ID: 965651836

View in Genome Browser
Species Human (GRCh38)
Location 3:170942428-170942450
Sequence CTGGGTGAGGGGGTGGTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965651828_965651836 27 Left 965651828 3:170942378-170942400 CCAGAATAGGCAAAAGTATAGTG No data
Right 965651836 3:170942428-170942450 CTGGGTGAGGGGGTGGTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965651836 Original CRISPR CTGGGTGAGGGGGTGGTGTA TGG Intergenic
No off target data available for this crispr