ID: 965652448

View in Genome Browser
Species Human (GRCh38)
Location 3:170947672-170947694
Sequence AGCCAGCTGGGCTACTGTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965652441_965652448 9 Left 965652441 3:170947640-170947662 CCCACGGCCCTGGTGCGGGATCT No data
Right 965652448 3:170947672-170947694 AGCCAGCTGGGCTACTGTGTCGG No data
965652445_965652448 1 Left 965652445 3:170947648-170947670 CCTGGTGCGGGATCTACTAGGTG No data
Right 965652448 3:170947672-170947694 AGCCAGCTGGGCTACTGTGTCGG No data
965652440_965652448 12 Left 965652440 3:170947637-170947659 CCACCCACGGCCCTGGTGCGGGA No data
Right 965652448 3:170947672-170947694 AGCCAGCTGGGCTACTGTGTCGG No data
965652444_965652448 2 Left 965652444 3:170947647-170947669 CCCTGGTGCGGGATCTACTAGGT No data
Right 965652448 3:170947672-170947694 AGCCAGCTGGGCTACTGTGTCGG No data
965652442_965652448 8 Left 965652442 3:170947641-170947663 CCACGGCCCTGGTGCGGGATCTA No data
Right 965652448 3:170947672-170947694 AGCCAGCTGGGCTACTGTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965652448 Original CRISPR AGCCAGCTGGGCTACTGTGT CGG Intergenic
No off target data available for this crispr