ID: 965669115

View in Genome Browser
Species Human (GRCh38)
Location 3:171128428-171128450
Sequence AATGCTTGTTCTCACCTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965669113_965669115 23 Left 965669113 3:171128382-171128404 CCTCAAAGTTTCTATGAATTCTA 0: 1
1: 0
2: 4
3: 30
4: 314
Right 965669115 3:171128428-171128450 AATGCTTGTTCTCACCTTGCAGG 0: 1
1: 0
2: 3
3: 16
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965669115 Original CRISPR AATGCTTGTTCTCACCTTGC AGG Intronic
900933716 1:5752542-5752564 AGTGCCTGCTGTCACCTTGCAGG + Intergenic
901943807 1:12684654-12684676 AATCCTTGTTCTGTCCTTACGGG - Intergenic
909329510 1:74395176-74395198 ATTGCTTGTTGTAACCATGCTGG + Intronic
918303439 1:183224723-183224745 AATACTCGTTCCCACCTTCCAGG + Intronic
920729115 1:208466276-208466298 AATTTTTGTTCTTCCCTTGCGGG - Intergenic
921051230 1:211513272-211513294 CATGCTGCTTCTCACCATGCAGG + Intergenic
922361959 1:224831019-224831041 GATGCTTGTTCTGACATTGTAGG - Intergenic
923288323 1:232519038-232519060 AATGGTTGTTAACACTTTGCAGG + Intronic
923443884 1:234049522-234049544 AATGCATTTTCTCACATTTCTGG - Intronic
923783913 1:237049647-237049669 AAAGCTTGTTGTCAGCTTTCAGG - Intronic
924800545 1:247326969-247326991 AAAGCTTGTTGTCAGCTTTCAGG + Intronic
1065952897 10:30668045-30668067 AGTCCTTGTTCTCACCAAGCAGG + Intergenic
1067118220 10:43451996-43452018 AGTCCTTGTTCTCATCATGCAGG - Intronic
1068346890 10:55792678-55792700 AACGCTTGTTCTCACAGTTCTGG + Intergenic
1069072664 10:64005719-64005741 ATTGCCTGTGCTGACCTTGCAGG + Intergenic
1069568619 10:69480317-69480339 AATGCTTCTTCTTCCCTGGCAGG - Intronic
1074121137 10:110495359-110495381 AAAGCTTGTTCTCACTATGTCGG - Intergenic
1074227919 10:111505592-111505614 ACTGCTTGTGCTCACCTGCCAGG - Intergenic
1074729879 10:116359652-116359674 AAAGCTGGTTCTCAACTTGGGGG - Intronic
1075780206 10:125012482-125012504 ACTGCTTGTTCTCTTCCTGCCGG + Intronic
1077006375 11:359542-359564 AATGTATTTTCTCACCTTTCTGG + Intergenic
1078063697 11:8064256-8064278 CATGCTTGTCCCCACCTTGATGG + Intronic
1078302565 11:10147482-10147504 ACTGCATGTTCTCACTTTGAGGG + Intronic
1083078825 11:60069588-60069610 ACTGCTGATTCTCACCTTGCTGG + Exonic
1083901356 11:65645050-65645072 CATGCAGTTTCTCACCTTGCTGG + Exonic
1083989578 11:66238782-66238804 AGTGCCTCTTCTCTCCTTGCAGG + Exonic
1086541506 11:87917633-87917655 AAGGCATGTTCTCTCCTTGTTGG - Intergenic
1091132282 11:133156469-133156491 AATGCATGTGCTCAGCTGGCTGG - Intronic
1092893238 12:12989124-12989146 ACTGCTTGTTCACACAGTGCAGG + Intronic
1093562102 12:20553417-20553439 GATGCTTGCTCTGACCTTGGGGG - Intronic
1094045687 12:26163910-26163932 ACTGCTTTTGCTCACCTTGGTGG - Intronic
1097797416 12:63878834-63878856 AGTGCTAATTCTCACCTTGTTGG + Intronic
1097828990 12:64204035-64204057 ACTGCATGTTCTCGCTTTGCAGG + Intronic
1098196915 12:68011954-68011976 ATTGCTTGTTCTGACATTCCAGG - Intergenic
1099358792 12:81671330-81671352 CATTCTTGTTGTCACCTTACAGG + Intronic
1101198769 12:102412990-102413012 AAAGCTGATTTTCACCTTGCAGG + Intronic
1102537785 12:113594038-113594060 AATGCATATTCTCACCAGGCAGG - Intergenic
1103240779 12:119411649-119411671 AGAGCTGGTTCTCACCTTGGGGG + Intronic
1105949129 13:25213809-25213831 AATGCCTGCACTCACCATGCTGG - Intergenic
1106814650 13:33393973-33393995 AATGCATGTTCTCTCCTTGAAGG + Intergenic
1112424179 13:99281551-99281573 GATGCGAGTTCTCACCTTCCAGG - Intronic
1114231847 14:20790396-20790418 AATGCCTGTCCTCACCTCGGTGG - Intergenic
1116054442 14:39845830-39845852 AATGGTAGTTCTTACCTTTCAGG - Intergenic
1117462823 14:55963200-55963222 GATGTTTGTTTTCACCTTGAGGG + Intergenic
1118393763 14:65318235-65318257 AGTGTTTGTTCACACCTGGCAGG + Intergenic
1120706038 14:87746782-87746804 AATGATTGTTTGCACCTTGCAGG + Intergenic
1122048485 14:99039687-99039709 GATGCCTGCTCTCTCCTTGCTGG + Intergenic
1124229584 15:27932232-27932254 AATGTCTGTTCTAACCTGGCTGG + Intronic
1131378430 15:91944404-91944426 AATGCTTTGTCTCACTTTGGTGG - Intronic
1131618972 15:94046876-94046898 AGTCCTTGTTCCCATCTTGCCGG - Intergenic
1132436778 15:101812359-101812381 AATTCTTGTTCTCCCTTTCCAGG - Intronic
1133354734 16:5127558-5127580 AATGCAGGTTCTCATCTGGCAGG - Intergenic
1140535371 16:75704839-75704861 TCTCCTTGTTCTCACCTGGCTGG + Intronic
1142045710 16:87924034-87924056 AATGGTTTTTCTCCCCTTGTTGG - Intronic
1143890740 17:10100498-10100520 AATCCTTGCTCTCACCTGGATGG - Intronic
1147816497 17:43214368-43214390 CATGCTTGTTCCCTCCTTCCTGG - Intronic
1149904533 17:60513393-60513415 AATGCTTGTGATCACCTATCGGG + Intronic
1150606912 17:66699828-66699850 AAGGCTTGTCCTCCCTTTGCTGG + Intronic
1150850021 17:68695502-68695524 AATGCTTGCTTTCACTTTGCTGG - Intergenic
1153048323 18:877140-877162 AGAGCTAGTACTCACCTTGCTGG - Intergenic
1154094789 18:11402692-11402714 AATGCTTGTTTTAATTTTGCAGG - Intergenic
1155718148 18:28972342-28972364 AATGCTTTTTATCATCTTGCAGG + Intergenic
1157607602 18:48935629-48935651 TATGCTTGTTCTCACTCTGCGGG - Intronic
1159211589 18:65329293-65329315 ATTGATTGTTCACAGCTTGCAGG - Intergenic
1160524881 18:79529864-79529886 AATTATTGTTCTCATCTTTCAGG + Intergenic
1161559102 19:4961207-4961229 GATGCTTGCTCTGACCTTGGGGG - Exonic
1162220647 19:9173461-9173483 AAGGCCTGTTCACACATTGCTGG + Intergenic
1163058826 19:14743405-14743427 AATGCGTGATCTTACCGTGCTGG + Exonic
1163103134 19:15109390-15109412 GAAGCTTGTTCTTACCTTGGGGG - Exonic
1165271010 19:34707722-34707744 ACTGCTTGTGCTGGCCTTGCTGG - Intergenic
1168434429 19:56306043-56306065 AATGCTTGCTCTAATCTTCCAGG - Intronic
927804176 2:26130789-26130811 AATGCTTGTTTTAAACTTGGTGG + Intronic
929208938 2:39331657-39331679 AATATTTGTTCTAGCCTTGCTGG - Intronic
930930689 2:56878148-56878170 AATGCCTGCTCTCACCATGCCGG + Intergenic
941651592 2:168098285-168098307 AATGATTGTGCTGACCTTGAAGG - Intronic
944587648 2:201186617-201186639 AATGCCTGTTTTTACCTTTCTGG - Intronic
947974677 2:234355416-234355438 AATGCTTGACCTCAGCTAGCTGG + Intergenic
1169322954 20:4649811-4649833 AATGCCTGTTCTCAGCTGTCAGG + Intergenic
1169411257 20:5372370-5372392 AAAGCTTCTGCTCGCCTTGCAGG + Intergenic
1169605138 20:7309288-7309310 AATGCATGTTCTCACCGTTCTGG + Intergenic
1169855386 20:10096185-10096207 AATCCTTGTACTCACATTGGTGG - Intergenic
1171513536 20:25707726-25707748 AATGTTTGTTTTTACCTTTCAGG + Intergenic
1173840980 20:46157023-46157045 AATGATTGTACCCACCTTGTGGG + Intergenic
1175664701 20:60848538-60848560 AATGTTTCTTGTTACCTTGCAGG - Intergenic
1175784695 20:61705182-61705204 AATATTTGTTCTCACCTTGGTGG + Intronic
1180796875 22:18610234-18610256 GCTGCTTGTTCTCCGCTTGCAGG + Exonic
1181224849 22:21385037-21385059 GCTGCTTGTTCTCCTCTTGCAGG - Exonic
1181253783 22:21549776-21549798 GCTGCTTGTTCTCCTCTTGCAGG + Exonic
1182046812 22:27281271-27281293 AATGCCTGATCTAACCTTGCTGG - Intergenic
1182928262 22:34147927-34147949 ATTGCTAGTTCTCACCTTTCTGG + Intergenic
1182964486 22:34508462-34508484 AATGCTTTTTCTGTCCTTGTAGG - Intergenic
1183891599 22:40934373-40934395 AATGTTTGTTCTAACCTTGTAGG - Intergenic
1184735721 22:46396746-46396768 AATGCTGGCTCTGTCCTTGCAGG - Exonic
952845148 3:37681975-37681997 AATGACTGTTCTCGCCTGGCTGG - Intronic
952849593 3:37716596-37716618 TATGCTTGTTCTGAACTTGTTGG - Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
961294830 3:125876456-125876478 AATGCATGTTCTCAGCTGGGAGG + Intergenic
962267056 3:133951379-133951401 AATGCATGATCTCACCTTACTGG + Intronic
963073231 3:141322317-141322339 AATGCTTTCTCTCAGCTTCCTGG + Intergenic
964899160 3:161636835-161636857 AATTCTTGTTCTGATCTTTCAGG + Intergenic
965669115 3:171128428-171128450 AATGCTTGTTCTCACCTTGCAGG + Intronic
966143142 3:176779469-176779491 TATGCTTTCTTTCACCTTGCTGG + Intergenic
975140950 4:70917825-70917847 AATGCTTGATCCCACATTCCTGG - Intronic
975373494 4:73614960-73614982 AAAGCATGTTCTTACCTTTCAGG - Intronic
978837599 4:113171514-113171536 AATGCATTTTCTCACTTTGGGGG + Intronic
978950844 4:114556962-114556984 AATGTTTGGTCTCATCTTCCTGG - Intergenic
981148375 4:141352117-141352139 CATGCTTGTTCTCATCTTTAGGG + Intergenic
982467576 4:155749338-155749360 AATGCTCATTCTCACCTCCCAGG + Intergenic
984975632 4:185227931-185227953 AATGCTCTTTCTCTCCTTGGTGG - Intronic
985323792 4:188744310-188744332 ATTGCTTGTTCTGACTTTGGTGG + Intergenic
985394847 4:189531281-189531303 AGTTCTTGTTCTCCACTTGCAGG + Intergenic
987652452 5:20760276-20760298 AATGCTTGCTGTCATCTTGGTGG - Intergenic
987870104 5:23605814-23605836 AATTCCTGTCCTCCCCTTGCAGG - Intergenic
988743107 5:34101207-34101229 AATGCTTGCTGTCATCTTGGTGG + Intronic
991491781 5:67190920-67190942 AGTGCTTATTCTCACCTTTTCGG + Intronic
993364040 5:87013802-87013824 AATGTTTATTCTCACCTTCAAGG + Intergenic
996719009 5:126612012-126612034 CATGCTAGTTCTGGCCTTGCTGG - Intronic
998204725 5:140150296-140150318 GATCCTTGTTCTCACCTTCCTGG + Intergenic
999649428 5:153750766-153750788 AATGGTTGTACTCATCTTACAGG - Intronic
1000364119 5:160475226-160475248 AACGTTTCTTTTCACCTTGCAGG + Intergenic
1001877895 5:175216867-175216889 AAAGCCTGTGCTCACCTTCCGGG - Intergenic
1008722323 6:54371253-54371275 AATGCTAGTTCTGTCCTCGCTGG + Intronic
1013156386 6:107494573-107494595 AATGCTTGATCTAATCATGCTGG - Intronic
1015709546 6:136124699-136124721 AATGCTTTTTTTCACATAGCAGG + Intronic
1015826179 6:137314330-137314352 AATGCTTGTTCTCACTTTTCTGG + Intergenic
1016435123 6:144028770-144028792 AATGCTTGTTATCTACGTGCTGG + Intronic
1016874351 6:148850041-148850063 TATACTAATTCTCACCTTGCTGG + Intronic
1017060440 6:150479532-150479554 CATTCTTTTTCTCAACTTGCTGG - Intergenic
1018022989 6:159779880-159779902 AATGACTGTTCTTACCATGCTGG + Exonic
1019615071 7:1955646-1955668 ATGGCTTGTTGTCACCGTGCTGG - Intronic
1022212946 7:28229300-28229322 AATTCTTGTGCACACCTTTCTGG + Intergenic
1024588667 7:50862463-50862485 AATGCTTTTTCACATCTTGGAGG - Intergenic
1027136333 7:75626700-75626722 AATTTTTGTTTTCACCATGCTGG - Intronic
1027572572 7:79888800-79888822 AATTCTTGTTCTCCCTCTGCAGG + Intergenic
1030128517 7:106177795-106177817 AAAGCCAGTTCTCATCTTGCAGG - Intergenic
1031214461 7:118872106-118872128 ACTGCTTGTTGTGACCGTGCTGG - Intergenic
1032418948 7:131762280-131762302 AATTCTTGTTCTGACCTGCCAGG - Intergenic
1034919882 7:155071019-155071041 AGTGCTTATTCTCACCTTGCTGG + Exonic
1035250471 7:157593786-157593808 AAGGCATGTTCTCACCGGGCTGG + Intronic
1037347548 8:17915868-17915890 CATGCGTGTTCTCCCCTTCCCGG + Intergenic
1037991193 8:23322281-23322303 CATGTTTATTCTCCCCTTGCAGG - Exonic
1041426313 8:57724871-57724893 AATGCATGTTCTCAGCTTACAGG + Intergenic
1041813090 8:61933992-61934014 AATGCTTGTGCTAACCTTAAGGG + Intergenic
1043260590 8:78190324-78190346 CATGCTTGTTGTCAGCTTTCAGG + Intergenic
1046212268 8:111092304-111092326 CTGGCTTGTTCTCACCTTTCTGG + Intergenic
1047224674 8:122946219-122946241 GGTGCTGGTCCTCACCTTGCTGG + Intronic
1048629282 8:136224358-136224380 AATCCTTGTTCACCCCTTCCAGG - Intergenic
1052506734 9:29364490-29364512 ACTGCTTCTTCTCACCCTTCAGG + Intergenic
1060710058 9:125853031-125853053 CATTCTTTTTCTCAACTTGCAGG + Intronic
1187095463 X:16143195-16143217 AAAGCTTGTTCCCTCCATGCAGG + Intronic
1191842543 X:65523583-65523605 CCTGCTTGGGCTCACCTTGCTGG - Exonic
1192612603 X:72582484-72582506 CATCCTTGTCCTCACCATGCTGG - Exonic
1196164840 X:112527343-112527365 AATATCTGTTCTTACCTTGCTGG - Intergenic
1196463990 X:115954885-115954907 AATGCTTGTTCCCATATTCCTGG + Intergenic
1197047981 X:122023208-122023230 TATGCCTGTTCTAACCTTCCTGG - Intergenic
1198255306 X:134919213-134919235 AATGCTTGTACTTCCCTTGCAGG + Intergenic
1201690493 Y:16759468-16759490 GAAGATTGTTCTCACTTTGCAGG + Intergenic
1201929226 Y:19322926-19322948 AATGCTTCTTCTCCCTTTGTGGG + Intergenic
1202083444 Y:21109224-21109246 AAAGCTTGTTTTCACCTTGCAGG - Intergenic