ID: 965662997

View in Genome Browser
Species Human (GRCh38)
Location 3:171062052-171062074
Sequence ATCTAGTGGTTTGGGCAAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965662997 Original CRISPR ATCTAGTGGTTTGGGCAAGA TGG (reversed) Exonic
900351926 1:2239076-2239098 TTTTAATGGTTTGGGCAACAGGG - Intronic
904307425 1:29599162-29599184 ATCTTGTCGTTTGGGCAGGAAGG - Intergenic
906836165 1:49085498-49085520 ATCTAGGAGTTGGGTCAAGATGG + Intronic
907424648 1:54372017-54372039 AACTAGTGGTTTGGGAGAGTTGG - Intronic
908896984 1:68911793-68911815 ATTCATTGGTTGGGGCAAGAAGG - Intergenic
909748685 1:79132033-79132055 ATCCATTAGTTTTGGCAAGAGGG + Intergenic
911204811 1:95081372-95081394 ATCTAGAAGATTGGGCAGGATGG + Intergenic
912215799 1:107609948-107609970 ATCTACTGGTTTGGGCACCTAGG + Exonic
915500623 1:156314209-156314231 ATCTATTGTTTTGGGCTTGATGG - Intronic
917057376 1:170997819-170997841 ATCTAGTGCTTAGTCCAAGATGG - Intronic
919116416 1:193285633-193285655 ATGTGGTGGTTTGGGAAATATGG + Intergenic
922910280 1:229210026-229210048 ATGTAGTGATTCAGGCAAGAGGG + Intergenic
923524355 1:234760575-234760597 TTCTAATGCTTTGGGCAGGAAGG + Intergenic
924020939 1:239781471-239781493 TTTTAGGAGTTTGGGCAAGAGGG + Intronic
1065304219 10:24353265-24353287 ATATAGTGGTGTGGGAAAGGTGG - Intronic
1066421122 10:35265801-35265823 GTCTAGTGGGTTGGCCAAGGTGG + Intronic
1070004708 10:72412252-72412274 ATTGAGTTGTTTGGACAAGAAGG + Intronic
1070382024 10:75889874-75889896 CTATAGAGGTTTGGCCAAGAGGG + Intronic
1071464776 10:85929103-85929125 ATCCAGTGGTTTGGGAGAAAAGG + Intronic
1071687681 10:87778044-87778066 ACTAAGTGGTTTTGGCAAGATGG + Intronic
1074037531 10:109755751-109755773 ATCAATTGGTTTTGGCAACAAGG - Intergenic
1076305095 10:129460762-129460784 CTCTACTGCTTTGGGGAAGATGG + Intergenic
1081793221 11:45803815-45803837 ACCTAGAGTTCTGGGCAAGAAGG + Intergenic
1082814425 11:57498906-57498928 ATCTAGTGACTTGGGGAGGATGG - Intronic
1083700311 11:64473070-64473092 ATCTATTGGTTTGGGCCAGTTGG - Intergenic
1084613042 11:70216244-70216266 GTCAAGTTGTTTGGGCAAAAAGG + Intergenic
1087113438 11:94496334-94496356 ATCTACTGGTTTAGGTATGATGG - Intronic
1088047560 11:105472419-105472441 AATTAGTGATCTGGGCAAGATGG + Intergenic
1089951635 11:122533904-122533926 ATCAAGTGGCTTAAGCAAGATGG + Intergenic
1092113489 12:5981597-5981619 AGCACTTGGTTTGGGCAAGAAGG + Intronic
1093138679 12:15481143-15481165 ATTTCATTGTTTGGGCAAGAAGG - Intronic
1094622371 12:32092391-32092413 ATGTAGTGGTTTGAGTCAGAAGG + Intergenic
1094672793 12:32587229-32587251 ATTTATTGGTTTAGGCATGAAGG + Intronic
1096161686 12:49383687-49383709 ATAAAGTGGGTCGGGCAAGATGG - Intronic
1096192296 12:49627802-49627824 AGATGGTGGCTTGGGCAAGATGG + Intronic
1101695635 12:107123068-107123090 GTCTAGTGTTTTGGGAAACAAGG + Intergenic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1105242232 13:18619138-18619160 GTCTAGTGGTCTGGGCAGGCTGG + Intergenic
1106319501 13:28624629-28624651 ACCTAGAGGTTTGAGCAACAGGG + Intergenic
1106795711 13:33202813-33202835 ATCTGGTGGGTGGGGCAGGAGGG + Intronic
1107934713 13:45335903-45335925 ATGTAGTGGTTTGAGCAATCTGG - Exonic
1113963169 13:114136888-114136910 GTCTATTGGTTTGGTCCAGAGGG - Intergenic
1115757078 14:36539535-36539557 ATCTTGTGAGTTGGGCATGATGG + Intergenic
1115769174 14:36653190-36653212 ATATAGAGGATTGGGGAAGAAGG - Intergenic
1118438195 14:65790190-65790212 ATTTAGGGCTTTGGGGAAGAGGG + Intergenic
1119946843 14:78704231-78704253 ATCAAGTGGGTTGGGCAAGAGGG + Intronic
1120897985 14:89551444-89551466 ATCTAGTGGTGTTGGGAGGAAGG - Intronic
1121498664 14:94416046-94416068 AGTCAGTGGTTTGGGCAAAATGG + Intergenic
1122507885 14:102243420-102243442 ATCAAGTTGTTTGGACAAAAAGG - Intronic
1126073726 15:44888084-44888106 ATCTAGTGGATTCAGCAACAAGG + Intergenic
1126084464 15:44998770-44998792 ATCTAGTGGATTCAGCAACAAGG - Intergenic
1126946710 15:53829663-53829685 ATTGAGTGGTTTAGACAAGATGG - Intergenic
1127362388 15:58255830-58255852 ATCTAGAGGTTGGGGCAAACAGG + Intronic
1128285528 15:66433623-66433645 TTCTAGAGGTTTGGGATAGAGGG + Intronic
1128469053 15:67936751-67936773 GTCTAGTGGTCTGGGCATAAAGG + Intergenic
1128800727 15:70495128-70495150 CTCTACTGGTTTGGGGAAGGAGG - Intergenic
1129123844 15:73421204-73421226 CTCTAGAGGTTGAGGCAAGAGGG - Intergenic
1129323785 15:74789068-74789090 GTCTAGTGGTTTGGGAGAGGTGG - Intronic
1130382238 15:83380460-83380482 AGGTAGGGGTTGGGGCAAGAGGG + Intergenic
1130763921 15:86851166-86851188 ATCTACTATTTTGGGAAAGAGGG + Intronic
1130857491 15:87853838-87853860 TCCTAGTGGTTTGGGGAATAAGG + Intergenic
1131879947 15:96851840-96851862 ATCTGTTGGCTTTGGCAAGAAGG + Intergenic
1133483189 16:6191992-6192014 ATCTAGTAGATTGAGGAAGAAGG + Intronic
1133603889 16:7367124-7367146 ATTTAGTGAGTTGGGAAAGATGG + Intronic
1137023882 16:35454817-35454839 AAGTACTGGTTTGGGGAAGATGG - Intergenic
1137832552 16:51557860-51557882 ACCTGATGGGTTGGGCAAGAGGG + Intergenic
1139824248 16:69744778-69744800 GTCTAGTCGTTTCTGCAAGATGG - Intronic
1141497734 16:84421480-84421502 CTCTGGTGGTTTGTGGAAGATGG + Intronic
1144734254 17:17546162-17546184 ATCCAGTGGCCTGGGCTAGAAGG + Intronic
1145945735 17:28773009-28773031 AACTTTTGGTTTGGGCAGGAAGG + Intronic
1148485410 17:47987707-47987729 TGCTCGTGGTTTGGGCGAGAGGG - Intergenic
1148703519 17:49607128-49607150 ATATCTTGGTTTGGCCAAGACGG - Intronic
1149012300 17:51870014-51870036 AAAGAGTGGTTTGGGCAGGAAGG - Intronic
1151527939 17:74683790-74683812 ATCTTATGCTTTGGGCCAGATGG + Intronic
1153198808 18:2628932-2628954 ATCTAGTAGGCTGGGCATGATGG - Intergenic
1153739384 18:8106927-8106949 TTCCAGTGCTTTGGGCCAGATGG - Intronic
1154446717 18:14440740-14440762 GTCTAGTGGTCTGGGCAGGCTGG - Intergenic
1155161494 18:23199673-23199695 AACCAGGGGTTAGGGCAAGAGGG + Intronic
1157131933 18:45015253-45015275 CTCTAGGGGTCTGGGCAAGATGG + Intronic
1160602353 18:80023341-80023363 AACTAGAAGTTTGGGGAAGAGGG + Intronic
1161383338 19:3977919-3977941 ATCTGGTGCTTTGGGCCCGACGG - Exonic
1162903189 19:13807553-13807575 TCCTGGTGTTTTGGGCAAGATGG + Intronic
925585527 2:5460684-5460706 ATCTAGGGCTTTGAGGAAGATGG + Intergenic
927572040 2:24168300-24168322 ATTTAGAGGTTGGGGCAAGGAGG + Intronic
932830453 2:74984876-74984898 AGCTAGTGGTTTAGGAATGATGG + Intergenic
933620246 2:84530831-84530853 ATCCAGTTGTCTGAGCAAGAGGG + Intronic
936229422 2:110687021-110687043 AGCTGGTGGTTTGGGCATGTAGG + Intergenic
938483235 2:131679491-131679513 GTCTAGTGGTCTGGGCAGGCTGG + Intergenic
940846187 2:158644301-158644323 ATTTTGTGGTCTGGGCATGATGG + Intronic
941315416 2:163986002-163986024 ATCCAGAGGTTTGGGCCAAAAGG + Intergenic
941455926 2:165712243-165712265 ATCAAGTTGTTTGGACAAAAAGG + Intergenic
943495363 2:188613335-188613357 ATCTTGTCATTTGGGCAACATGG - Intergenic
944038341 2:195325124-195325146 ATTTAAAGGTTTGGGAAAGATGG + Intergenic
947449478 2:230194094-230194116 ATCTTGGGGTTTGGCCTAGAAGG - Intronic
1171174038 20:23037873-23037895 TTCTGGTGGTATGGGGAAGATGG + Intergenic
1173239539 20:41282018-41282040 TTCTTGTGGATTGGGCATGAGGG + Intronic
1176176430 20:63728400-63728422 AGCCAGGGATTTGGGCAAGAGGG + Intronic
1177646140 21:23901886-23901908 ATCTAGTGATCTTGGGAAGAGGG + Intergenic
1178891115 21:36521912-36521934 ATCTAGTGTTTTATACAAGAAGG + Intronic
1179125736 21:38589063-38589085 GTCTAGTGTTTTGGGGAACAAGG - Intronic
1179594334 21:42431949-42431971 TTCTAATGATTTGGGCAAAATGG + Intronic
1183708701 22:39490079-39490101 ATACAGTGGTTTAAGCAAGATGG + Exonic
1184265763 22:43345014-43345036 ATCTTGTGCATTGGGCAACAGGG + Intergenic
949952963 3:9244385-9244407 GTCTAGAGGTTTGAGGAAGAAGG - Intronic
954954003 3:54502943-54502965 ATCCAGTGGTGTGGGCATCAGGG - Intronic
956197358 3:66666235-66666257 TTCTATTGGTTTTGGCAATATGG + Intergenic
957655104 3:83063885-83063907 CTCTAGTGGGTCTGGCAAGAGGG - Intergenic
958781456 3:98548447-98548469 ATCAACTGATTTGGGCGAGATGG + Intronic
959971009 3:112409866-112409888 GTATAGTGGCTTGGGCAAGGGGG + Intergenic
962041039 3:131707770-131707792 TTGTAGTGGTTTGAGTAAGAGGG - Intronic
965069412 3:163899124-163899146 ATTTAGTGTTTTGGGCTAAATGG - Intergenic
965662997 3:171062052-171062074 ATCTAGTGGTTTGGGCAAGATGG - Exonic
966492453 3:180543176-180543198 ATCTAGTGGCATTGGCAAAAAGG - Intergenic
966695870 3:182790565-182790587 ATCTTGTGCTTTGGGAGAGATGG - Intergenic
968992667 4:3925178-3925200 CTCTAGGGGTTTGAGCAACAGGG + Intergenic
969930048 4:10622031-10622053 AGCAAGTGGTTTGGGGAAAATGG + Intronic
972039708 4:34577485-34577507 ATTTTCTGGTTTGGGCAACAAGG - Intergenic
972267567 4:37477391-37477413 AGCAAGGGGATTGGGCAAGATGG + Intronic
974067243 4:57090073-57090095 CTCTAGTGGCTTGGCCAAAATGG - Intronic
974294593 4:59980747-59980769 ATCTTGTGCTTTGGGAGAGATGG - Intergenic
975155084 4:71062468-71062490 CTCTAGTTCTTAGGGCAAGAGGG + Intergenic
977561692 4:98539445-98539467 AAATTGTGGTTTGGGGAAGAGGG - Intronic
977812975 4:101379664-101379686 ATATATTGTTTTGGGCAATATGG + Intergenic
979360992 4:119764812-119764834 TTCTAGTGTTTTGTGGAAGATGG + Intergenic
983187116 4:164712761-164712783 ATGTAATAATTTGGGCAAGAAGG - Intergenic
984411960 4:179406874-179406896 ATGTAATGGTTTGGTCAGGATGG - Intergenic
984560532 4:181263683-181263705 TTCTACTGATTTAGGCAAGAGGG + Intergenic
985556482 5:561083-561105 AAACAGAGGTTTGGGCAAGAAGG - Intergenic
988469662 5:31526613-31526635 ATCTGGTGGTTGGGGAAAGGCGG + Exonic
989119017 5:37984855-37984877 ATAGAGTGGTTTGGGAAAGAAGG - Intergenic
993563342 5:89440626-89440648 ATATACAGGTTTGGGCAATAGGG - Intergenic
1000155152 5:158543217-158543239 ATTTGGTGCTTTGGACAAGAGGG + Intergenic
1000766621 5:165299551-165299573 ATCTCATGATTTGGGCAAGTGGG - Intergenic
1003229359 6:4237114-4237136 CTCTAGTGGCTTGGGCCAGATGG - Intergenic
1005702946 6:28421570-28421592 ATTTAATGATTTTGGCAAGATGG - Intergenic
1009446621 6:63749953-63749975 ATTGAGAGATTTGGGCAAGATGG - Intronic
1010305618 6:74318166-74318188 ATCTAGCGGTTTGGAATAGATGG + Intergenic
1011960178 6:93079100-93079122 ATTTTGTGGTTTGGGGAAGGAGG - Intergenic
1013193098 6:107820543-107820565 AAGAAGTGCTTTGGGCAAGAGGG - Intronic
1015610081 6:135007768-135007790 TTCCAGTTGTTTGGGGAAGATGG - Intronic
1016103527 6:140132922-140132944 ATATATTGCTTTGGGCAATATGG - Intergenic
1017922614 6:158885312-158885334 ATCAAGTTGTTTGGGCAAAAAGG + Intronic
1022921746 7:35023038-35023060 ATCTAGTGTCCTGGGCAAGTGGG + Intronic
1030002770 7:105083153-105083175 ATTTATTGTTTTGGGCATGATGG + Intronic
1033927063 7:146475533-146475555 ATTGAGTGGTTTGGACAGGATGG + Intronic
1033976735 7:147111941-147111963 ATGTATTGCTTTGGGCAATATGG + Intronic
1037152584 8:15655848-15655870 ATAAGGTGGTTTGGGGAAGAAGG - Intronic
1038080241 8:24126624-24126646 ATCTAGTTATTTGGGAAAGCAGG - Intergenic
1038302846 8:26370660-26370682 ATCTAGTCCATTAGGCAAGATGG - Exonic
1041734982 8:61100705-61100727 ACCTAGTGGATTGGGAACGATGG - Intronic
1041812224 8:61924332-61924354 ATCTTCTGTCTTGGGCAAGATGG - Intergenic
1043072766 8:75660173-75660195 ATCCAGTGGGTTGGTCATGAAGG - Intergenic
1043647927 8:82546022-82546044 ATTTAGTGTTTTGGGTAAGGTGG + Intergenic
1044018479 8:87074872-87074894 AACTAGTGGTTTCTGCAAGATGG - Intronic
1045724357 8:105154524-105154546 ATCTAATTGTTTAGGAAAGATGG + Intronic
1045981730 8:108197516-108197538 ATTTATTGTTTTGGGCATGAGGG - Intergenic
1046184345 8:110693393-110693415 ATCTCATGGGTTGGGCAAGCGGG - Intergenic
1047436073 8:124836310-124836332 CTCCAGTGGTTTGGGCAGGATGG - Intergenic
1050658255 9:7853312-7853334 TGCTAGTGGATTGGGGAAGATGG + Intronic
1053078306 9:35153650-35153672 ATATAATGGTTTAGTCAAGATGG + Intergenic
1055426014 9:76197710-76197732 ATCTTGTGGTTGGGGACAGAAGG - Intronic
1055980469 9:81995305-81995327 AGCTAGTGGTTAGGGAAAGGTGG + Intergenic
1060280590 9:122213441-122213463 ATCTAGGAGTTGGGGGAAGAAGG - Intronic
1186251098 X:7667594-7667616 ATCTAGTGTTTTGAACCAGACGG - Intergenic
1187283702 X:17882923-17882945 CTTTGGTGGATTGGGCAAGATGG + Intergenic
1187745615 X:22405994-22406016 AATTAGTGGTATGGGAAAGAGGG + Intergenic
1189372437 X:40439579-40439601 AACTAGTGGTCTAGGCAGGAGGG - Intergenic
1189663835 X:43332003-43332025 ATTCAGTGGTGTGGGCAAGAAGG + Intergenic
1190051811 X:47156094-47156116 ATCTAGTGGGCTGGGCACGGTGG - Intronic
1192347133 X:70319895-70319917 ACATAGTGGTTTTGGCAAGGTGG - Intronic
1196372104 X:114990818-114990840 ATCTGGTGGTTAGGGCATGAGGG + Intergenic
1197452418 X:126636436-126636458 ATCTAAGGGTTTGGGCAAGTGGG + Intergenic
1197930949 X:131695784-131695806 ATCCATTGGTTTGGTCTAGAAGG + Intergenic
1198595291 X:138229410-138229432 AAATAGTGGTTTAGTCAAGAGGG + Intergenic