ID: 965667651

View in Genome Browser
Species Human (GRCh38)
Location 3:171112293-171112315
Sequence TACAAGACCTTGAGAGGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 4, 3: 10, 4: 221}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965667643_965667651 11 Left 965667643 3:171112259-171112281 CCCGTCCCCAGTGCAAGGAAGTA 0: 1
1: 0
2: 0
3: 13
4: 146
Right 965667651 3:171112293-171112315 TACAAGACCTTGAGAGGAAGGGG 0: 1
1: 0
2: 4
3: 10
4: 221
965667644_965667651 10 Left 965667644 3:171112260-171112282 CCGTCCCCAGTGCAAGGAAGTAA 0: 1
1: 0
2: 0
3: 16
4: 193
Right 965667651 3:171112293-171112315 TACAAGACCTTGAGAGGAAGGGG 0: 1
1: 0
2: 4
3: 10
4: 221
965667646_965667651 5 Left 965667646 3:171112265-171112287 CCCAGTGCAAGGAAGTAAAAAGA 0: 1
1: 0
2: 4
3: 54
4: 445
Right 965667651 3:171112293-171112315 TACAAGACCTTGAGAGGAAGGGG 0: 1
1: 0
2: 4
3: 10
4: 221
965667645_965667651 6 Left 965667645 3:171112264-171112286 CCCCAGTGCAAGGAAGTAAAAAG 0: 1
1: 0
2: 5
3: 31
4: 296
Right 965667651 3:171112293-171112315 TACAAGACCTTGAGAGGAAGGGG 0: 1
1: 0
2: 4
3: 10
4: 221
965667647_965667651 4 Left 965667647 3:171112266-171112288 CCAGTGCAAGGAAGTAAAAAGAG 0: 1
1: 0
2: 1
3: 21
4: 287
Right 965667651 3:171112293-171112315 TACAAGACCTTGAGAGGAAGGGG 0: 1
1: 0
2: 4
3: 10
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965667651 Original CRISPR TACAAGACCTTGAGAGGAAG GGG Intronic
900437874 1:2640064-2640086 TTCAAGACCATGGAAGGAAGCGG + Intronic
901910470 1:12453388-12453410 TATAAGAGCTTGAGAGAAACAGG + Intronic
902528432 1:17074824-17074846 CACAGGGCCTTGACAGGAAGTGG - Intronic
904399936 1:30249501-30249523 TCCAAGACCCTGGGAGCAAGGGG + Intergenic
907409779 1:54275740-54275762 TCCAAGTCCTTGAGAGAAAAGGG - Intronic
909672290 1:78203020-78203042 TCCAAGACTTTGGGAGGCAGAGG - Intergenic
911815663 1:102346628-102346650 TCCAAGAGCTTGAAAGGCAGAGG + Intergenic
913437958 1:118866554-118866576 TAAGAGAGCTTGAGAGGAAGTGG - Intergenic
914785991 1:150831452-150831474 AACAAGACTTTGAGAGAAAAGGG - Intronic
916150973 1:161789983-161790005 TAAATGACCTTGAGAGGATATGG - Intronic
916463676 1:165050699-165050721 TAAGAGACCTTCAGAGGAGGTGG + Intergenic
916606861 1:166351469-166351491 AGCAAGAGCTTGAGAGGAACAGG - Intergenic
916822150 1:168410110-168410132 TAAAGGACCATGAGAGGAAATGG + Intergenic
919726477 1:200887932-200887954 TAGAAGAGCTGTAGAGGAAGGGG + Intergenic
920377992 1:205519557-205519579 GACAGGAGCCTGAGAGGAAGTGG - Intronic
921580222 1:216887692-216887714 AACAAGCCATTCAGAGGAAGTGG - Intronic
921924711 1:220701912-220701934 GACAGGAGCTTGAGAGGAAATGG - Intergenic
922394681 1:225184367-225184389 TCCAAGACTTTGGGAGGCAGAGG + Intronic
923208696 1:231783343-231783365 TTAAAGAACTTGTGAGGAAGGGG + Intronic
924802994 1:247341417-247341439 TCCAAGACTTTGAGAGGCCGAGG - Intergenic
1063649888 10:7924291-7924313 TACAAAACCATGAAAGAAAGCGG + Intronic
1064232290 10:13539726-13539748 TACAAGACAGTGACGGGAAGAGG + Intergenic
1069123114 10:64594197-64594219 TACATGCCCTTGAAAGGAAGAGG - Intergenic
1071235812 10:83646895-83646917 TACAAAATTTTGAGAGGAGGTGG + Intergenic
1072001492 10:91199840-91199862 GACAAGAATTTGAGAGTAAGTGG + Intronic
1072913055 10:99520654-99520676 TACCAGCCCTTGAGAGGATCTGG - Intergenic
1073067242 10:100769900-100769922 TGTTAGACCCTGAGAGGAAGAGG + Intronic
1073287447 10:102397358-102397380 TACAAAAACTTCAGAGGCAGCGG + Exonic
1073345869 10:102782548-102782570 AAGAAGCCCTAGAGAGGAAGAGG - Intronic
1074118666 10:110476960-110476982 GACAAGACCTTCAGATGTAGTGG - Intergenic
1074402489 10:113153422-113153444 TCCAAGACATCGACAGGAAGGGG - Intronic
1074455147 10:113589790-113589812 TACTTGACCTTGAGGGTAAGAGG + Exonic
1075370742 10:121932822-121932844 TACAACACCTTTAGAGGGAAAGG - Intergenic
1077101896 11:826121-826143 GACAGGACCTTGAGACCAAGGGG - Intergenic
1077240773 11:1509278-1509300 TGCATGACCCTGAGAGGGAGAGG - Intergenic
1078147806 11:8733908-8733930 GACAGGACCTTCAGAGGAAAGGG - Intronic
1084859191 11:72007128-72007150 AAGATGCCCTTGAGAGGAAGTGG + Intronic
1088428632 11:109732366-109732388 TACTAGACATTGACAGGAAAGGG + Intergenic
1091055359 11:132413134-132413156 TAATACACCTTGATAGGAAGAGG + Intergenic
1091430807 12:432737-432759 TATAAGACATTAAGAGGAACTGG + Intronic
1091548380 12:1519327-1519349 AACAAGACGGGGAGAGGAAGGGG - Intergenic
1091680182 12:2521491-2521513 TCCAGGCCCTGGAGAGGAAGAGG - Intronic
1091699554 12:2650875-2650897 TACAAGACCCTGGAAGGGAGAGG - Intronic
1093322431 12:17729565-17729587 TCTAAGACCTTGAGAAGAATGGG - Intergenic
1093916775 12:24811559-24811581 TACAAAACCTTCAGAGCATGAGG + Intronic
1096474388 12:51899231-51899253 TGGAAGAGCTGGAGAGGAAGAGG + Intergenic
1099480400 12:83158578-83158600 TACAAGTCCTTGTGAGAAAGTGG - Intergenic
1099709268 12:86200012-86200034 GAGAAGAGCTTGACAGGAAGGGG - Intronic
1100500912 12:95173266-95173288 CACAAGACATGGGGAGGAAGAGG + Intronic
1100569447 12:95833321-95833343 TTCAAGACCAAGAAAGGAAGGGG - Intergenic
1101195857 12:102381465-102381487 TTCCAGACTTTGAGAGGTAGAGG - Intergenic
1101878511 12:108610830-108610852 TCCAAGCCCCTGAGAGGGAGAGG - Intergenic
1105569869 13:21591945-21591967 TAAAAGACCTAGAGAGGCAAGGG + Intronic
1110278955 13:73670478-73670500 GACAACACTTTGAGAGCAAGAGG - Intergenic
1114080461 14:19198665-19198687 TTCAAGACCATGGAAGGAAGGGG + Intergenic
1114482892 14:23046389-23046411 TAAAAGACTAAGAGAGGAAGGGG - Intergenic
1115747495 14:36452279-36452301 TTAAGGACCTTGAGAGGAGGGGG + Intergenic
1117843548 14:59886514-59886536 CACAAGCCCTTGAGAGCCAGAGG + Intergenic
1120135179 14:80858896-80858918 AACAAGTCCTGGAGAGGATGTGG + Intronic
1120149041 14:81012582-81012604 AACAAGTCCTGGAGAGGATGTGG - Intronic
1120459857 14:84780862-84780884 GACAAGACATTGTGAGAAAGTGG - Intergenic
1122057158 14:99108227-99108249 TCCAGGACTTTGAGAGGCAGAGG - Intergenic
1123174058 14:106401036-106401058 TACAAGACCTTGACATGGATGGG - Intergenic
1123182268 14:106481970-106481992 TACAAGACCTTGACATGGATGGG - Intergenic
1202944636 14_KI270726v1_random:14760-14782 TACAAGACCTTGACATGGATGGG + Intergenic
1124159794 15:27257904-27257926 TATAACACTTTGAGAGGCAGAGG - Intronic
1125124899 15:36208674-36208696 TACAAGGCCTTGAGATGACCCGG - Intergenic
1127604701 15:60574587-60574609 TACAAGAGGATGAGAGGATGGGG + Intronic
1128238119 15:66081177-66081199 TCCCAGACCTGGAGAGGATGGGG - Intronic
1129056349 15:72823147-72823169 ACCAAGACCTTGAGAGGTCGTGG + Intergenic
1129316616 15:74749155-74749177 TCCAAGACTGTGAGAGGATGGGG + Intronic
1134011887 16:10859913-10859935 TACTTCCCCTTGAGAGGAAGAGG - Intergenic
1138222446 16:55264350-55264372 TCCCAGACCTAGAGAGTAAGGGG + Intergenic
1140704104 16:77610043-77610065 TGAAAGACCTTTGGAGGAAGGGG - Intergenic
1144862750 17:18315752-18315774 AAGAAAACATTGAGAGGAAGTGG - Exonic
1145085878 17:19938980-19939002 CACAACACTTTGAGAGGCAGAGG - Intronic
1146044448 17:29492135-29492157 TCCAAGCCCTTGAGAGGCTGAGG - Intronic
1147850690 17:43440325-43440347 TACAAGACCTAGAGCAGAAGAGG + Intergenic
1148737028 17:49870745-49870767 TACAAGACCTAAAGATGAGGAGG - Intergenic
1149375721 17:56042200-56042222 TACAAGCCCTGGAGGGGCAGGGG + Intergenic
1151199876 17:72460068-72460090 TAGAAGAGCTTGACAGGAGGTGG + Intergenic
1151883635 17:76910694-76910716 TGCAAGAGCTTGAGAGGAAGTGG - Intronic
1152055496 17:78022437-78022459 TTCAAAACCTTCAGAGGAAAAGG - Intronic
1152703212 17:81829746-81829768 TGGAAGACTTTGAGGGGAAGGGG - Intronic
1154210455 18:12375468-12375490 TCCAACACTTTGAGAGGAGGAGG + Intronic
1155080779 18:22407894-22407916 TACAAGACATGGAGAGGCTGGGG - Intergenic
1155123043 18:22842284-22842306 TTCAAGACCATGAGAGTGAGCGG - Intronic
1157919141 18:51697835-51697857 AAGAAGATCTTGAGAGGAAGAGG - Intergenic
1159197325 18:65134238-65134260 TGCATGAACCTGAGAGGAAGAGG + Intergenic
1159239174 18:65719088-65719110 TAGAAAACCTTGAGAAGAATTGG - Intergenic
1164157717 19:22606566-22606588 TACAAAACATTTAGAGGAGGAGG - Intergenic
1164362565 19:27531496-27531518 TACAAGACCTTGAATGAAAAAGG + Intergenic
1164545432 19:29157804-29157826 TTGAATACCTAGAGAGGAAGAGG - Intergenic
1166160425 19:40948673-40948695 TTCAACACCCTGAGAGGCAGAGG + Intergenic
1166914476 19:46185848-46185870 TACATGACCTTGGGAGGCCGGGG - Intergenic
1167052323 19:47086773-47086795 GACAAGTCCCTGTGAGGAAGGGG - Intronic
926123715 2:10258479-10258501 GGCAGGACCTTGAGGGGAAGGGG - Intergenic
926692340 2:15746123-15746145 CTCCAGACCTTGAGAGGATGTGG - Intergenic
927342443 2:21997696-21997718 TAACAGGCTTTGAGAGGAAGAGG + Intergenic
928260020 2:29758258-29758280 CACAACACCTTGAGAGGCTGAGG - Intronic
929989958 2:46778562-46778584 AGCAAGTCCTTTAGAGGAAGGGG - Intergenic
930007271 2:46908125-46908147 GACAAGGCCTTGAGAGGAGCAGG + Intronic
931071868 2:58660539-58660561 TACAGCACTTTGAGAGGCAGAGG + Intergenic
937623376 2:124015846-124015868 CACAACACCTTGAGAAGCAGAGG - Intergenic
937835238 2:126464856-126464878 CTCAAGACCTTGATAGGCAGCGG - Intergenic
939200186 2:139023844-139023866 GACAATACCTTGAAAGGATGAGG + Intergenic
939548070 2:143578242-143578264 TAAAAGACCTTGAAAGCATGTGG - Intronic
940607469 2:155944902-155944924 TTACTGACCTTGAGAGGAAGGGG + Intergenic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
943647211 2:190418988-190419010 CACAATACCCTGAAAGGAAGAGG + Intronic
944173247 2:196801826-196801848 CACATTACCTTGAGATGAAGTGG + Intergenic
947062243 2:226180158-226180180 CACAACAAGTTGAGAGGAAGGGG - Intergenic
1169439165 20:5619825-5619847 TCCAACACTTTGGGAGGAAGAGG - Intergenic
1169944987 20:10978829-10978851 TTCAAGGGCTTGAGAGAAAGAGG + Intergenic
1172233738 20:33355205-33355227 TCCAAGACTTTGGGAGGACGGGG + Intergenic
1175366062 20:58457047-58457069 GCCAAGACCTTGAGAGGGACTGG + Intergenic
1176006993 20:62870864-62870886 TACAGGAGGATGAGAGGAAGGGG - Intergenic
1176155269 20:63616802-63616824 TACAGGACCCTGAGAGCTAGGGG + Intronic
1176417165 21:6483190-6483212 TACATGACTTTGAGAGGCTGAGG - Intergenic
1177441490 21:21132351-21132373 TACAGGATCTTGAGATGAAATGG - Intronic
1178511072 21:33205595-33205617 TACAAGTTCTTAAGGGGAAGTGG + Intergenic
1179406897 21:41133578-41133600 TACACAACTTTGAGTGGAAGAGG + Intergenic
1179692662 21:43091523-43091545 TACATGACTTTGAGAGGCTGAGG - Intergenic
1180500318 22:15924019-15924041 TTCAAGACCATGGAAGGAAGGGG - Intergenic
1183235440 22:36613551-36613573 TACAAGATAATCAGAGGAAGAGG - Intronic
951407888 3:22323523-22323545 TACAAAACCGTGAGAAGAAAAGG + Intronic
952816806 3:37453137-37453159 TACAAGACCCTGGGTGGAAGTGG + Intronic
954299659 3:49693438-49693460 TACTAGAACTTGGGAGGCAGAGG - Intronic
954436014 3:50496739-50496761 TCCAAGACCCTGAGAGGCTGTGG + Intronic
956225121 3:66948799-66948821 CACAAACCCTTGAGAAGAAGAGG - Intergenic
957990186 3:87616953-87616975 CACAAGACCTTGGGATGAGGTGG + Intergenic
958190378 3:90176697-90176719 TAAAAGAATTAGAGAGGAAGGGG + Intergenic
958412053 3:93830294-93830316 TAAAAGAATTAGAGAGGAAGGGG + Intergenic
959218996 3:103491014-103491036 TAAAACAGGTTGAGAGGAAGGGG - Intergenic
959300420 3:104592573-104592595 CAGAAGAGCTTCAGAGGAAGTGG + Intergenic
959307796 3:104691596-104691618 TACAAGTGCTGGAGAGGATGTGG - Intergenic
959376563 3:105594904-105594926 TAAAAGACCTGAAAAGGAAGGGG + Intergenic
960705664 3:120478310-120478332 TCAAAGACCTTGAGATGAATGGG - Intergenic
962178756 3:133183295-133183317 GATAAGACTTTAAGAGGAAGAGG - Intronic
965667651 3:171112293-171112315 TACAAGACCTTGAGAGGAAGGGG + Intronic
966202485 3:177371781-177371803 TACCAAACATTGAGAGGAGGTGG - Intergenic
969820682 4:9717925-9717947 TAAAAGAGATGGAGAGGAAGGGG - Intergenic
969998562 4:11340578-11340600 TAAAAGAGATAGAGAGGAAGGGG - Intergenic
970008318 4:11430712-11430734 CACAAGACCTTGAAAGAAACTGG + Intergenic
970403320 4:15738594-15738616 TAAAAAACCTTGATGGGAAGTGG + Intergenic
971225871 4:24751108-24751130 TACAAGAAGTTTAGAGGAAGGGG - Intergenic
971928918 4:33052766-33052788 TACTAGTCATTGAGTGGAAGTGG - Intergenic
974034251 4:56803552-56803574 TCCAAGACATAGTGAGGAAGTGG + Intergenic
975209030 4:71677684-71677706 TGCAACACCTTGATAAGAAGTGG - Intergenic
975480536 4:74874983-74875005 AACAAGACCTAGAGGAGAAGAGG + Intergenic
976734962 4:88300126-88300148 TACTTGACCTTGAGAGGTTGAGG - Intergenic
977813598 4:101387268-101387290 TACCAGACATTCAGAGGAATTGG - Intergenic
977938389 4:102830963-102830985 TATAATAACTTGAGAGTAAGGGG + Intronic
978563217 4:110055108-110055130 TCCAAGACCGTGAGAGGACTTGG - Intronic
978862901 4:113471815-113471837 TTCTAGACCATGAGAGGAGGGGG - Intronic
980429609 4:132676566-132676588 TCCAAGACCTTGGGAGGCCGAGG + Intergenic
980736716 4:136899766-136899788 AAAAAGACCTTGAAAGGAAAGGG + Intergenic
982106786 4:152018242-152018264 TGCAAGAGCTTTAGAGCAAGAGG - Intergenic
983304732 4:165971776-165971798 TGGCAGAGCTTGAGAGGAAGAGG - Intronic
985287887 4:188355825-188355847 TACAAGTGCTGGAGAGGATGTGG - Intergenic
987237701 5:15959630-15959652 TATGAGACTTGGAGAGGAAGTGG + Intergenic
989664804 5:43841670-43841692 GACATGCCCTTGAAAGGAAGGGG - Intergenic
991185329 5:63800058-63800080 TTAAAGACATTGAGAGGAGGAGG - Intergenic
991295552 5:65076466-65076488 TACAAGACGTTTAAAGGCAGAGG + Intergenic
993718342 5:91297244-91297266 TAGAAGAACTTTAGAGGAGGTGG + Intergenic
994369521 5:98952240-98952262 AAAAAGCCCTTGAGAGAAAGGGG + Intergenic
997039662 5:130236590-130236612 TAAAGGATATTGAGAGGAAGTGG + Intergenic
997258760 5:132449365-132449387 TACAAGGCCTTGAGACAAAGTGG + Intronic
998614385 5:143723953-143723975 TTCAAAAACTTGAGAAGAAGGGG - Intergenic
998903971 5:146883811-146883833 TACAACACTTTGAGGGCAAGAGG - Intronic
999086807 5:148899379-148899401 TGCCAGTCCTGGAGAGGAAGAGG + Intergenic
999925111 5:156367411-156367433 TTCCAAACCTTGAGAGGAAAGGG + Intronic
999985361 5:156999306-156999328 TCCAACACCTTGGGAGGCAGAGG + Intergenic
1000260278 5:159581548-159581570 TACTAAACCCTGAGAAGAAGGGG + Intergenic
1003439394 6:6125077-6125099 TGCAAGAGATAGAGAGGAAGGGG - Intergenic
1005067475 6:21832563-21832585 TACAAGACCATGAGAGCAAGAGG + Intergenic
1007887108 6:45242294-45242316 GACAACAACTTGAGAGGTAGAGG + Intronic
1008787147 6:55182389-55182411 TCCAAGAGCTAGAGAGAAAGTGG - Intronic
1010473107 6:76253364-76253386 TACCAGGCCTTGAGAGAGAGGGG + Intergenic
1011715694 6:90102944-90102966 TACAATACTTTGAGGGGCAGTGG + Intronic
1012410757 6:98954355-98954377 TCCCAGACTTTGAGAGGCAGAGG - Intergenic
1015998322 6:139017224-139017246 TACAAAGCCTAGAGTGGAAGGGG - Intergenic
1016199018 6:141385008-141385030 TAGAAGAACTTGAGAGGATTGGG - Intergenic
1018074878 6:160203185-160203207 TCCAAGACCTCAAGAGCAAGGGG + Intronic
1021039059 7:15838846-15838868 AATAATACCTTTAGAGGAAGTGG - Intergenic
1022178421 7:27894747-27894769 TACAACACCTTGAGAAGAAGGGG - Intronic
1023223298 7:37943319-37943341 TAACAGACTTTGAGAGGAATTGG - Intronic
1023272546 7:38480327-38480349 CACATGACCCTGAGAGTAAGGGG - Intronic
1023662816 7:42488217-42488239 TACAAGTTTTTGAAAGGAAGGGG + Intergenic
1024666056 7:51548331-51548353 AACAAGTCCCTGAGAGGAAATGG - Intergenic
1028672128 7:93413704-93413726 TACCAGAAGTTGAGGGGAAGGGG - Intergenic
1029179029 7:98685967-98685989 TGAAGGACCTTGAGAGGAGGTGG + Intergenic
1029467356 7:100734637-100734659 AAAAAGACCTTGAGAGGAAGGGG + Intronic
1034713949 7:153221920-153221942 AACAAGTCCTGGAGAGGATGTGG + Intergenic
1036044631 8:5125856-5125878 TACAAGCCTTTGAAAGGAATGGG + Intergenic
1041926708 8:63244251-63244273 TACATAAACTTAAGAGGAAGTGG - Intergenic
1042808788 8:72801120-72801142 TGTTAGACCTTGAGAGGATGGGG + Intronic
1044512748 8:93101747-93101769 TACAAGAAGGTGAAAGGAAGAGG + Intergenic
1044607742 8:94061810-94061832 CATAATACCTGGAGAGGAAGAGG - Intergenic
1045912752 8:107429209-107429231 TACAGGGCCTTGAGAGAAATAGG + Intronic
1046566891 8:115913254-115913276 TCCCAGACTTTGAGAGGCAGAGG + Intergenic
1046592653 8:116224745-116224767 TACAAGAATTTAAGGGGAAGAGG + Intergenic
1046599409 8:116298592-116298614 CACAACACTTTGGGAGGAAGAGG - Intergenic
1048282716 8:133116851-133116873 TGCAAGACAGTGAGATGAAGTGG - Intronic
1048537088 8:135306942-135306964 GACAAAACCATGAGAAGAAGTGG + Intergenic
1048896624 8:138997973-138997995 CTCAAGGCCTTGGGAGGAAGAGG + Intergenic
1049675645 8:143887705-143887727 TCCAAGCCCCTGGGAGGAAGGGG + Intergenic
1050760768 9:9067499-9067521 GAGAAAAGCTTGAGAGGAAGAGG - Intronic
1051227012 9:14910002-14910024 TAAAGGGCTTTGAGAGGAAGGGG + Exonic
1051770915 9:20578425-20578447 TCCAAGACTTTGGGAGGCAGAGG + Intronic
1051957603 9:22714366-22714388 TGCAAAAACTTGAGAGGAAGTGG + Intergenic
1052262013 9:26527957-26527979 TACAAGCCCCAGAAAGGAAGAGG - Intergenic
1053145069 9:35706544-35706566 TGCAAGGCCTGGGGAGGAAGTGG + Exonic
1054782920 9:69182420-69182442 TGCAACACATTGAAAGGAAGAGG + Intronic
1055994699 9:82144784-82144806 GACATGTCCTTGAGATGAAGTGG - Intergenic
1058071829 9:100609286-100609308 TAGAAGACCCTGAGATGATGGGG + Intergenic
1058627858 9:106953876-106953898 AACAAGACCTGGAGTGGCAGAGG - Intronic
1059862801 9:118483798-118483820 TACAAGACTTTGACAGGGAATGG - Intergenic
1060533407 9:124363246-124363268 GACAAGCGCTTGAGAGGAGGAGG + Intronic
1060960164 9:127675140-127675162 TACAAGGCCCTGTGAGGGAGCGG - Intronic
1062728072 9:138089063-138089085 TAGAAGAGCTTGAGAAGAACAGG - Intronic
1186139692 X:6558514-6558536 CACAAAACCTTGAGAGTGAGAGG + Intergenic
1186316747 X:8378927-8378949 TCCAACACTTTGAGAGGCAGAGG + Intergenic
1187362592 X:18642149-18642171 TAGAAGACCTAGAGAGATAGAGG + Exonic
1187417238 X:19103900-19103922 TACAAGGTCTTGAGGGGAAAAGG + Intronic
1189963067 X:46343774-46343796 GAGAAGACCCTGGGAGGAAGGGG - Intergenic
1191118525 X:56876900-56876922 TACAAGAACATGAGTGGAACTGG - Intergenic
1191689106 X:63921658-63921680 CACAAGACTTTGAGAAGAATAGG + Intergenic
1192836899 X:74809496-74809518 TACAAAACCTGCAGAGGAACTGG + Intronic
1194013276 X:88587593-88587615 TCCAAGAAATTGAGAAGAAGGGG + Intergenic
1196314674 X:114209257-114209279 TGTAAGTCATTGAGAGGAAGAGG + Intergenic
1197365228 X:125556529-125556551 TTCAAGGCCTTTAGTGGAAGAGG + Intergenic
1197635802 X:128913772-128913794 TTCAAGGAGTTGAGAGGAAGAGG + Intergenic
1197899244 X:131352005-131352027 TACAAGAGCTGGTGAGGATGTGG + Intronic
1199372204 X:147063534-147063556 TAAAAAACCTTGGGAGGAAAGGG - Intergenic
1201621013 Y:15957777-15957799 CACAAAACCTTGAGAGTGAGAGG - Intergenic