ID: 965648332

View in Genome Browser
Species Human (GRCh38)
Location 3:170908304-170908326
Sequence CGTCGCCGCCGCGGCCGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 0, 2: 2, 3: 68, 4: 396}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965648327_965648332 -9 Left 965648327 3:170908290-170908312 CCTCCACCCTTCAACGTCGCCGC 0: 1
1: 0
2: 0
3: 6
4: 48
Right 965648332 3:170908304-170908326 CGTCGCCGCCGCGGCCGCACAGG 0: 1
1: 0
2: 2
3: 68
4: 396
965648323_965648332 -3 Left 965648323 3:170908284-170908306 CCCCGCCCTCCACCCTTCAACGT 0: 1
1: 0
2: 0
3: 12
4: 221
Right 965648332 3:170908304-170908326 CGTCGCCGCCGCGGCCGCACAGG 0: 1
1: 0
2: 2
3: 68
4: 396
965648321_965648332 18 Left 965648321 3:170908263-170908285 CCCTCTGCTAGCTGGCGCGCACC 0: 1
1: 0
2: 0
3: 1
4: 56
Right 965648332 3:170908304-170908326 CGTCGCCGCCGCGGCCGCACAGG 0: 1
1: 0
2: 2
3: 68
4: 396
965648325_965648332 -5 Left 965648325 3:170908286-170908308 CCGCCCTCCACCCTTCAACGTCG 0: 1
1: 0
2: 1
3: 18
4: 284
Right 965648332 3:170908304-170908326 CGTCGCCGCCGCGGCCGCACAGG 0: 1
1: 0
2: 2
3: 68
4: 396
965648320_965648332 22 Left 965648320 3:170908259-170908281 CCGGCCCTCTGCTAGCTGGCGCG 0: 1
1: 0
2: 0
3: 5
4: 112
Right 965648332 3:170908304-170908326 CGTCGCCGCCGCGGCCGCACAGG 0: 1
1: 0
2: 2
3: 68
4: 396
965648319_965648332 23 Left 965648319 3:170908258-170908280 CCCGGCCCTCTGCTAGCTGGCGC 0: 1
1: 0
2: 0
3: 16
4: 186
Right 965648332 3:170908304-170908326 CGTCGCCGCCGCGGCCGCACAGG 0: 1
1: 0
2: 2
3: 68
4: 396
965648324_965648332 -4 Left 965648324 3:170908285-170908307 CCCGCCCTCCACCCTTCAACGTC 0: 1
1: 0
2: 1
3: 21
4: 342
Right 965648332 3:170908304-170908326 CGTCGCCGCCGCGGCCGCACAGG 0: 1
1: 0
2: 2
3: 68
4: 396
965648326_965648332 -8 Left 965648326 3:170908289-170908311 CCCTCCACCCTTCAACGTCGCCG 0: 1
1: 0
2: 0
3: 1
4: 47
Right 965648332 3:170908304-170908326 CGTCGCCGCCGCGGCCGCACAGG 0: 1
1: 0
2: 2
3: 68
4: 396
965648322_965648332 17 Left 965648322 3:170908264-170908286 CCTCTGCTAGCTGGCGCGCACCC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 965648332 3:170908304-170908326 CGTCGCCGCCGCGGCCGCACAGG 0: 1
1: 0
2: 2
3: 68
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965648332 Original CRISPR CGTCGCCGCCGCGGCCGCAC AGG Intronic
900512975 1:3069053-3069075 CGCCGCCGCCGCCGCCGCCTCGG - Intergenic
900796576 1:4712034-4712056 GGTCGCCGCCCCGGCCGCCCCGG + Exonic
901084331 1:6601554-6601576 CCTGGCAGCCCCGGCCGCACGGG + Intronic
901483074 1:9539494-9539516 CGTGGCCGCCGGCGCCTCACCGG - Exonic
901540116 1:9910178-9910200 CGCCGCCGCAGCGGCTGCTCGGG - Exonic
901875920 1:12167100-12167122 CGTCGCCGTCTGGGCCGCGCTGG + Exonic
902350109 1:15847963-15847985 AGCCGCCGCCGCCGCCGCCCCGG + Exonic
903034442 1:20485319-20485341 CGTCGCCGCCGTCGCCGTAGGGG + Exonic
903115532 1:21176303-21176325 TGCCGCCGCCGCCGCCGCTCCGG + Exonic
903324742 1:22563451-22563473 CGCCGCCGCCGCCGCCGCCCCGG - Intergenic
903652326 1:24929787-24929809 TGCCGCCGCCGCCGCCGCAGGGG + Exonic
903750212 1:25616799-25616821 CCCCGCCGCCGCCGCCGCTCGGG - Intergenic
904585457 1:31577304-31577326 CGGCACGGCCGCGGCAGCACAGG - Exonic
904641988 1:31938059-31938081 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
904642013 1:31938139-31938161 CGCCGCCGCCGCCGCCGGGCCGG - Exonic
904769067 1:32870913-32870935 CGCCGCCACCGCCGCCGCGCGGG - Intronic
904822829 1:33256455-33256477 CGCCGCCGCCGCCGCCGCCTCGG + Intergenic
904822951 1:33256822-33256844 CGCCGCCGCCGCCGCCGCTCTGG - Intronic
905108369 1:35577229-35577251 CCTCGCCGCCGCAGCTGCCCTGG - Intronic
905449285 1:38046642-38046664 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
906140596 1:43531542-43531564 CGCCCCCGCCCCCGCCGCACAGG + Intronic
906204395 1:43979335-43979357 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
906365422 1:45205978-45206000 CGCCGGCGCCGGGGCCGCCCCGG + Exonic
906637015 1:47416490-47416512 GGCCGCCGCCGCCGCCGCCCCGG - Exonic
906960920 1:50419099-50419121 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
906961419 1:50421483-50421505 CGCCGCCGCCGTCGCCGCGCCGG + Exonic
907038356 1:51236444-51236466 CGTGGCCGCCGCCGCCCCGCGGG + Exonic
907429965 1:54406049-54406071 CGCCGCCGCCGCTACCGCTCCGG + Exonic
908355846 1:63324102-63324124 GGGCGCCGCCGCGGCCGCTGCGG + Exonic
913565562 1:120069428-120069450 CGCCGCCGCCGCCGCCGCCTGGG + Exonic
913632568 1:120724125-120724147 CGCCGCCGCCGCCGCCGCCTGGG - Intergenic
914237334 1:145823950-145823972 CGTCGCCGCCGCCGCCGCCTCGG + Exonic
914286160 1:146228803-146228825 CGCCGCCGCCGCGGCCGCCTGGG + Exonic
914619316 1:149390799-149390821 CGCCGCCGCCGCCGCCGCCTGGG - Intergenic
914702937 1:150150348-150150370 CGTCGGCGCCGCGGCGGCCTGGG + Intronic
915246348 1:154558628-154558650 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
916065505 1:161132641-161132663 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
916065512 1:161132650-161132672 CGCCGCCGCCGCGGCCGTGGGGG + Exonic
917817437 1:178725254-178725276 CGCCGCCGCCGCTGCCGCTCGGG - Exonic
919463241 1:197902936-197902958 CCGCCCCGCCGCGGCCGCCCCGG + Intronic
920924525 1:210329071-210329093 CGTTGCCGTCGCCGCCGCCCGGG + Exonic
921060182 1:211578740-211578762 AGGGGCCCCCGCGGCCGCACGGG + Exonic
922753736 1:228082871-228082893 TGTCGCCGCCGCCGCCGCGGGGG - Intronic
922958622 1:229626017-229626039 CGCCGCCCCCGCCGCCGCTCTGG + Exonic
923141332 1:231163149-231163171 CGCCGCCGCCGCTGCCTCTCTGG + Exonic
923171552 1:231421885-231421907 CGCCGCCGCCGCCGCCGCCATGG - Exonic
924289724 1:242524715-242524737 CCCCGCCGCCGCCGCCGCCCCGG - Intergenic
924754786 1:246931492-246931514 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1064208971 10:13347776-13347798 CGCCGCCGCCGCCGCCGCGCGGG - Intronic
1064443172 10:15371242-15371264 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1064981956 10:21174165-21174187 CCTCGCCGCCGCCGCCGCGCAGG + Intronic
1065023093 10:21516899-21516921 CGCCGCCGCCGCCGCCGCCTTGG + Exonic
1065099804 10:22321528-22321550 CGTGGCGGCCGCGGCTGCTCGGG + Exonic
1065883823 10:30059507-30059529 CGCCGCCACCGCCGCCGCTCCGG + Exonic
1065993163 10:31032072-31032094 AGTCGCCGCCGCAGGCGCCCCGG - Intergenic
1067178790 10:43969734-43969756 AGTGGCCCCCGCGGCTGCACAGG - Intergenic
1071618176 10:87094978-87095000 CGCCTCCGCCGCGGCCTCCCCGG + Intronic
1072719503 10:97771935-97771957 CGCCGCCGCCGCCGCCGCGGAGG + Exonic
1072915525 10:99535457-99535479 CGCCGCCGCCGCCGCAGCAGCGG + Exonic
1074121649 10:110497994-110498016 CGTCGCGGCCGCAGCCCCGCGGG + Exonic
1074814504 10:117134310-117134332 CGCAGCCGCCGCCGCCGCCCCGG - Exonic
1074843281 10:117375434-117375456 CGCTGCCGCCGCCGCCACACCGG - Exonic
1075032161 10:119030551-119030573 TGTCGCCGCTGGCGCCGCACAGG - Exonic
1075629316 10:123991683-123991705 CGCCGCCGCCGCCACCGCCCCGG - Intergenic
1075699761 10:124461795-124461817 CGCCGGCGCCGCGGCCGCGCAGG - Intergenic
1075801884 10:125159482-125159504 CGCCGCCGCCACTGCCGCGCGGG - Intronic
1075877913 10:125823159-125823181 GGTGGCCGCCGCGGCCCCTCGGG - Exonic
1076554209 10:131311519-131311541 AGCCGCCGCCGCCGCCGCCCTGG - Exonic
1076638912 10:131901018-131901040 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1077214546 11:1389998-1390020 CGCCGCCGCCGCCGCCGCCGAGG - Intronic
1077514241 11:2992150-2992172 GGCCGCCGCCGCGCCCGCGCCGG + Intronic
1079128503 11:17734844-17734866 CGTCGCGGCGGCGGCGGCAGCGG + Exonic
1079689409 11:23403540-23403562 CGCCGCCGCCGCCGCGGGACGGG + Intergenic
1081832051 11:46121967-46121989 CGCCGCCGCCGCCGCTGCACTGG - Intergenic
1083660891 11:64251414-64251436 AGTCGCCGCCCCGGCCGCCAGGG + Intergenic
1084385631 11:68841487-68841509 CATCCCTCCCGCGGCCGCACGGG + Intronic
1084973034 11:72781709-72781731 CGCCGCCGCCGCAGCTGCCCGGG + Intronic
1085485667 11:76860952-76860974 CGCCGCCGCCGCCGCCGCCCAGG - Exonic
1085561272 11:77474211-77474233 CGCAGCCGCCGCCGCCGCGCCGG - Intronic
1086887838 11:92224978-92225000 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1088332132 11:108665135-108665157 TGTCGCCGCCGCCGCCGCAATGG + Exonic
1089993427 11:122882898-122882920 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1090293860 11:125569475-125569497 CGGGGCCGCTGCGCCCGCACTGG - Exonic
1091248889 11:134124971-134124993 TGTCGTCGCCGCTGCCGCAGAGG - Intronic
1091248932 11:134125175-134125197 CGCCGCCACCGCCGCTGCACGGG + Intronic
1091550289 12:1530984-1531006 CGCCGCCGCCGCCGCCGCCCCGG + Intronic
1091558582 12:1594165-1594187 CGCCGCCGCCGCCGCCGCCTCGG + Exonic
1091823166 12:3491295-3491317 CGCCGCCGCCGCCGCCGCGGAGG + Exonic
1092743058 12:11649042-11649064 CGTCTGCGGCGCGGCCGCCCCGG + Intergenic
1094375404 12:29783757-29783779 CGCCGCCGCCGCTGCTGCCCTGG + Exonic
1094564937 12:31590853-31590875 GGCCGCCGCCGCCGCCGCCCGGG + Exonic
1095261743 12:40105952-40105974 AGCCGCCGCCACGGCCGCTCCGG + Intronic
1096983740 12:55743399-55743421 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1097891469 12:64781189-64781211 CGGCACCGCTGCGGCCGCCCAGG - Intronic
1098320714 12:69240149-69240171 CTTCCCCGCCGCTGCCGCTCGGG + Intronic
1099989765 12:89709325-89709347 CGCCGCCGCCGCTGCCGCCTTGG + Intergenic
1100089705 12:90954682-90954704 CGCCGCCGCCACCGCCGCCCAGG + Exonic
1100315623 12:93441988-93442010 CGTCGCCGCAGCCGCCGCCGAGG + Exonic
1100565623 12:95790909-95790931 CGCCGCTGCCGCTGCCGCCCGGG + Intronic
1100869443 12:98894981-98895003 CGCCGCCGCCGCTGCCGCCAGGG - Intronic
1101592898 12:106139193-106139215 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
1101605885 12:106247623-106247645 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1101605887 12:106247626-106247648 CGCCGCCGCCGCCGCCGCGGTGG + Exonic
1102256512 12:111418516-111418538 TGGCCCCGCCGCGGCCGCCCGGG + Exonic
1102370948 12:112382090-112382112 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1102854053 12:116277794-116277816 CGCCGCCGCCGCCGCCACTCCGG - Intergenic
1103308916 12:119989310-119989332 CGTCGCCGCCGCTGCTGCTGGGG + Intergenic
1103364012 12:120369332-120369354 CGCCGCCTCCGCGGGCGCCCGGG - Intergenic
1103377718 12:120469649-120469671 CGCCGCCGCCGCCTCAGCACGGG + Exonic
1103563599 12:121804679-121804701 CGTCTCCGCCGCGGCGGCGGCGG - Intronic
1103954250 12:124567588-124567610 CACCGCCGCCGCGGCCGCCGGGG - Intronic
1105031452 12:132887281-132887303 AGTCGCCGCCGCCGCAGCCCTGG - Exonic
1105409596 13:20160890-20160912 GGTCGCCGCCGCGGCAGAGCGGG - Exonic
1106157495 13:27171785-27171807 CGTCGTCGCCGCCGGCGCTCAGG + Exonic
1106208405 13:27620500-27620522 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1107604014 13:42040754-42040776 GGCCGCCGCCGCCGCCGCCCCGG - Intronic
1107624841 13:42272044-42272066 CGCCGCCGCCGCCGCAGCTCCGG - Intergenic
1108340661 13:49496012-49496034 CGTCGCCGCCCCGGCCCGAGAGG + Exonic
1108541498 13:51451736-51451758 CGCCGCCGCCGCTGCCGGGCCGG + Intronic
1112216315 13:97434311-97434333 CGCCGCCGCCGCCGGCGCCCAGG + Exonic
1113656115 13:112068545-112068567 CGCCGCCGCCGCCGCCGCCACGG - Exonic
1114866202 14:26598007-26598029 CGCCGCCGCCGCTGCCGGAGCGG + Intergenic
1115399235 14:32939123-32939145 CGCCGCCGCCGCCGCCGCCACGG + Intronic
1116821762 14:49634051-49634073 CGCCGTCGCCGCCGCCGCGCCGG - Exonic
1117424418 14:55580243-55580265 CGCCGCCGCCGCAGTCGCTCAGG - Intronic
1117875896 14:60249629-60249651 CGCCGCCGCCTCGGCCGACCAGG + Intronic
1118351002 14:64972369-64972391 CTGCGCCGCCGCCGCCGCCCCGG + Intronic
1118607700 14:67515405-67515427 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
1118849479 14:69573085-69573107 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1118854789 14:69612143-69612165 CGTCGCTGCCCGGGCAGCACCGG + Intronic
1119743212 14:77027300-77027322 CGCCGCCGCCGCCGCCGCTGCGG - Exonic
1122231199 14:100306975-100306997 CACCGCCGCCGCGGGCGCGCAGG - Intergenic
1122418693 14:101562309-101562331 CGTCGGGGCCACGGCCGCCCTGG - Exonic
1122444991 14:101761696-101761718 CGCCGCCGCCGCCGCCGCCGTGG + Intergenic
1122445014 14:101761778-101761800 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
1123024879 14:105419863-105419885 CGAGGCCGCCGAGGCCGCGCAGG - Exonic
1123024883 14:105419872-105419894 CGCCGCCGCCGAGGCCGCCGAGG - Exonic
1123024887 14:105419881-105419903 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
1202929126 14_KI270725v1_random:23288-23310 CCTCTCCGCCGCGCCGGCACCGG + Intergenic
1123464571 15:20506002-20506024 CGTGGGCGCGGCGGCCGCACCGG - Intergenic
1123653543 15:22495039-22495061 CGTGGGCGCGGCGGCCGCACCGG + Intergenic
1124109482 15:26773046-26773068 CGCCGCCGCCGCCGCCGCGCTGG + Exonic
1124275300 15:28321969-28321991 CGTGGGCGCGGCGGCCGCACCGG - Intronic
1124307404 15:28589632-28589654 CGTGGGCGCGGCGGCCGCACCGG + Intergenic
1124427074 15:29571026-29571048 CGCCGCCGCTGCTGCCGTACCGG + Intergenic
1124652506 15:31484004-31484026 CGCCGCCGCCGCCGCCGCCACGG - Exonic
1125508785 15:40282025-40282047 CGCCGCCGCCGCTGCGGCCCGGG - Exonic
1125522938 15:40358259-40358281 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1126034921 15:44537030-44537052 CGTCGCCGCCGCCGCCTGAGGGG + Intergenic
1126849868 15:52790365-52790387 CGCCGCCGCCGCCGCCGCAGCGG + Intronic
1127415031 15:58749551-58749573 CGCCGCCGCCGCCTCCTCACGGG + Exonic
1128651153 15:69414596-69414618 GGTCGCGGCCGCAGCAGCACCGG - Intronic
1130076676 15:80695579-80695601 CGGCGCCGGCGCGTCCGCCCCGG + Exonic
1130076692 15:80695621-80695643 CGCCGCCGCCGCGGCCCAGCCGG + Exonic
1130564420 15:84981685-84981707 CGCCGCCGCCGCCGCCTCCCCGG - Intronic
1130596692 15:85254278-85254300 TGTGGCAGCCGCGGCCGCTCAGG - Intergenic
1131215238 15:90530342-90530364 CGCCGAGGCCGCGGCCGCTCCGG - Intronic
1132342352 15:101086516-101086538 CGGCGGAGCCGCGGCCGCGCAGG - Intergenic
1132641876 16:981780-981802 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1132877959 16:2148664-2148686 CGCCGCCGCCGCCGCCGCCAGGG + Exonic
1133784352 16:8963358-8963380 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1135023799 16:18983992-18984014 CGCCGCCGCCGCCGCCTCCCCGG - Exonic
1136365176 16:29806409-29806431 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1136365216 16:29806483-29806505 CGTCGCCGCCGCCGTCGCCGCGG + Intronic
1136478253 16:30526426-30526448 CATCGCCGCCGCCGCTGCACTGG - Exonic
1136498835 16:30659691-30659713 CGTCGCCGCCGCCGCCCGCCAGG + Exonic
1138360746 16:56425436-56425458 TGCCGCCGCCGCCGCCGCGCCGG + Exonic
1138591179 16:58000526-58000548 CGTAGCGGCTGCGGCCGGACCGG + Intronic
1139637119 16:68264515-68264537 CGCCGCCGCCGCGGCAGCTCAGG - Intronic
1139761414 16:69187322-69187344 CGACGCCGCCGCGGCCGAGCTGG + Exonic
1140068055 16:71626642-71626664 CGGAGCCGCCGCAGCCGCAGAGG + Exonic
1140209183 16:72957815-72957837 CACCGCCGCCGCCGCCGCCCCGG + Exonic
1141418919 16:83899194-83899216 GGTTGCCCCCGCGGCCGCCCGGG + Exonic
1142177553 16:88651963-88651985 CATGGCCACCGGGGCCGCACTGG + Exonic
1142379207 16:89722033-89722055 CGTCGCCGGCCCGGCCTCCCCGG + Intronic
1142764328 17:2057104-2057126 CGCCGCCGCCGCCGCCCCGCAGG - Exonic
1142983625 17:3685460-3685482 CCTCTCCCCGGCGGCCGCACTGG - Intronic
1142990024 17:3724158-3724180 CGCCTCCGCCGCCGCCTCACCGG - Exonic
1143590887 17:7885330-7885352 CGCCGCCGCCGCCGCCACCCCGG + Intronic
1144109804 17:12020901-12020923 CGGAGCCGCCGCCGCCGCTCGGG - Exonic
1144910058 17:18673038-18673060 CGCCGCCGCCGCCGCCGCCTGGG + Exonic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1146132628 17:30291949-30291971 CGCCGCCGCCGCCGCCGAGCCGG - Exonic
1147200647 17:38799427-38799449 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1147719826 17:42532207-42532229 CGCCGCCGCCGCCGCCGCCCAGG + Intergenic
1148130900 17:45262159-45262181 CGTCCCCGCCGCGACCCCACAGG + Intergenic
1148356471 17:46978932-46978954 CGGCGGCGCCGGGGCCGCCCTGG - Exonic
1148899876 17:50867126-50867148 AGTCGCAGCCGGGGTCGCACCGG - Intronic
1150003656 17:61456649-61456671 CGTCGTCGCCGCCGCCGCCGCGG + Exonic
1150239801 17:63622502-63622524 CGGCGCCGCCGAGGCCGGGCTGG + Exonic
1150484870 17:65536834-65536856 TGCCGCCGCCGCGGCCGCGAGGG - Intronic
1151755335 17:76072449-76072471 CGCCGCCGCCGCCGCCGCCTGGG + Exonic
1152049141 17:77958950-77958972 CGCCGCCGCCGCCGCCGCCTAGG + Intergenic
1152714364 17:81891436-81891458 CCCCACCGCCGCGGCCGCCCTGG + Exonic
1153040816 18:812015-812037 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1154268212 18:12897117-12897139 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1155007507 18:21741525-21741547 CGCCGCCGCCGCTGCCGCCGGGG - Exonic
1155053819 18:22169038-22169060 CGCCGCCGCCGCGGCGGGAGGGG - Intergenic
1156099597 18:33578269-33578291 CGCCACCGCCGCGGCCGCTGCGG - Intergenic
1156213839 18:34976943-34976965 CGCCGCCGCCGCCGCCGCTCCGG - Intronic
1157260969 18:46174848-46174870 CTCCGGCGCCGCGGCCGCAGTGG + Intronic
1157384052 18:47247479-47247501 AGTCCCCGCCGCTGCCGCCCGGG + Intronic
1157384319 18:47248373-47248395 CGTGGCCGCCGCGGCCGCGGTGG - Intronic
1157464311 18:47930839-47930861 CTCCGCCGCCGCGGCCGCGCGGG + Intronic
1158954158 18:62523597-62523619 TGCCGCCGCCGCCGCCGCCCCGG + Exonic
1160706306 19:531784-531806 CTGCGCCGCCGCCGCCGCCCGGG - Exonic
1160873168 19:1286079-1286101 CGCCGCCGCCGCCGCCGAGCGGG - Intergenic
1160930464 19:1567639-1567661 CCCCGCCGCCGCCGCCGCCCCGG - Exonic
1160930699 19:1568301-1568323 CGCCGCCGCCTCGGCCGCCGAGG - Intergenic
1161080595 19:2308160-2308182 CGCCGCCGCCGCCGCCTCCCGGG + Intronic
1161397886 19:4054401-4054423 CCTCTCCGCCGCGGCCGTAGTGG + Exonic
1161701680 19:5799348-5799370 CGATGCTGCCGCGGCCGCCCCGG + Intergenic
1162485918 19:10960676-10960698 CGCCGCCACCGCCGCCGCAGTGG + Intergenic
1162751759 19:12833852-12833874 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1162751794 19:12833949-12833971 AGTCGCCGCCGCTGCCGCCATGG + Intronic
1163282463 19:16325815-16325837 GGCCGCCGCCGCGGCAGCCCTGG + Exonic
1163453239 19:17391225-17391247 CGCCGCCTCCCGGGCCGCACAGG + Intergenic
1163606979 19:18280983-18281005 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1163807252 19:19406450-19406472 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1164639162 19:29812095-29812117 CGTCGCCGCCGCCGCCTGCCGGG + Exonic
1165431418 19:35775582-35775604 CGTCGCCGCTGCCGCCGCCATGG - Exonic
1165803137 19:38565194-38565216 CGTCGCCCCCGCCGCCGCCGTGG - Exonic
1165924947 19:39320955-39320977 CGCCGCCACCGCCGCCGCAAGGG + Intergenic
1165928642 19:39342542-39342564 CGCCGCCACCGCCGCCGCTCGGG - Exonic
1166361253 19:42253868-42253890 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1166807694 19:45496977-45496999 CGCCGCCGCCGCCGCCGCCCTGG + Exonic
1167613362 19:50517798-50517820 CGTGGCCGCCGCGGCCGCCGTGG - Exonic
1167781653 19:51602310-51602332 CGTCTCCTCCACGGCCTCACTGG + Intergenic
925984822 2:9206996-9207018 CGCCGCTGCCGCCGCCGCTCCGG - Exonic
926217100 2:10912357-10912379 CGCCGCCGCCGCTGCCGCTGGGG - Exonic
927652293 2:24920042-24920064 CGCCGCCGCCGCGGGTGCAGGGG - Intergenic
927713819 2:25340915-25340937 CGCCGCCACCGCGGCCGCCCGGG + Intronic
927881457 2:26692709-26692731 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
928540275 2:32278078-32278100 GGTCGCCGCCGCGGCCGCCTCGG + Exonic
928904352 2:36355383-36355405 CGTGGCCGCAGCGGCCGGCCTGG - Intergenic
932306353 2:70706358-70706380 CCTCGCCGCCGCCCCCGCAGGGG - Exonic
933666860 2:84971283-84971305 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
934079052 2:88452278-88452300 CGCCGCCGCCGCCGCCCCCCGGG - Exonic
934079114 2:88452454-88452476 CGCCGCCACCGCCGCCGCCCCGG - Exonic
934248169 2:90324632-90324654 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248184 2:90324693-90324715 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248358 2:90325306-90325328 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248369 2:90325344-90325366 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248380 2:90325382-90325404 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248396 2:90325446-90325468 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934261193 2:91478105-91478127 CGCCGCCGCCGCCGCCGCCCCGG + Intergenic
934304465 2:91809922-91809944 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
934328792 2:92042828-92042850 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
935112318 2:100104804-100104826 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
935196646 2:100820245-100820267 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
935592441 2:104855292-104855314 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
935592782 2:104856389-104856411 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
935904388 2:107827415-107827437 CATCGCGGCCGCGGCCGGGCCGG - Intronic
939612998 2:144332478-144332500 CGTCGCCGGCTGGGCCGCGCCGG - Intronic
939629760 2:144517172-144517194 CGCCGCCGCCGCCGCCGCCTCGG + Intronic
942241115 2:173964682-173964704 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
942278193 2:174337443-174337465 CGCCGCCGCTGCCGCCGCCCGGG - Exonic
943060504 2:183037958-183037980 CGCCTCCGCCGCGGCCTCCCCGG + Intronic
943571506 2:189580771-189580793 CGCCGCCGCCGCCGCCGCCGTGG + Exonic
944221863 2:197310949-197310971 CGCTGCCCCCGCGCCCGCACCGG + Intronic
944412671 2:199458591-199458613 TGTCGCCGCCGCCTCCGCGCCGG - Intronic
944831219 2:203535342-203535364 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
945032955 2:205682311-205682333 CGTCGCCGCCCCGCCCGAGCTGG + Intronic
945466017 2:210171322-210171344 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
946325333 2:218981915-218981937 TGCCGCCGCCGCGGCCGCCCAGG - Exonic
946921424 2:224585152-224585174 CGCCGCCGCCGCGGCTGCCCAGG - Exonic
948645158 2:239400216-239400238 CGTCGCCGCTGCGAGCGCCCGGG - Intronic
1169171823 20:3471340-3471362 CGCCGCGGCCTCGGCCTCACAGG - Exonic
1169214727 20:3786510-3786532 CGGCGCCGCCGCCGCCGCCCCGG + Exonic
1172474460 20:35226680-35226702 CGCCGCCGCCGCCGCCGCCTCGG - Exonic
1173166205 20:40688864-40688886 CGCAGCCGCCGCTGCCGCCCGGG + Exonic
1173548169 20:43914873-43914895 CGCCGCCGCCGCGCCCGCCATGG + Exonic
1173672875 20:44810298-44810320 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1173741737 20:45406671-45406693 CGCCCCCGCCGCGGCCTCGCTGG + Intronic
1173813584 20:45971272-45971294 CAGCGACGCCGCGGCCGCCCCGG - Exonic
1175429537 20:58891708-58891730 CGCCGCCGCCGCCGCCGCCATGG + Intronic
1175847004 20:62064797-62064819 CGGCGCCGCAGCCGCCGCGCCGG + Exonic
1175847371 20:62065825-62065847 CGCCGCCGCCGCCGCCGCTCGGG + Intergenic
1176171187 20:63697098-63697120 CGTGCCTGCCGCTGCCGCACCGG + Exonic
1176207109 20:63895197-63895219 CGCCGCCGCCGCCGCCGCCCGGG + Exonic
1176548597 21:8212233-8212255 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176556491 21:8256441-8256463 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176567528 21:8395268-8395290 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1176575430 21:8439483-8439505 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1177011053 21:15730366-15730388 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1177011057 21:15730369-15730391 CGCCGCCGCCGCCGCCGCGGGGG + Exonic
1179511808 21:41878789-41878811 CGTCGTCGCCGAGGCCCCAGGGG - Exonic
1179674910 21:42974753-42974775 CGCCGCCGCCGCTGCCGCCCGGG + Intronic
1179674987 21:42974965-42974987 AGGCGCCGCCGCCGCCGCGCTGG + Intronic
1180014710 21:45074595-45074617 CGCCGCCGCCGCCGCCGCCACGG - Intronic
1181026853 22:20131825-20131847 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1181478092 22:23180833-23180855 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1181710693 22:24685939-24685961 CGACGCTGCCGCCGCGGCACTGG - Intergenic
1183247212 22:36703231-36703253 CGCCGCCGCCGCCGCTGCCCGGG - Exonic
1183912948 22:41092442-41092464 CCGCGCCGCCGCCGCCGCACCGG - Exonic
1183942257 22:41302305-41302327 CGTGGCCGCCGCAGCCGAAAGGG - Intronic
1184767035 22:46577398-46577420 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1185374291 22:50474964-50474986 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1203238467 22_KI270732v1_random:30913-30935 CGCCGCCGCCGCCGCCGCCGGGG + Intergenic
1203261535 22_KI270733v1_random:173616-173638 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
950583488 3:13878166-13878188 CGCCGGCGCCGCGGCCTCCCCGG - Intronic
951078513 3:18425155-18425177 CGCCGCCGCCGCTGCCGCTGTGG + Intronic
951080291 3:18444670-18444692 CGACGCCGGCGCGCCCGCCCGGG - Intronic
951907896 3:27721913-27721935 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
952241158 3:31532712-31532734 CGCCGCCGCCGCAGCTGCACTGG + Intronic
952796433 3:37243291-37243313 CGTCGCCGCCGCGGCTCCCGGGG + Exonic
953484984 3:43286629-43286651 TGTCGGCGCCGCGGCCGCTGCGG + Exonic
953526159 3:43691355-43691377 GCTGGCCGCGGCGGCCGCACCGG + Intronic
953908790 3:46881834-46881856 CGTCGCGGCCGGGGGCGCGCGGG + Intronic
953947773 3:47164011-47164033 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
955239341 3:57165363-57165385 CGCTGCCGCCGCGGCCGCCGCGG - Exonic
955911573 3:63863958-63863980 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
956678016 3:71753646-71753668 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
960664217 3:120094381-120094403 CGCCGCCGCCGCCGCCGCCCGGG - Intronic
961402139 3:126654961-126654983 GGTCGCCGCCGCAGTCGCCCGGG - Intronic
961780170 3:129316429-129316451 CAGCGCCGCCGCGCCCGCAGCGG + Intergenic
961827177 3:129605301-129605323 CGCCGCCGCCGCCACCGCCCGGG + Intronic
962301893 3:134250658-134250680 CGCCGCCGCCGCCGCCGAAGAGG + Exonic
965648332 3:170908304-170908326 CGTCGCCGCCGCGGCCGCACAGG + Intronic
966182200 3:177197562-177197584 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
967055460 3:185825495-185825517 CCTCGGCGCCGCGCCCGCCCGGG - Intergenic
967904101 3:194486792-194486814 CGCCGCCGCCGCGGGCGCGGAGG - Intronic
967965470 3:194956913-194956935 CGTCACCACCACGGCCGGACAGG + Intergenic
968701299 4:2059400-2059422 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
969716818 4:8871856-8871878 CGCCGCCGGGGCGGCCTCACTGG + Intergenic
970333008 4:15003720-15003742 CGCCGCCGCCGCCGCCGCCCGGG - Exonic
970456183 4:16226427-16226449 CGTCGGCGACGCGGCCGCTCCGG - Exonic
972321553 4:37977360-37977382 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
972396658 4:38664107-38664129 GGGAGCCGCCGCGGCCGCCCGGG - Intergenic
972740575 4:41882454-41882476 AGTAGCCGGCGCGGCCGCTCAGG - Intergenic
975986253 4:80203225-80203247 CGCCGCAGCCGCGGCTGCAGCGG - Exonic
978777310 4:112516502-112516524 CGAAGCCGCAGCGGCCGCAGAGG + Intergenic
981128490 4:141132926-141132948 CGTCCCGGCCGCGGCCCCTCCGG - Intronic
981270744 4:142845723-142845745 CGCCGCCGCCGCCGCCGGCCTGG - Intronic
986813660 5:11385161-11385183 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
988825323 5:34929736-34929758 CGCCGCCGCCGCCGCCGCTTCGG + Exonic
989576457 5:42992663-42992685 CAGCGCCGCCGCCGCCGCCCGGG - Intergenic
989812671 5:45696209-45696231 CGCCGCCGCCGCCGCCGCGACGG - Intergenic
990382990 5:55233754-55233776 CGTCGCCTCCGCGGCCCGCCGGG + Intergenic
990825429 5:59893356-59893378 CGCCGCCCCCGCCGCCGCCCGGG - Exonic
990955144 5:61332803-61332825 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
990955148 5:61332806-61332828 CGCCGCCGCCGCCGCCGCGGGGG + Exonic
992105521 5:73447213-73447235 CGCTGCCGCCGCCGCCGCGCAGG - Exonic
992105782 5:73448196-73448218 CGCCGCCGCCGCCGCTGCGCGGG + Exonic
993502375 5:88678410-88678432 CGTCGCTGCCGCTGCCGCCGCGG + Intergenic
993901219 5:93585113-93585135 CGGCGCCGCCGCCGCCGCCGCGG - Exonic
994107323 5:95961738-95961760 TGCCGCCGCCGCCGCCGCTCCGG + Exonic
995106327 5:108381292-108381314 CGCCGCCGCCGCTGCCGCCTCGG - Exonic
996862814 5:128084232-128084254 CGCCGCCGCCGCCGCAGCAGCGG - Exonic
997013531 5:129905151-129905173 CCTCGCCGCCGCTGCTGCAGCGG - Exonic
997319157 5:132963577-132963599 CGTCGCCGCCGCCAGCGGACGGG - Exonic
997980697 5:138465908-138465930 CGGCGCCGCCGGGGCCCCAGAGG + Exonic
998118988 5:139561183-139561205 CGTCGCCGCCACGGCCCCGGAGG - Exonic
999062763 5:148653989-148654011 CGCCCCCGCCGCGTCCCCACCGG + Intronic
1001065117 5:168529693-168529715 CGTCGCCGCCGCCGCGCCCCCGG - Exonic
1002591074 5:180291981-180292003 CGCCGCCGCCGCCGCCGCAGTGG + Exonic
1002897960 6:1390052-1390074 CGCCGCCGCCGCCGCCGCCCCGG + Exonic
1003551833 6:7107683-7107705 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1004044689 6:12012448-12012470 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1004924052 6:20402373-20402395 CGCCGCCGCTGCCGCCGCCCCGG + Exonic
1004924532 6:20403859-20403881 CGCCGACGCCGCGGGGGCACCGG + Intronic
1005040437 6:21595548-21595570 CGGCGCTGCTGCGGCCGCTCAGG - Exonic
1006302352 6:33200321-33200343 CGCCGCCGCCGCCGCCGCTGCGG + Exonic
1006472508 6:34236742-34236764 CGCCGCCGCCGCTGCCGCGCGGG - Intergenic
1007625404 6:43243675-43243697 CGCCGCAGCCGCAGCCGCAGCGG + Exonic
1007665354 6:43510144-43510166 CGCCGCCGCCGCGACCGCGAGGG - Exonic
1007728846 6:43933398-43933420 CCACCCCGCCGCGGCCCCACAGG - Intergenic
1008932469 6:56954936-56954958 CGCCGCCGCCGCGGCCGCCCGGG + Intergenic
1010107157 6:72183003-72183025 CGTCCCCGCCCAAGCCGCACCGG + Exonic
1011075179 6:83431051-83431073 TGTGGCGGCGGCGGCCGCACTGG + Exonic
1012624921 6:101393548-101393570 CCTGGCCGCCGCGGCCACTCGGG - Intergenic
1012895471 6:104941375-104941397 CGTTGCCACAGCGGCCGCCCAGG + Intergenic
1013619324 6:111873023-111873045 CGGAGCCGCCTCGGCCGCGCCGG - Exonic
1015625936 6:135181191-135181213 CGCCGCCTCCGCGGTCGCCCTGG - Intergenic
1017164158 6:151391553-151391575 CGCCGCCGCCGCCGCCGCGCCGG - Intergenic
1018400491 6:163415138-163415160 CGCCGCCGCCGCCGCCGGAGAGG - Exonic
1019111926 6:169724007-169724029 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1019474246 7:1236431-1236453 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1020272889 7:6607496-6607518 CGTCCCCGAGGGGGCCGCACCGG + Intronic
1020275538 7:6622402-6622424 CGCCGCCGCCGCTGCCGTGCAGG - Exonic
1021231103 7:18086899-18086921 CGCCGCCGCCGCCGCCGCGCGGG - Intergenic
1021668643 7:23013552-23013574 TGCCGCCGCCTCGGCCCCACCGG - Intronic
1021827916 7:24573272-24573294 CGCCGCCGCCGCCGCCGCTTGGG - Intronic
1022427952 7:30285546-30285568 CGGCGCCGCGGCGGCCGCGGCGG + Exonic
1022427953 7:30285551-30285573 CGGGGCCGCCGCGGCCGCCGCGG - Exonic
1022559872 7:31336724-31336746 CGTCGCCTCGGTGGCCGCCCGGG - Intergenic
1023405880 7:39833517-39833539 CGCCGCCGCCGCTACCGCTCCGG - Intergenic
1023418225 7:39951126-39951148 CGTCGCCGCCGTTGCCGCGCTGG - Exonic
1025069679 7:55887596-55887618 CGCCGCCGCCGCCGCCGCGGTGG - Intronic
1025069681 7:55887599-55887621 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1025615709 7:63114426-63114448 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1027421154 7:78019488-78019510 CGCCGCTGCCGCCGCCGCCCGGG + Exonic
1029996754 7:105014154-105014176 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1030727198 7:112939762-112939784 CGCCGCCGCCGCCGCCCCTCAGG + Exonic
1031051882 7:116953440-116953462 CGCCGCCGCCGCCGCGGCCCGGG - Exonic
1033159121 7:138981331-138981353 CGTCCCAGCCGCAGCCGCAGCGG - Intergenic
1033253190 7:139777818-139777840 CGCCGCCGCCGCTGCCGCCCGGG + Intronic
1034147257 7:148884212-148884234 CGCCGCCGCCGCCGCCGCCGGGG + Exonic
1034223098 7:149460470-149460492 GGTCCCAGCCGCGGCCGCAGAGG - Intronic
1034469722 7:151248756-151248778 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1034618022 7:152435854-152435876 CGCCGCCGCCGCTGCTGCTCGGG + Exonic
1034618183 7:152436281-152436303 CTTCGCCGCCGCCGCCGCCCGGG - Intergenic
1034977736 7:155457978-155458000 CGCCGCCGCCTGGGCCGCCCGGG - Intergenic
1035169538 7:157009945-157009967 CGCCGCCGCCGCCGCCGCTGGGG - Exonic
1035553015 8:544655-544677 GGCCGCCGCCGCCGCCGCCCAGG - Exonic
1036432453 8:8702960-8702982 CGTTGTCGCCGCCGCCGCAAGGG + Exonic
1040065592 8:43141294-43141316 CGCCGCCGCCGCCGCCGCCTGGG + Intronic
1041059501 8:54022275-54022297 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1041689916 8:60678763-60678785 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1042040220 8:64581387-64581409 CCCCGCCGCCGCCGCCGCCCAGG - Exonic
1042696025 8:71556390-71556412 CGTGGCTGCCGCGGGCGCGCGGG - Intronic
1043502957 8:80874323-80874345 CGCCGCCGCCGCCGCCGCCCGGG + Intronic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1044832306 8:96262008-96262030 CGCCGCCACCGCGGCAGGACGGG + Exonic
1044934279 8:97278001-97278023 CGCCGCCGCTGCGGCTGCGCAGG + Intergenic
1045516297 8:102863628-102863650 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1045737921 8:105318457-105318479 CGGCGCCGCCGCCGCCGCTCCGG - Intronic
1048214267 8:132480871-132480893 CGCCGCCGCCGCCGCCGCCCCGG - Exonic
1049109852 8:140635788-140635810 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1049759837 8:144326946-144326968 CGTAGTCGCCGCGGGCGCGCCGG + Intergenic
1049759845 8:144326988-144327010 CGTAGTCGCCGCGGCCGCACCGG + Intergenic
1049788438 8:144462373-144462395 CGCCGCCGCCGCCGCCGCCTCGG + Intronic
1049788442 8:144462382-144462404 CGCCGCCGCCTCGGCCGCCTCGG + Intronic
1051419000 9:16871565-16871587 CGTCCCAGCCGCGGCCGACCCGG + Intergenic
1052192792 9:25678180-25678202 CGCCGCCGCCGCCGCCGCTGGGG + Exonic
1052903989 9:33817739-33817761 CGCCGCCGCCGCCGCCGCGATGG + Exonic
1053306211 9:36986348-36986370 GGGCCCCGCCGCGGCCGCGCCGG + Intronic
1053697501 9:40651086-40651108 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1054308790 9:63450486-63450508 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1054407652 9:64774845-64774867 CGCCGCCGCCGCAGCCGCCGCGG - Intergenic
1054798629 9:69325390-69325412 CGCCGCTGCCGCCGCCGCTCAGG + Intronic
1054798673 9:69325543-69325565 AGTCGCCGCCGCTGCCGCCGCGG + Intronic
1054835650 9:69672545-69672567 CGCCGCCGCCGCGGGCTCGCGGG - Intergenic
1055091114 9:72365281-72365303 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1055514207 9:77020319-77020341 CGCCGCCGCCGCCGCCGCCACGG - Exonic
1055514231 9:77020415-77020437 CGCCGCGGCCGCGGCGGCAGCGG - Exonic
1055514232 9:77020421-77020443 CGTGGACGCCGCGGCCGCGGCGG - Exonic
1055936833 9:81611792-81611814 CGCAGCCGCCGCGGCCGCCGTGG - Exonic
1057489144 9:95508367-95508389 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1057773160 9:97984461-97984483 GGGCGCCGCCGCCGCGGCACAGG - Intronic
1059145550 9:111896681-111896703 CGGCGCCGCAGCGGGCGCGCGGG + Intergenic
1059191639 9:112333169-112333191 CCTCGGCACCGCGGCCGGACCGG + Intronic
1059191713 9:112333438-112333460 AGGCGGCGCGGCGGCCGCACCGG - Intronic
1059483712 9:114611527-114611549 CGCCGCCGCCGCCGCCACCCCGG - Exonic
1060480683 9:124015367-124015389 CTTGGCCGCCGCGGCTGCAGCGG - Exonic
1061144121 9:128787270-128787292 CGCCGCCGCCGCCGCCCCCCAGG - Exonic
1062094109 9:134694297-134694319 CGTCCCCGCCCAGGCCGCACAGG + Intronic
1062314806 9:135961367-135961389 GCGCGCCGTCGCGGCCGCACCGG + Exonic
1062551138 9:137087118-137087140 CGCCGCCGCCGCCGCCTCATCGG + Exonic
1062560399 9:137139156-137139178 AGTCGCCGCAGCGTCCGGACCGG + Intronic
1202779846 9_KI270717v1_random:24374-24396 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1203469881 Un_GL000220v1:111685-111707 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1203477702 Un_GL000220v1:155657-155679 CGCCGCCGCCGCCGCCGCGGCGG + Intergenic
1185457757 X:319237-319259 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1186452926 X:9688135-9688157 AGCCGCCGCCGCCGCCGCACTGG - Exonic
1190474402 X:50813133-50813155 CGCCGCCGCCGCCGCCGCCAGGG - Intronic
1192034320 X:67546339-67546361 CTGCGCCGCCGCAGCCGCCCAGG - Exonic
1194977593 X:100409720-100409742 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1195138207 X:101931892-101931914 CGCCGCCGCCGCTGCCGCGCAGG + Intronic
1195954795 X:110317831-110317853 CGCCGCCGCCGCCGCAGCCCTGG + Exonic
1198388138 X:136147716-136147738 CCCCGCCGCCGCCGCCGCTCGGG + Intronic
1198767093 X:140091339-140091361 CGCCGCCGCCGCCGCCGCCTCGG - Intergenic
1199500369 X:148500673-148500695 CGCCGCCGCCGCTGCCGCCCCGG + Exonic
1200003191 X:153072522-153072544 CGACCCCGCCGCCGCCGCAGCGG + Exonic
1200004532 X:153077487-153077509 CGACCCCGCCGCCGCCGCAGCGG - Intergenic
1200098202 X:153673901-153673923 CTGCGGCGCCGCGGCCGCGCTGG - Intronic
1200229538 X:154437163-154437185 CGCCGCCGCCGCCACCGCACTGG - Exonic