ID: 965642962

View in Genome Browser
Species Human (GRCh38)
Location 3:170850439-170850461
Sequence ACAGAGAGACTATAAAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 194}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965642962 Original CRISPR ACAGAGAGACTATAAAGGGT TGG (reversed) Intronic
901207676 1:7506126-7506148 ACAGCGAGGTTATAGAGGGTGGG - Intronic
903814083 1:26051821-26051843 GCAGAGAGACTGGAGAGGGTGGG - Exonic
904545359 1:31266330-31266352 AAAGAGAAACTCTAAAGGGGAGG + Intronic
905298871 1:36972460-36972482 ACAGAGAGAGTGGAAGGGGTAGG + Intronic
907075826 1:51577104-51577126 ACAGAGAGAGTAGGAAGGGGAGG - Intergenic
909998599 1:82313565-82313587 ATAGAGAAACTGTAAAGGATTGG - Intergenic
911067458 1:93803268-93803290 ACATATAGAATGTAAAGGGTTGG + Intronic
911139388 1:94482454-94482476 ATAGAAAGACTATAAATGTTAGG + Intronic
913970627 1:143412970-143412992 AGAAAGAAACTATAAAGGGCTGG - Intergenic
914065003 1:144238581-144238603 AGAAAGAAACTATAAAGGGCTGG - Intergenic
914114148 1:144727773-144727795 AGAAAGAAACTATAAAGGGCTGG + Intergenic
916004683 1:160648794-160648816 ACAGGGAGACTTGAAAGAGTAGG + Intergenic
916302857 1:163294721-163294743 AAAGAGAGAGCATAAAGGTTTGG - Intronic
917230231 1:172828622-172828644 AGAGAGAAATTATAAAGGGCAGG + Intergenic
920549900 1:206850160-206850182 ACAGAGTGAAAATAAAGGGATGG + Intergenic
921416766 1:214897870-214897892 ACAGAGACACTTTTAAGAGTTGG + Intergenic
922194346 1:223346632-223346654 GCAGAGAGAGGCTAAAGGGTAGG - Intronic
923163267 1:231336677-231336699 GCAGAGAGACTTTGAAGGGGCGG - Exonic
924598000 1:245464056-245464078 GAAGAAAGACTAGAAAGGGTGGG - Intronic
924630202 1:245730568-245730590 ACAGATAGAAAATAAAGGGATGG + Intergenic
1066316242 10:34249673-34249695 AGAGACAGACCATACAGGGTGGG - Intronic
1070386623 10:75930970-75930992 ACAGATAGACTACAAAGTATTGG + Intronic
1072972428 10:100028809-100028831 CCAGAGGGACTATAAAGGGCAGG - Intergenic
1073689554 10:105792724-105792746 ACACAGAGACTAGAAATGGAAGG + Intergenic
1073854338 10:107657343-107657365 AGAGAGGAAATATAAAGGGTGGG - Intergenic
1074302297 10:112243351-112243373 AAGGAGACACTATAGAGGGTAGG - Intergenic
1074792714 10:116907334-116907356 ACAGAGAGGCAAGCAAGGGTCGG + Intronic
1075704916 10:124494785-124494807 ACAGACAAACTTTAAAGGGCAGG - Intronic
1077715216 11:4573874-4573896 ACATAGAGACTCAGAAGGGTGGG - Intronic
1078413333 11:11145649-11145671 AGACAGAGACTAGAAAGGCTAGG - Intergenic
1078446695 11:11410042-11410064 CCAGAGAGACAAAGAAGGGTGGG - Intronic
1079787231 11:24688927-24688949 ACAGTGAGACAATACAGGGAGGG - Intronic
1080870308 11:36230919-36230941 ACATAGAGACTATACACGGAGGG - Exonic
1082663142 11:55939725-55939747 ATAAAGAGACTATAATTGGTGGG - Intergenic
1085798328 11:79564272-79564294 ACAGAGAGAATATTCAAGGTGGG + Intergenic
1085938984 11:81185607-81185629 AAGGAGAGACTAAAAGGGGTAGG - Intergenic
1087540711 11:99514904-99514926 TCAGTGAGACTATGAAGGGTGGG + Intronic
1088041429 11:105388682-105388704 AAAGAGATACTATAAATGTTTGG + Intergenic
1088358342 11:108966409-108966431 ACAGAGAGCCTCTAAAGGGCTGG - Intergenic
1088636645 11:111827491-111827513 ACATAGAGACAATAAAAAGTTGG + Intronic
1090569436 11:128030689-128030711 ACAGAGAGACTTGAAAGACTTGG - Intergenic
1090842524 11:130504579-130504601 ACAGAGAGACTAAAAACAGAGGG - Intergenic
1091119015 11:133041444-133041466 GCAGAGAGACTGCAGAGGGTGGG - Intronic
1091196274 11:133733300-133733322 AAAGAGAGGCAATGAAGGGTGGG + Intergenic
1091743908 12:2978747-2978769 GAAGAGAGACTATCAGGGGTTGG - Intronic
1092685578 12:11041238-11041260 ACAGAGAGAAAATAAAGGGATGG + Intronic
1092693523 12:11143616-11143638 ACAGATAGAAAATAAAGGGATGG + Intronic
1092831966 12:12452868-12452890 TCAGACAGATTATAAAGGTTAGG - Intronic
1094098649 12:26736957-26736979 ACAGAGAGAAAACAAAGAGTTGG + Intronic
1095842739 12:46712192-46712214 ACAAAGATAATATAAAGGATAGG - Intergenic
1096564202 12:52462820-52462842 AGAGAGAGATTATAAAGAATTGG - Intergenic
1099532405 12:83800592-83800614 ACCGACAGACAATATAGGGTTGG + Intergenic
1101405696 12:104426681-104426703 ACAGAGTGAAAATAAAGGGAAGG + Intergenic
1102224273 12:111216937-111216959 ACTGAGGGACTAGATAGGGTGGG - Intronic
1102628140 12:114252810-114252832 ACAGATGGAGTATAAAGGCTTGG + Intergenic
1106114879 13:26808846-26808868 ACAGAGTGACTATAAATTGCAGG + Intergenic
1106405448 13:29469266-29469288 AAAGAGAGATTAGAAGGGGTGGG - Intronic
1106627986 13:31440853-31440875 ACACAGAGAGTACAAAGGGAGGG - Intergenic
1107240389 13:38226647-38226669 ACAGAGAGACTAGAAATTTTTGG - Intergenic
1111024672 13:82503737-82503759 ACAGATAGAGAAGAAAGGGTAGG - Intergenic
1112708444 13:102099213-102099235 ACAGAGAGAAGATAAATGGATGG + Intronic
1112735058 13:102407096-102407118 ACAGAGAGAAAAGAAGGGGTTGG - Intergenic
1112743195 13:102497687-102497709 AAAGAAACACTAAAAAGGGTAGG + Intergenic
1113436391 13:110295291-110295313 ACAGAGACACAATAAAGGAATGG + Intronic
1116047846 14:39766003-39766025 ACAGATAGAATACAAAGGGAAGG - Intergenic
1116529737 14:45955291-45955313 GAAGAGAGACAATAAAGGGAAGG - Intergenic
1117843779 14:59889292-59889314 ACAGTGAGACTAGATGGGGTAGG - Intergenic
1119491046 14:75033755-75033777 AGAGAGAAACTAGAAGGGGTGGG - Intronic
1119591716 14:75894754-75894776 AAAGATAGACAATAAAAGGTTGG + Intronic
1120292852 14:82598735-82598757 ACAGAGGGATTATAATGGGAAGG + Intergenic
1120838013 14:89058283-89058305 ACTGAGAGTCAGTAAAGGGTGGG - Intergenic
1124930111 15:34111592-34111614 ACACAGAGACTATACAAGGAGGG - Intergenic
1125204150 15:37132352-37132374 ACAAAGAGATTATAAGGGTTTGG - Intergenic
1126781674 15:52144308-52144330 ACAGAAAGAATATATTGGGTAGG - Intronic
1134539527 16:15053947-15053969 ACAGGGAGACATTAAAGGTTGGG - Intronic
1134834932 16:17353328-17353350 ACAGAGAGCCTGTTGAGGGTGGG + Intronic
1135402924 16:22178562-22178584 ACAGAAAGCCTCTAAAGGGTCGG + Intronic
1138132992 16:54498178-54498200 CCAGACAAACTATCAAGGGTTGG + Intergenic
1140429864 16:74893214-74893236 ACAGAGAGACTATCCTGGGTGGG + Intronic
1140946807 16:79776375-79776397 AGAGAGAGGCAAGAAAGGGTTGG - Intergenic
1141604093 16:85143128-85143150 ACAGGGGGACTAAAAAGGCTTGG - Intergenic
1142747590 17:1967623-1967645 AGAGAGAGACTGGAAAGTGTTGG - Intronic
1142908896 17:3070306-3070328 ACTGAGAGAGTCTCAAGGGTAGG + Intergenic
1142925669 17:3233936-3233958 ACTGAGAGAGTCTCAAGGGTAGG - Intergenic
1143079655 17:4372009-4372031 AAAGAAAGACTAGAAAGGGTGGG + Intergenic
1144592686 17:16537790-16537812 AAAGAAAGACTATAAAGAGCTGG - Intergenic
1148545208 17:48513415-48513437 ACAGTGAGAGTATAAGGGGGTGG - Intergenic
1148972757 17:51498633-51498655 ACAGAAAGGCCATAGAGGGTAGG + Intergenic
1149070561 17:52537034-52537056 AGAGAGAGACAATAAAGGAAAGG + Intergenic
1152372654 17:79899625-79899647 AAAGAGAGAATAACAAGGGTTGG + Intergenic
1203167072 17_GL000205v2_random:107197-107219 AGTGAGAGACTGTACAGGGTTGG - Intergenic
1157494534 18:48146432-48146454 ACAGAGAGGCTATATATGTTTGG + Intronic
1158340455 18:56460393-56460415 ACACAGAAACTAGAATGGGTAGG + Intergenic
1159005152 18:63004553-63004575 ACACAAAGACTCTCAAGGGTGGG - Intergenic
925080844 2:1064521-1064543 ACAGCGTGACTATAGAGGATGGG + Intronic
927808745 2:26170391-26170413 AAAGAGAGACCCTACAGGGTAGG + Intergenic
928499856 2:31879400-31879422 CCAGAGAGAGTATAAGGAGTAGG - Intronic
929700214 2:44156253-44156275 GCAGAGAGACTTAAAGGGGTAGG - Intergenic
933218804 2:79663663-79663685 ACAGAGAACATATAAAAGGTGGG - Intronic
933442209 2:82327318-82327340 ACAGACAGAATCTAGAGGGTGGG - Intergenic
934033372 2:88067304-88067326 GGAGAGAGACTGAAAAGGGTGGG + Intergenic
934492808 2:94773270-94773292 ACAGAAGGAATATATAGGGTTGG - Intergenic
938141335 2:128797143-128797165 ACACAGTGACTTTAAAGTGTTGG + Intergenic
938827091 2:135016796-135016818 AGAGAGATAATATAAAGGATAGG - Intronic
940559972 2:155282382-155282404 AAAGAGACACTGTAAAGAGTAGG - Intergenic
941213985 2:162682434-162682456 AGAGAGAGACTATAAAAATTTGG + Intronic
941321613 2:164062744-164062766 ACAGAAAGTCTGTAAATGGTTGG + Intergenic
941389717 2:164896874-164896896 ACAGGAAGTGTATAAAGGGTAGG - Intronic
944834563 2:203566028-203566050 ACAGAGTGTCATTAAAGGGTAGG - Intergenic
945630010 2:212262757-212262779 ACAGAGAGAAAATAAAGAGAAGG - Intronic
1170574803 20:17654178-17654200 ACAGGGAGACTGTGAAGGGAGGG - Intronic
1171972707 20:31573991-31574013 TAAGAGTGACTATAAAGGTTTGG + Intronic
1172038315 20:32025972-32025994 ACAGGGTGACTAGAGAGGGTAGG + Intronic
1172231474 20:33339543-33339565 ACACAGAGGCTATTAAGAGTTGG + Intergenic
1172556061 20:35842442-35842464 ACACAGAGTCTCTAAACGGTAGG + Intronic
1174901502 20:54505659-54505681 AAAGAGAGAGTATAGGGGGTGGG + Intronic
1176404687 21:6351902-6351924 AGTGAGAGACTGTACAGGGTTGG + Intergenic
1176432470 21:6637202-6637224 AGTGAGAGACTGTACAGGGTTGG - Intergenic
1177068931 21:16477510-16477532 ACAGAGAGAGTAGAAAGGATAGG - Intergenic
1177343671 21:19839151-19839173 AAAGAGAGAGAAAAAAGGGTGGG + Intergenic
1178174466 21:30080451-30080473 ACAGAAAGCCTATAGAGGCTAGG - Intergenic
1179146142 21:38769625-38769647 ACAGAGAGATGACAAAGAGTCGG + Intergenic
1179239523 21:39577232-39577254 AGAGAGAGAATATAAAGGCAAGG + Intronic
1184589616 22:45473187-45473209 AGAGAGAGACTATGAAGGCATGG - Intergenic
949270190 3:2207166-2207188 ACAGAGAGACTAGGAACGGCTGG - Intronic
951507758 3:23467668-23467690 ATAGTGAGGCTATAAATGGTGGG - Intronic
953039337 3:39241056-39241078 ACAGAGAGACTTTAAGGAGTTGG - Intergenic
956401367 3:68883402-68883424 AAAGAGAGACTATCCTGGGTGGG - Intronic
956540121 3:70327402-70327424 CCAGAGAGATTTTACAGGGTTGG + Intergenic
959080391 3:101794726-101794748 ACAGAGAGACTTGAGAGGGTAGG + Intronic
961983518 3:131106215-131106237 ACAGAGAGACTAAAGACAGTTGG - Intronic
962301386 3:134246346-134246368 AGAGAGAGAAAATAAAGGGTGGG + Intronic
962782723 3:138735944-138735966 AGAGAGAGAATATACAGTGTAGG - Intronic
964140904 3:153397566-153397588 AAAGAGGCACTAAAAAGGGTGGG - Intergenic
965642962 3:170850439-170850461 ACAGAGAGACTATAAAGGGTTGG - Intronic
967213358 3:187188501-187188523 AGAGAGAGAGTATAAGGGATTGG - Intergenic
967517278 3:190385091-190385113 ACACAGAGAAAATAAACGGTTGG - Intronic
970068250 4:12124025-12124047 AGAGGGAGACTATCAATGGTGGG + Intergenic
970371954 4:15417065-15417087 ACAGAGAAAGAATAAAAGGTGGG - Intronic
971121178 4:23706584-23706606 AGAGAGTGCCTATAAAGGGCTGG - Intergenic
976773704 4:88683358-88683380 ACTGAGAAACTATAAAGGATGGG + Intronic
978787153 4:112622601-112622623 ACAGACAGATTTTACAGGGTCGG - Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979551351 4:121994719-121994741 TCACAGAGACTATAAAGGAGAGG + Intergenic
980336384 4:131479205-131479227 TGAGAGAGACTATAAAGTGAAGG - Intergenic
982229446 4:153195150-153195172 ACAGAGACACCATAGAGGGAAGG + Intronic
983372449 4:166878722-166878744 AAAGAGAGACTCCAAAGGGCTGG + Intronic
986119106 5:4814238-4814260 AGAGAGAGAGTGCAAAGGGTGGG - Intergenic
987135344 5:14894727-14894749 AAAGAGAGACAATAAAAGGATGG + Intergenic
987954655 5:24722859-24722881 ACAGAGGGAATATAATGGGGTGG - Intergenic
990957464 5:61357780-61357802 ACAGAGAAATTATAAAAGGATGG - Intronic
991426957 5:66502175-66502197 ACAGAGTGTCTATAGAGGGATGG - Intergenic
992832743 5:80610692-80610714 AGAGAGAGAAAATAAAGAGTAGG - Intergenic
993115032 5:83710194-83710216 ACAGGGAGAATATGTAGGGTGGG + Intronic
993147267 5:84111315-84111337 ACAGACACACTATAAACTGTAGG - Intronic
993498164 5:88631848-88631870 CAAGAGAGACTAGAAAGGGTAGG - Intergenic
1001768917 5:174277715-174277737 ACAGAGAGAATACTAAGGGCTGG + Intergenic
1002961244 6:1916543-1916565 AGAGAGAGACGAAAAAGGGAGGG + Intronic
1003729731 6:8808056-8808078 AAGGATAGATTATAAAGGGTTGG + Intergenic
1005045853 6:21641623-21641645 ACAGAGATAGTATAAAAGCTAGG + Intergenic
1008707356 6:54179261-54179283 ACAGAGTGAAAATAAAGGGATGG - Intronic
1009288668 6:61856053-61856075 ACAGTGAGACTAGGAAGAGTTGG - Intronic
1009658449 6:66576959-66576981 AGAGAGAGACTATAAAAGAGAGG + Intergenic
1013770300 6:113620925-113620947 ACAGAGAGACAAGACAGGGTTGG - Intergenic
1018255192 6:161911541-161911563 ACAGAGACATTATCCAGGGTTGG - Intronic
1020992940 7:15224413-15224435 ACAGAGAGACAAAAAGGGGTGGG - Intronic
1021118835 7:16774213-16774235 ACAGAGAGATTTTAAAGAATTGG - Intronic
1022843796 7:34190370-34190392 ACACAGTGAGCATAAAGGGTGGG - Intergenic
1024097526 7:45995135-45995157 GCAGACAGACTAGAAAGGTTAGG + Intergenic
1024701864 7:51912162-51912184 ACAGAGAGACAATACGGTGTAGG - Intergenic
1027403951 7:77838616-77838638 ACAAAGATCCTATAAGGGGTGGG + Intronic
1027940342 7:84670609-84670631 ACAGATGGACTATTAAGGCTGGG - Intergenic
1029905846 7:104092932-104092954 ACTGAAAGATTATCAAGGGTGGG - Intergenic
1032575042 7:133044681-133044703 ACAAAAAGACTGTAAAGTGTTGG + Intronic
1033948893 7:146759358-146759380 ACAGAGACATTAGAAAGGGGAGG + Intronic
1034230632 7:149524756-149524778 AGAGAGAGATTATAAATGGGAGG + Intergenic
1036370910 8:8162276-8162298 AAAGAGAGATTATTCAGGGTGGG - Intergenic
1036879984 8:12503360-12503382 AAAGAGAGATTATTCAGGGTGGG + Intergenic
1038371739 8:27000552-27000574 ACAACTAGACTATAAAGGATAGG - Intergenic
1038400887 8:27283813-27283835 ACTGAGCGACAATAAAGGGAGGG + Intergenic
1039121763 8:34156047-34156069 ACACAGAGACTAAAAAGGAAAGG - Intergenic
1039383386 8:37107025-37107047 ACAGAGAGACAATAAAAGAAAGG + Intergenic
1042095415 8:65210601-65210623 ACAGTGAGTCTATAATGGTTAGG - Intergenic
1043090643 8:75898260-75898282 ACAGAGTGACAATAAAAAGTGGG + Intergenic
1043148537 8:76683552-76683574 ACAGAGTTAATAAAAAGGGTGGG - Intronic
1044157142 8:88861472-88861494 ACAGAGAGAGGATAAAGGGACGG - Intergenic
1044693106 8:94897422-94897444 AAAAAGAGAAAATAAAGGGTAGG + Intronic
1045672281 8:104568763-104568785 AAAGACAGACAATAAAGTGTTGG + Intronic
1046679490 8:117152697-117152719 ACATAGAGACTAGAAAGTGTGGG - Intronic
1047360186 8:124162065-124162087 ACGGAGAGACTATATGGGGAAGG + Intergenic
1050731502 9:8714516-8714538 ACAGAGATCCTATAATGGGGAGG - Intronic
1051238145 9:15023577-15023599 AAAGACAGAGTATAATGGGTAGG - Intergenic
1052168397 9:25362907-25362929 ACAGAAAGGCTAAAAAGGGCTGG + Intergenic
1055699881 9:78932358-78932380 CAAGAGAGACTAAGAAGGGTGGG + Intergenic
1058630444 9:106981021-106981043 AAAGACAGACTTTAAAAGGTGGG - Intronic
1060325274 9:122608596-122608618 ACAGAGAGACTACAGAGAGGTGG - Intergenic
1203439065 Un_GL000195v1:171510-171532 AGTGAGAGACTGTACAGGGTTGG + Intergenic
1185895691 X:3856871-3856893 ACAGATAGACAATAATAGGTAGG + Intergenic
1185900810 X:3895295-3895317 ACAGATAGACAATAATAGGTAGG + Intergenic
1185905925 X:3933734-3933756 ACAGATAGACAATAATAGGTAGG + Intergenic
1186134848 X:6508199-6508221 ACAGAGAGACAAAGAAGAGTAGG + Intergenic
1186200758 X:7153144-7153166 ACAATGAGATGATAAAGGGTGGG - Intergenic
1189358733 X:40331716-40331738 AGAGAGAGATTATAAGGGATTGG - Intergenic
1189499432 X:41542090-41542112 ACATACATACTATAAAGGGAAGG + Intronic
1189875811 X:45434620-45434642 AGAGAGGCACTAAAAAGGGTAGG - Intergenic
1189908968 X:45790409-45790431 ACAGAGACACTAAAAACAGTGGG - Intergenic
1190531215 X:51378598-51378620 ACATAGAGAATATAAAAAGTAGG + Intergenic
1193247567 X:79247028-79247050 ACATAGAGAAAATAAATGGTTGG + Intergenic
1194354927 X:92870973-92870995 AAAGGGAGACTATACTGGGTGGG + Intergenic
1195122832 X:101774387-101774409 AGAGAGAGACTTTATAGGTTTGG - Intergenic
1199988368 X:152968898-152968920 ACAGACAGAGCATGAAGGGTGGG + Intronic
1200663287 Y:5987990-5988012 AAAGGGAGACTATACTGGGTGGG + Intergenic