ID: 965662403

View in Genome Browser
Species Human (GRCh38)
Location 3:171055551-171055573
Sequence GTATAGCCAGGGTCATAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965662398_965662403 18 Left 965662398 3:171055510-171055532 CCTGCAACTTGGCCTGTTAGGAT No data
Right 965662403 3:171055551-171055573 GTATAGCCAGGGTCATAGCCCGG No data
965662395_965662403 30 Left 965662395 3:171055498-171055520 CCTTCTTACGTTCCTGCAACTTG No data
Right 965662403 3:171055551-171055573 GTATAGCCAGGGTCATAGCCCGG No data
965662400_965662403 6 Left 965662400 3:171055522-171055544 CCTGTTAGGATGATTCATGGAGC No data
Right 965662403 3:171055551-171055573 GTATAGCCAGGGTCATAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965662403 Original CRISPR GTATAGCCAGGGTCATAGCC CGG Intergenic
No off target data available for this crispr