200718066 CTATTATCTCAGAATGTAAAGGG + Intergenic
945000969 2:205350097-205350119 CTGTTATATCAGAAAGACCTGGG + Intronic
945375109 2:209070864-209070886 CAATTATATGATAAGGAACTAGG + Intergenic
946143552 2:217712088-217712110 TTATTATCTCACAAGAAATTAGG - Intronic
1171335966 20:24385873-24385895 AAATGTTCTCAGAAGGAACTTGG + Intergenic
1173826845 20:46053287-46053309 CTAACATCTCAGAATGAAGTAGG - Intronic
1181333463 22:22112507-22112529 CTATTATATCAGAAGAAAATGGG - Intergenic
949793264 3:7816936-7816958 CTGTCATGTCAGAGGGAACTGGG + Intergenic
950966833 3:17152441-17152463 CTAACATCTCTGAATGAACTGGG + Intergenic
951243238 3:20311631-20311653 CTATTATCTCACCAGGAAATAGG - Intergenic
955111018 3:55950039-55950061 GTATTATCACAGAAGGTATTTGG - Intronic
955599706 3:60631864-60631886 GTTTCATCTCAGAAGAAACTGGG - Intronic
955693550 3:61613633-61613655 CTATGAAATCAGAATGAACTGGG + Intronic
957524618 3:81363759-81363781 CTAGAATCCCAGAAGGAATTTGG + Intergenic
957705310 3:83772537-83772559 CTATAACCTCAGAATGCACTAGG - Intergenic
959121739 3:102241108-102241130 CAATGACCTCAGAAGGAGCTGGG + Intronic
962665885 3:137653215-137653237 CTATTCTATGAGAAGGAAGTGGG + Intergenic
965636243 3:170784174-170784196 CTATTATCTCAGAAGGAACTTGG + Intronic
969116831 4:4875513-4875535 CGATGACTTCAGAAGGAACTGGG - Intergenic
969361552 4:6667254-6667276 CTCTTAACTCTGAAGGATCTGGG - Intergenic
971581199 4:28343260-28343282 CTATTATTTCACAGGGAAATTGG - Intergenic
972692875 4:41416865-41416887 CTAGTTTCTCAGAAAGAAATAGG + Intronic
974628275 4:64451932-64451954 CTATTTTCTCAGAAAAAAATAGG - Intergenic
976965057 4:91027752-91027774 CTATTGTATTAGAAGGAACCAGG + Intronic
977335130 4:95688199-95688221 AAATTATAACAGAAGGAACTTGG - Intergenic
978083844 4:104625622-104625644 CAATTATCTCTGAAGAAATTAGG + Intergenic
980254318 4:130357879-130357901 CTATTACCTTATAATGAACTAGG + Intergenic
981963612 4:150573878-150573900 CTTTTAACACAGTAGGAACTTGG + Intronic
983059672 4:163143598-163143620 CTATTATCTAGGAGGGGACTAGG + Intronic
987029840 5:13965684-13965706 CTGTTAATTCAGGAGGAACTGGG - Intergenic
990040620 5:51374910-51374932 CTATTCTATCAGAATGAACTGGG + Intergenic
990273108 5:54167062-54167084 CTTATAACTCACAAGGAACTGGG - Intronic
991157824 5:63459222-63459244 CTATTAAGTCAGTAGCAACTTGG + Intergenic
994547701 5:101187588-101187610 CTTTTATCTGAGAAGGAACATGG + Intergenic
996746183 5:126848084-126848106 CTATGATCCCAGAAAGAGCTTGG - Intergenic
997008905 5:129853412-129853434 ATATTATCTGAGAAAGAACAAGG + Intergenic
997380212 5:133430461-133430483 CTATCATCTCAGCAGGACTTGGG + Intronic
997655851 5:135553836-135553858 CTATGATCCCAGATGGGACTTGG + Intergenic
998304810 5:141063525-141063547 AAATTCTCTCAGAAGGAAGTAGG + Intergenic
1004536707 6:16510138-16510160 CTATGATCTGAAAAGGAACTAGG - Intronic
1008640486 6:53457419-53457441 CAATTATATGAGGAGGAACTGGG + Intergenic
1008846505 6:55971084-55971106 CCAGTGTCTTAGAAGGAACTTGG - Intergenic
1009688723 6:66998251-66998273 CTATTGTTTCTGATGGAACTTGG - Intergenic
1020864067 7:13533884-13533906 CTCTTATCTCTGAAGACACTGGG + Intergenic
1021906865 7:25343247-25343269 ATTTTAAATCAGAAGGAACTAGG + Intergenic
1024395962 7:48866973-48866995 AGATTATGTCAGAAGGAATTAGG + Intergenic
1030440710 7:109585079-109585101 CTATCATCTCAGAATGTGCTTGG - Intergenic
1030619880 7:111777371-111777393 ATATTATAACAGAAGGAACCTGG + Intronic
1030768509 7:113442055-113442077 CTTTTATCCAAGAAGGAACATGG - Intergenic
1031507429 7:122603270-122603292 CAAAAATCTCAGAAGGGACTTGG + Intronic
1031631313 7:124046569-124046591 ATATTATCCCAGAAGGAATATGG - Intergenic
1031951364 7:127895897-127895919 GAGTTATGTCAGAAGGAACTAGG - Intronic
1035495858 7:159325460-159325482 CTATTACCTCAGGATGCACTAGG - Intergenic
1038953493 8:32442541-32442563 CGAATATCTCAGAAGCCACTTGG - Intronic
1039757202 8:40536432-40536454 TTATTTTCTCAGAAGGTGCTGGG - Intronic
1040072199 8:43197613-43197635 TTATTATCTCAGAAAACACTTGG - Intronic
1041365431 8:57098154-57098176 CTATTTTCACAGAAGGAGTTAGG + Intergenic
1041555452 8:59149638-59149660 CTAGTATCTTAGTAGGAACCTGG + Intergenic
1043008813 8:74856084-74856106 TTACTGTCTCAGAAGGACCTAGG - Intergenic
1043082207 8:75781080-75781102 CTCTTATCTCAGAAGGATGAAGG - Intergenic
1046344814 8:112909755-112909777 CACTTATCTCAGAAGTAAATCGG + Intronic
1046540421 8:115573687-115573709 ACTTTATCTCAGAAGGAAATAGG - Intronic
1050125010 9:2347795-2347817 ATGTTATCTCAGTAGGAAGTGGG - Intergenic
1050825965 9:9946141-9946163 TTATTATCTTAGAAGGTACAAGG - Intronic
1050989731 9:12134749-12134771 CTCTTATCCAAGAAGGAACATGG - Intergenic
1053053979 9:34982930-34982952 CTTTTAGCTCAGGAGGAACTGGG - Intergenic
1053711363 9:40812856-40812878 CAATTTTCTCGGAAGGACCTGGG + Intergenic
1055956961 9:81783016-81783038 CTATAATCCCAGAAGGATTTTGG - Intergenic
1056201747 9:84283723-84283745 CTCTTATCTCAGATGGAGGTTGG + Intronic
1057437928 9:95059250-95059272 CTATTCTCTCAGGAGAAACAAGG - Intronic
1059682755 9:116602514-116602536 ATATTATATCAGGAGGAAATGGG + Intronic
1062222478 9:135424821-135424843 CTATTCTCTCTGAAGCTACTTGG + Intergenic
1185737103 X:2502314-2502336 CTGTGGTCTCAGTAGGAACTGGG - Intronic
1186034804 X:5410642-5410664 CTATTATTTCTGAACAAACTGGG - Intergenic
1187856260 X:23638462-23638484 CTGTGATCTGAGAAGGTACTTGG - Intergenic
1193374048 X:80736728-80736750 CTACTATGTCAGAAGGATCAAGG + Intronic
1195952929 X:110296246-110296268 CTAATTTCTCAGCAGAAACTGGG - Intronic
1197301981 X:124792055-124792077 GAATTATCTCAGAGGGAAATTGG + Intronic
1197580059 X:128270868-128270890 CTATTATGTTAGAAGGATCTGGG - Intergenic