ID: 965667374

View in Genome Browser
Species Human (GRCh38)
Location 3:171109866-171109888
Sequence GAGGCTAATTTTTACTTAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 206}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965667370_965667374 29 Left 965667370 3:171109814-171109836 CCCCATTACTGGAAACTAAACAA 0: 1
1: 0
2: 2
3: 33
4: 359
Right 965667374 3:171109866-171109888 GAGGCTAATTTTTACTTAATAGG 0: 1
1: 0
2: 0
3: 11
4: 206
965667371_965667374 28 Left 965667371 3:171109815-171109837 CCCATTACTGGAAACTAAACAAT 0: 1
1: 0
2: 1
3: 22
4: 293
Right 965667374 3:171109866-171109888 GAGGCTAATTTTTACTTAATAGG 0: 1
1: 0
2: 0
3: 11
4: 206
965667372_965667374 27 Left 965667372 3:171109816-171109838 CCATTACTGGAAACTAAACAATG 0: 1
1: 0
2: 0
3: 8
4: 206
Right 965667374 3:171109866-171109888 GAGGCTAATTTTTACTTAATAGG 0: 1
1: 0
2: 0
3: 11
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965667374 Original CRISPR GAGGCTAATTTTTACTTAAT AGG Intronic
902519755 1:17009557-17009579 CAGGCTAATTTTTTTTTAGTAGG + Intronic
904742808 1:32691387-32691409 GTGGCTAATTTTTTTTTAGTCGG - Intronic
904791583 1:33026357-33026379 CTGGCTAATTTTTATGTAATTGG + Intronic
907723195 1:56993298-56993320 GAGTCTAATTTTAAAATAATTGG - Intergenic
907791228 1:57666828-57666850 TAGGGTAATTTTTAATTAAAAGG + Intronic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
910134761 1:83954816-83954838 GTGGGTAATTTTTACCTATTTGG - Intronic
912250502 1:108007477-108007499 CAGGCTATTTTTTATTTTATGGG - Intergenic
913366180 1:118041773-118041795 GAGACTAAGTTTTACAGAATTGG + Intronic
913439490 1:118882908-118882930 GATGCTAATATTCACTTCATGGG + Intergenic
915282293 1:154830785-154830807 GAGGATCATTTTCTCTTAATTGG - Intronic
916181647 1:162089097-162089119 GATGCTAATTTTTATTGAGTTGG + Intronic
916848075 1:168673693-168673715 GGGGCTAACTTTTGCCTAATAGG + Intergenic
917236815 1:172901530-172901552 GAGGAAAATTTTAACTGAATAGG + Intergenic
917688851 1:177446763-177446785 GAGGGTAGTTTTTACCTCATGGG + Intergenic
917723545 1:177809079-177809101 GAGGGTAATTTTCACTTGGTGGG - Intergenic
919363243 1:196622191-196622213 GATGCTAATTTTCAAATAATTGG + Intergenic
919706218 1:200678326-200678348 GATGCTAATTGCTACTAAATTGG + Intergenic
921267294 1:213432412-213432434 AAGGCTAGTGGTTACTTAATTGG - Intergenic
921472496 1:215566438-215566460 GAGGCTATTTTTTATTTTTTTGG + Intergenic
923745021 1:236692267-236692289 GAGGATCATATCTACTTAATTGG - Intronic
923962193 1:239098279-239098301 GAGACAAATTTTTCCTTAACAGG + Intergenic
924748488 1:246861471-246861493 GTGGCTAATGTTTCCCTAATTGG + Intronic
1068824722 10:61422927-61422949 GAGGCTGATGTTTACTTTTTTGG - Intronic
1069240777 10:66136438-66136460 TAAGCTACTTTTTACTAAATTGG + Intronic
1069262805 10:66420195-66420217 GTGCCTACTTCTTACTTAATGGG - Intronic
1071710743 10:88046611-88046633 GAGGCTAATATTTATATGATAGG + Intergenic
1072526794 10:96278945-96278967 AAGGCTAATATCTCCTTAATAGG + Intergenic
1073403189 10:103275674-103275696 TAGGATAAGTTTTACTTCATGGG - Intergenic
1074606526 10:114974840-114974862 GCGGCTAATCTTTACTCCATGGG + Intronic
1075338629 10:121627444-121627466 CAGCCTAATTTATACTTGATAGG + Intergenic
1075927438 10:126264203-126264225 GATGCTGATATTTGCTTAATGGG + Intronic
1078007206 11:7540902-7540924 GATCCTAATTGTTAGTTAATTGG - Intronic
1078306107 11:10187830-10187852 GAAGTTAATTTTTTCTGAATTGG - Intronic
1081193048 11:40127782-40127804 GAAGCTAATTTTCTCTTCATTGG - Intronic
1086766391 11:90701036-90701058 GTGGGTATTTTTTATTTAATGGG + Intergenic
1087030016 11:93693361-93693383 GAGGCTAATTATTACTAAGCAGG + Intronic
1088712738 11:112523425-112523447 GAGGCCAATTTTAGCTGAATAGG + Intergenic
1088726610 11:112643251-112643273 CAGTCTAATATTTACTTAAATGG - Intergenic
1091320528 11:134646213-134646235 GATGCCAAGCTTTACTTAATTGG - Intergenic
1093119753 12:15254612-15254634 GAGACTAATATTTGCTTAAAAGG - Intronic
1093723255 12:22470804-22470826 GAGGTAAATCTTTACTGAATAGG - Exonic
1093981030 12:25475930-25475952 CATGCTCATTTTTACTTAAAGGG - Intronic
1095338569 12:41060965-41060987 GAGTCTAATACTTACATAATGGG - Intronic
1097461335 12:59866544-59866566 GAGCCTAATTTTTCATAAATGGG - Intergenic
1099005852 12:77233901-77233923 GAGGCCAATTCTTAGATAATGGG + Intergenic
1099042641 12:77675645-77675667 GAGGCTGATGTTTACCTAAGAGG - Intergenic
1099591542 12:84597628-84597650 GAGGATAATTTTCACTTATATGG + Intergenic
1099702084 12:86097810-86097832 GAGAATATTTCTTACTTAATAGG - Intronic
1100411902 12:94327117-94327139 GATTCTAATTTTTACTTGAGTGG + Intronic
1107727171 13:43310425-43310447 TATGCTAATTTCTGCTTAATTGG - Intronic
1108578131 13:51806555-51806577 GAGGCTAATTTTGACCAAAATGG + Intergenic
1109532291 13:63665397-63665419 GATGCTAATTTTTAATTTATTGG + Intergenic
1111069429 13:83145219-83145241 AAGGCTAATTATTATTGAATTGG - Intergenic
1112317380 13:98375401-98375423 GAGGCAAAATTTTACTTTATGGG + Intronic
1112743715 13:102504074-102504096 GAGGACAATTTTTACTTAACTGG - Intergenic
1116154045 14:41180833-41180855 GAGGCATATATTTACTTTATAGG - Intergenic
1116154313 14:41184837-41184859 AAGGCTATTTTTCACTAAATTGG + Intergenic
1116157957 14:41232492-41232514 GAGGTTAATTTTTACTTGTGTGG - Intergenic
1116592684 14:46799265-46799287 GTGGCTAATATTTGCTTCATAGG + Intergenic
1117416333 14:55500042-55500064 GAGGCTGCTTTTTGCTTAAAGGG - Intergenic
1123223289 14:106876159-106876181 GTGGCTAATTTTTACATTAGTGG + Intergenic
1129018997 15:72497710-72497732 GAGGCTATGTTTTCCTAAATAGG + Intronic
1135175732 16:20227115-20227137 TAGGCAAATCTTTGCTTAATGGG - Intergenic
1135967347 16:27047090-27047112 GAGTCTGATTATTATTTAATGGG - Intergenic
1137535726 16:49323566-49323588 GAGGGTAATTTTTACTTCTTGGG - Intergenic
1139047974 16:63086311-63086333 GAAGCAAATTTTTATTTAAATGG - Intergenic
1140982640 16:80125600-80125622 GAGGCCACATTTTACTTATTAGG - Intergenic
1144160873 17:12556594-12556616 GAATGTAATTTTTACTTAACGGG - Intergenic
1145946413 17:28778473-28778495 AACACTCATTTTTACTTAATAGG - Intronic
1146412745 17:32601947-32601969 GAGACTAATTTATACTTAGTTGG + Intronic
1148277965 17:46323045-46323067 GAGATTTATTTTTACTTAGTTGG + Intronic
1148300172 17:46540899-46540921 GAGATTTATTTTTACTTAGTTGG + Intronic
1153295156 18:3538668-3538690 GAGGCTAATGTTTTCATAGTTGG - Intronic
1153557608 18:6332473-6332495 GAGGGTAAATTTTATTGAATGGG - Intronic
1156569085 18:38232464-38232486 CAGGCTAAGCTTTCCTTAATAGG - Intergenic
1156764755 18:40638771-40638793 GAGGCAAATCTTTGCTAAATGGG - Intergenic
1156792166 18:40988732-40988754 GAGGCTAATTTCTTCTGAACTGG + Intergenic
1156962503 18:43050186-43050208 CAGGCTAATTTTTAATTTTTTGG + Intronic
1158028736 18:52936522-52936544 GAGTCTAATTTTTTCTTTCTTGG + Intronic
1158120556 18:54043436-54043458 GAGGCTAATACTTTCCTAATAGG - Intergenic
1158763610 18:60421227-60421249 GAGCAAAATTTCTACTTAATGGG + Intergenic
1159114469 18:64098359-64098381 GAGGATAATTCTTTTTTAATTGG + Intergenic
1164874303 19:31672463-31672485 CAGGCTAATTTTTAAATTATTGG - Intergenic
1166157722 19:40926937-40926959 GAGGCTAATTTATACATTAAGGG - Intergenic
1166639724 19:44485239-44485261 GAGGCTACCTTTTACTGATTTGG - Intronic
1168184348 19:54688914-54688936 GAGGCTATATTTTACTTTCTGGG - Intronic
925220584 2:2136721-2136743 GAGGCTTGTTTATACTGAATTGG + Intronic
926288824 2:11512376-11512398 TAAGTGAATTTTTACTTAATAGG - Intergenic
928264675 2:29801567-29801589 GAGGCCAATTTCTACTAAAGTGG - Intronic
928627045 2:33150544-33150566 ATGGGGAATTTTTACTTAATGGG - Intronic
929349232 2:40928535-40928557 GATGCTAGTTTTCACTTAACTGG - Intergenic
931000433 2:57774415-57774437 GAGAATAATTTATATTTAATTGG - Intergenic
933200761 2:79445557-79445579 GAAGTTAATTTTCACTTAAATGG - Intronic
935868055 2:107413341-107413363 AAGGCTAAATCTTTCTTAATTGG + Intergenic
938474271 2:131592299-131592321 GAGGCAAATTATAACTTGATCGG - Intergenic
938695203 2:133828595-133828617 GAGGCTAGTGTTTACCTTATTGG - Intergenic
941189198 2:162355784-162355806 GATGCTCATTTTTTCTTACTTGG + Intronic
941295032 2:163727412-163727434 GGGGTAAATTTTTACTTAAATGG + Intronic
945132872 2:206593255-206593277 GAGGCTTATTTTTGTTTAGTCGG + Intronic
945167533 2:206961936-206961958 GAGGCTAATTTTTTTTTTTTTGG - Intronic
945451176 2:209998138-209998160 GAGTCTAATTTTTTCTACATGGG - Exonic
945505732 2:210638007-210638029 GTGATTAATTTTTACTTAAAAGG + Intronic
1170254769 20:14328515-14328537 AAGGCTAATTAATACTTAAAAGG - Intronic
1172924215 20:38516058-38516080 GAGACTGATTTGTATTTAATGGG - Intronic
1173053736 20:39590752-39590774 GATGCTGATTTTTGCTGAATAGG + Intergenic
1174541299 20:51291806-51291828 GAGGATAATACTTGCTTAATTGG - Intergenic
1174812402 20:53658250-53658272 TAGGGTAAGGTTTACTTAATTGG - Intergenic
1175434977 20:58939247-58939269 GAGGTAACATTTTACTTAATTGG + Intergenic
1176300927 21:5098710-5098732 CAGGATAATTTTTCCTTAACAGG - Intergenic
1177252895 21:18619145-18619167 CATGATAATTTTTACTTATTGGG + Intergenic
1178322081 21:31613402-31613424 GGGGCTAATTTTTACAAAGTGGG - Intergenic
1179856101 21:44163188-44163210 CAGGATAATTTTTCCTTAACAGG + Intergenic
1182691320 22:32165564-32165586 GCAGCTAGTTTTTACTAAATGGG + Intergenic
1183919550 22:41153939-41153961 GGGCCTTATTTTTTCTTAATTGG - Intronic
1184496572 22:44845850-44845872 GAGGCTGCTTTTACCTTAATGGG + Intronic
951754300 3:26073034-26073056 GAGTCTTATTATTAATTAATTGG + Intergenic
952564904 3:34643191-34643213 GAAGCTTATTTCTACTTTATAGG + Intergenic
952782614 3:37117457-37117479 AAGGCCAACTTTTACTTATTGGG - Intronic
955890340 3:63643833-63643855 GATATTAATTTTTACTGAATAGG + Intergenic
956110707 3:65867571-65867593 CTGGCTAATTTTTAATTATTTGG - Intronic
959556535 3:107725855-107725877 GAGGTGAATTTTCATTTAATGGG + Intronic
959928304 3:111950399-111950421 GGAGATAATTTTTACTTCATGGG - Intronic
961117641 3:124344822-124344844 GACACTTAGTTTTACTTAATTGG - Intronic
964357882 3:155866974-155866996 AAAGCTAATTTTTTGTTAATGGG + Intergenic
964445325 3:156752108-156752130 GTAGCTAATTTCTATTTAATTGG - Intergenic
964603911 3:158538141-158538163 CAGGCCAATTTTTACCTATTAGG - Intronic
965170838 3:165262560-165262582 GAAGATAAATTTTAATTAATAGG + Intergenic
965667374 3:171109866-171109888 GAGGCTAATTTTTACTTAATAGG + Intronic
967427480 3:189344041-189344063 GATGCTAATATCTACTTAATAGG + Intergenic
971443126 4:26711686-26711708 AAGTTTAATTTTTACTTAATTGG + Intronic
971782399 4:31053760-31053782 TAAGCTAAGTTTTACTTTATTGG + Intronic
971890156 4:32509637-32509659 TAGTCTAATTTTTACTTCACAGG - Intergenic
971905803 4:32723944-32723966 GAGGCTAATTTTTCTTTTCTTGG - Intergenic
972584401 4:40423555-40423577 GAGGCTCACTGATACTTAATTGG + Exonic
973977846 4:56280987-56281009 GTACCTAATTTTTATTTAATGGG - Intronic
974395473 4:61329170-61329192 GAGGAGTATTTTTACTTAAATGG - Intronic
977346840 4:95826590-95826612 GGACCTAATTTTTACTTTATGGG + Intergenic
977989319 4:103421568-103421590 GATGCCAATTTTTAGTTACTTGG - Intergenic
978187519 4:105874315-105874337 GATACTAAATTTTACTTTATTGG - Intronic
978447385 4:108792652-108792674 CTGGCTAATTTTTACATTATTGG + Intergenic
986417130 5:7540387-7540409 GAGGTTAGTTTTTATCTAATTGG + Intronic
988785572 5:34563316-34563338 GAGGTTGATTTTTACTACATGGG - Intergenic
989018208 5:36966363-36966385 AAAGCTAATTTCTACTTGATAGG - Intronic
990023027 5:51151869-51151891 GATGATATTTTTTACTTATTTGG - Intergenic
990097423 5:52134488-52134510 GAGAGTAATTTTTCCATAATGGG - Intergenic
990553544 5:56908663-56908685 TAGGCTAATGTTGACTTCATAGG - Intergenic
991201846 5:64003922-64003944 GACAGTAATTCTTACTTAATAGG - Intergenic
991307336 5:65192157-65192179 GTGGCTAGGTTTTATTTAATTGG - Intronic
991951056 5:71947173-71947195 CCGGCAAATTTTTCCTTAATAGG + Intergenic
992007523 5:72492418-72492440 GAAACTAATTTTTTCTTCATTGG + Intronic
992685430 5:79194903-79194925 GATTCTAATTTTTATTTACTTGG - Intronic
993485977 5:88486187-88486209 AATACTAATTTTTACTTTATGGG + Intergenic
994228737 5:97287163-97287185 AAGTATACTTTTTACTTAATAGG + Intergenic
994438421 5:99768753-99768775 TAGGCTCATTTTTAGTTAAGGGG - Intergenic
995051631 5:107713076-107713098 GAGGTTAATTTTTACCTTGTTGG - Intergenic
995820508 5:116225004-116225026 TAGGCTAATCTTTAGTTTATGGG + Intronic
997858714 5:137396706-137396728 GAGGCTGAGTTTTACCTCATAGG - Intronic
998809112 5:145948532-145948554 CAGGCTAATGTTTTCCTAATAGG - Intronic
1003011536 6:2431829-2431851 CAGGGTGATTTTTACTTATTAGG + Intergenic
1003630164 6:7779499-7779521 CAGGCTAATTTTTATATATTTGG + Intronic
1005018600 6:21396671-21396693 GATGATAATTTTTCCTTAAAGGG - Intergenic
1005754620 6:28915127-28915149 CAGGATAAATATTACTTAATGGG - Intronic
1008287090 6:49667032-49667054 GAGGCTAACATTTACATATTTGG + Intergenic
1008338170 6:50331971-50331993 AAGGCTATTTTTTATTGAATAGG + Intergenic
1010163412 6:72886329-72886351 GATGCTAATGTTTACTAAACAGG - Intronic
1010302803 6:74281560-74281582 GTGGCTATTTTTTATTTATTTGG + Intergenic
1010787332 6:80019408-80019430 TAAGATAATTTTTTCTTAATTGG + Intronic
1011969384 6:93203289-93203311 GAAGCTAATTTTATGTTAATTGG + Intergenic
1012144528 6:95665167-95665189 GAGGGTAAGTTTTACTAAAAAGG - Intergenic
1012280262 6:97320045-97320067 GAGGATAATTTCTACTTCATAGG - Intergenic
1017688548 6:156939499-156939521 GAGGAAAATATTTACTGAATAGG - Intronic
1021346548 7:19536501-19536523 GATGCTAAGTTTTAATTAAGAGG + Intergenic
1021668552 7:23013209-23013231 GAGGCTCATTTTAACATACTCGG - Intronic
1022882249 7:34600282-34600304 GAGGCCAATTTTTACAGAAAAGG + Intergenic
1023110273 7:36803214-36803236 GAGGCTTATTTTTAGTGGATAGG - Intergenic
1024853322 7:53746245-53746267 AAGGTTAATTTTTACATAACAGG - Intergenic
1027936925 7:84617639-84617661 AAGAGTAATTTTTACTTAATTGG - Intergenic
1028799357 7:94944518-94944540 TTTGCTAATTTTTACTTAAGGGG + Intronic
1030460741 7:109832718-109832740 TATGCTAATATTTACTTTATAGG + Intergenic
1031280991 7:119798824-119798846 GGGGCAAATTTTCACTTAAGTGG + Intergenic
1033518326 7:142131750-142131772 CAGGCTAATTTTTATTTGATGGG + Intronic
1034596369 7:152197371-152197393 CAAGCTTATTTTTACTTAAAAGG + Intronic
1036033564 8:4995854-4995876 GAGGCTAATTCTCTCTTACTAGG - Intergenic
1040689902 8:49924065-49924087 CAGGTTAATTTTTAATGAATAGG + Intronic
1040972787 8:53155352-53155374 GAGGAAATTTTTTGCTTAATAGG - Intergenic
1041202061 8:55459366-55459388 TAGGCAAAATTTTACTTGATTGG + Intronic
1042179016 8:66066044-66066066 CAGGCTATTTTTTAGATAATTGG + Intronic
1042451025 8:68946019-68946041 GAGGCTAGATTTTACTTTAATGG + Intergenic
1043174757 8:77011127-77011149 AAGGATAATTTTTAAATAATAGG - Intergenic
1044124948 8:88448392-88448414 AAGGCTATTTTTTACATAACAGG - Intergenic
1044978204 8:97687811-97687833 AAGGCAAATTTTAATTTAATAGG - Intronic
1045285796 8:100790191-100790213 GTGCAAAATTTTTACTTAATCGG - Intergenic
1045762568 8:105628114-105628136 GGGGCTAATTTTTATTTCAGAGG - Intronic
1047145674 8:122196350-122196372 AAGGCTCCTTTTTACTTAAAAGG - Intergenic
1047261842 8:123269694-123269716 TAGGATACTATTTACTTAATAGG + Intronic
1047874915 8:129125337-129125359 TAGGCAAATATTTCCTTAATAGG - Intergenic
1047984954 8:130223137-130223159 AAGGATTATTTCTACTTAATGGG + Intronic
1048099878 8:131339461-131339483 GGGGCTAATTTTTTTTTAAGGGG + Intergenic
1050730984 9:8709132-8709154 GACGCAAAATTTTACTTAAGAGG + Intronic
1052306636 9:27017548-27017570 GAAGCTAACTTTTCCTTATTAGG + Intronic
1053361793 9:37493171-37493193 GAGGCTACTTTTTGCTTCAGGGG + Intronic
1053407476 9:37890053-37890075 GAGGCTAAATATTTTTTAATTGG + Intronic
1056636745 9:88337583-88337605 CTGGCTAATTTTTACATTATTGG - Intergenic
1057616490 9:96595303-96595325 GATGCTGAATTTTACTTCATGGG - Intronic
1058336416 9:103834853-103834875 GAGGGTAATTTGTAGTTCATGGG + Intergenic
1059875280 9:118627915-118627937 TAGGCTAATTATTATTTCATTGG + Intergenic
1185919741 X:4077883-4077905 CAGGCTGATTTCTGCTTAATTGG + Intergenic
1186010017 X:5119823-5119845 AAGGTTAATTTTTATTTAAGAGG + Intergenic
1186382247 X:9073141-9073163 GAAGCTCATTGTTAGTTAATTGG + Intronic
1188519691 X:31024514-31024536 CAGGATAATTTTTCCATAATAGG + Intergenic
1193847699 X:86495457-86495479 GAGGCTGATGGTTACTTTATTGG + Intronic
1194687640 X:96942804-96942826 CAGTCTTATTTATACTTAATTGG + Intronic
1195145326 X:102008932-102008954 GAGGTTAATTTTTACTGAGGGGG - Intergenic
1197503599 X:127273717-127273739 GAGGCTAATTTTTAAAAATTAGG + Intergenic
1198635975 X:138700782-138700804 AAGGCTTCTTTTTTCTTAATAGG + Intronic
1199827741 X:151516429-151516451 GAGGCAAATTTCCACTTAAGAGG + Intergenic
1200757997 Y:7009610-7009632 GAGTCTAAATTTTACATAATGGG + Intronic