ID: 965653711

View in Genome Browser
Species Human (GRCh38)
Location 3:170961181-170961203
Sequence CACCCTACCCCCATTGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965653711_965653718 13 Left 965653711 3:170961181-170961203 CCTACCCCAATGGGGGTAGGGTG No data
Right 965653718 3:170961217-170961239 ATAGTCAGCAAAGGCCTCCATGG No data
965653711_965653717 4 Left 965653711 3:170961181-170961203 CCTACCCCAATGGGGGTAGGGTG No data
Right 965653717 3:170961208-170961230 TTGGATAAGATAGTCAGCAAAGG No data
965653711_965653719 17 Left 965653711 3:170961181-170961203 CCTACCCCAATGGGGGTAGGGTG No data
Right 965653719 3:170961221-170961243 TCAGCAAAGGCCTCCATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965653711 Original CRISPR CACCCTACCCCCATTGGGGT AGG (reversed) Intergenic
No off target data available for this crispr