ID: 965651439

View in Genome Browser
Species Human (GRCh38)
Location 3:170938143-170938165
Sequence CTGAGGGTCTGACTGTTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965651439_965651440 -8 Left 965651439 3:170938143-170938165 CCTTCTAACAGTCAGACCCTCAG No data
Right 965651440 3:170938158-170938180 ACCCTCAGCTGCATGTCTGTTGG 0: 43
1: 4547
2: 2170
3: 921
4: 1002
965651439_965651444 5 Left 965651439 3:170938143-170938165 CCTTCTAACAGTCAGACCCTCAG No data
Right 965651444 3:170938171-170938193 TGTCTGTTGGAGTTTGCTGGAGG 0: 35
1: 2065
2: 2966
3: 1485
4: 969
965651439_965651443 2 Left 965651439 3:170938143-170938165 CCTTCTAACAGTCAGACCCTCAG No data
Right 965651443 3:170938168-170938190 GCATGTCTGTTGGAGTTTGCTGG 0: 41
1: 2148
2: 2128
3: 1178
4: 692

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965651439 Original CRISPR CTGAGGGTCTGACTGTTAGA AGG (reversed) Intergenic
No off target data available for this crispr