ID: 965645398

View in Genome Browser
Species Human (GRCh38)
Location 3:170875268-170875290
Sequence GTTAACTCCCTTGCATTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965645393_965645398 12 Left 965645393 3:170875233-170875255 CCTGTCCCCTGCTGATAAATGTT No data
Right 965645398 3:170875268-170875290 GTTAACTCCCTTGCATTTTCAGG No data
965645394_965645398 7 Left 965645394 3:170875238-170875260 CCCCTGCTGATAAATGTTTGTCT No data
Right 965645398 3:170875268-170875290 GTTAACTCCCTTGCATTTTCAGG No data
965645396_965645398 5 Left 965645396 3:170875240-170875262 CCTGCTGATAAATGTTTGTCTTT No data
Right 965645398 3:170875268-170875290 GTTAACTCCCTTGCATTTTCAGG No data
965645395_965645398 6 Left 965645395 3:170875239-170875261 CCCTGCTGATAAATGTTTGTCTT No data
Right 965645398 3:170875268-170875290 GTTAACTCCCTTGCATTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965645398 Original CRISPR GTTAACTCCCTTGCATTTTC AGG Intergenic
No off target data available for this crispr