ID: 965670522

View in Genome Browser
Species Human (GRCh38)
Location 3:171143155-171143177
Sequence TGCCAGGGCTTTGGTTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965670518_965670522 -2 Left 965670518 3:171143134-171143156 CCGCTAACACATGGAGGCATCTG 0: 1
1: 0
2: 1
3: 16
4: 136
Right 965670522 3:171143155-171143177 TGCCAGGGCTTTGGTTCCTGTGG 0: 1
1: 0
2: 2
3: 26
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965670522 Original CRISPR TGCCAGGGCTTTGGTTCCTG TGG Intronic
900160264 1:1219970-1219992 TGACGGGGCTGTGGTTCCTGGGG + Intronic
900385647 1:2409420-2409442 CGCCAGGCCTCCGGTTCCTGAGG + Intronic
900412666 1:2520012-2520034 TGCCATGGGCTTGGTTTCTGGGG - Intronic
900559845 1:3298698-3298720 TGCCTGGCCCTTGGTTCCTGGGG + Intronic
900565084 1:3328178-3328200 GGACAGGGCTGTGGTGCCTGGGG - Intronic
900991155 1:6099050-6099072 TGCCAGGGCCTTGGTTGCTGGGG + Exonic
901777794 1:11572369-11572391 TGTGGTGGCTTTGGTTCCTGCGG + Intergenic
902876505 1:19343808-19343830 TGCCAGGGCTCTGCTGCCAGTGG - Intronic
903368308 1:22818360-22818382 AGCCAGGGCGGTGGTTCATGGGG - Intronic
904317940 1:29677881-29677903 TGGCAGGGCTATGCCTCCTGTGG - Intergenic
904905966 1:33897462-33897484 CTCCAGGGCTTTCTTTCCTGGGG + Intronic
905206554 1:36345880-36345902 TCCCTGGGCTTTGGCTTCTGAGG + Intronic
905928315 1:41767787-41767809 TGGCAGGGCTTTTGTTCATCTGG + Intronic
906143559 1:43547295-43547317 TGTTTGGGCTTTGGTTCCTAAGG - Intronic
906547704 1:46632971-46632993 TGCCAGGTCTTTCTTTCCTGTGG - Exonic
906616338 1:47235353-47235375 TGGCAGGGCTTTGGTGGATGAGG - Intergenic
909873679 1:80778039-80778061 TGCCAGAGTATGGGTTCCTGGGG - Intergenic
910795257 1:91091368-91091390 GGTCAGGGCTTTGGGTCTTGCGG + Intergenic
914853005 1:151328555-151328577 TCCCAGCACTTTGGTACCTGAGG - Intergenic
918254527 1:182737034-182737056 TGGCAGGGCTTTGCTTCCCTTGG + Intergenic
920577478 1:207072212-207072234 TTACAGGGGTTTGGTTCTTGGGG - Exonic
922578225 1:226677514-226677536 TTCCAGGGCTTCTGATCCTGGGG - Intronic
922700775 1:227759056-227759078 TCCCTGGGCTTTGTTTCCGGTGG - Exonic
924425088 1:243943250-243943272 TGCCTGGCCTCTGGTTCCTGAGG + Intergenic
1063119842 10:3097568-3097590 AGCCAGGGCCTGGGTGCCTGGGG + Intronic
1065244931 10:23747349-23747371 TTCCTGGGCTTCGGATCCTGGGG + Intronic
1067744854 10:48928175-48928197 TGCCAGGGCTTTGGCTGTAGTGG + Intronic
1069992862 10:72325680-72325702 GGCCTGGGCTTGGGATCCTGGGG + Intergenic
1070812224 10:79304184-79304206 TGCCAGAGCTGTGCTTTCTGGGG - Intronic
1071695474 10:87864244-87864266 TGCCAGGCCTCTGGCTGCTGAGG + Exonic
1072019458 10:91383717-91383739 TGCCAGGGCTCAGGTTCCTAGGG + Intergenic
1073041459 10:100609828-100609850 AGGCAGGGCTGTGGTCCCTGGGG - Intergenic
1073142880 10:101260837-101260859 TGCCAGGGCAGTGGGTTCTGAGG - Intergenic
1074121406 10:110496857-110496879 TGCCAGGGCTTTGCTAGCTGCGG - Intergenic
1074521334 10:114227425-114227447 TGGCAGGGTTCTGATTCCTGTGG + Intronic
1075234293 10:120712407-120712429 TGCGTGGGCTTTGTCTCCTGAGG - Intergenic
1075588774 10:123676652-123676674 TGCCTGGGCTTTGTGTCTTGTGG - Intronic
1076433631 10:130424725-130424747 TGGAAGCGCGTTGGTTCCTGCGG - Intergenic
1077185551 11:1233982-1234004 TGTCAGGGCATGGGTGCCTGTGG - Intronic
1077325064 11:1960150-1960172 TGCCAGGGCATGGGCTCCTGTGG - Intronic
1077842141 11:5986628-5986650 TGCAAGGGCTTTGGGTGCAGTGG + Exonic
1077849198 11:6057973-6057995 TGCAAGGGCTTTGGGTGCAGTGG + Intergenic
1078839666 11:15066827-15066849 TCCCAGGACTTTGACTCCTGAGG - Intronic
1078912108 11:15742462-15742484 TTCCAGGGCTTTTGGTTCTGTGG + Intergenic
1079096686 11:17515456-17515478 TGCCAGTGCTCTGGTTTCTGGGG + Intronic
1081802577 11:45869958-45869980 TGGAAGGGTTTTGGCTCCTGGGG + Intronic
1082424405 11:52571728-52571750 TTCGAGGGCTTTGGGGCCTGTGG + Intergenic
1082902348 11:58268525-58268547 AGACAGGGCTTTGCTTTCTGAGG - Intergenic
1083189880 11:61042196-61042218 TGCCAGGGCTCAGGCTCCAGGGG + Intergenic
1084201535 11:67561924-67561946 TACCAAGGCTCTGGTTGCTGGGG - Intergenic
1084590463 11:70087088-70087110 TGCCATAGCTTTTGTTGCTGGGG + Intronic
1084737745 11:71116728-71116750 TGGGAGGTCTTTGGGTCCTGGGG + Intronic
1085732892 11:79014258-79014280 TGCCTGGGCCATGGTTCCTAAGG - Intronic
1085776341 11:79370130-79370152 TGGCTGGGCTTTGCTTCCTGGGG - Intronic
1086900848 11:92366187-92366209 TGCCAGTGCTTTGTTTACTAAGG - Intronic
1088808277 11:113371199-113371221 TCCCAGGGCTTTGGTATCTGTGG - Intronic
1089397432 11:118145495-118145517 GGCCAGGCCTTTGTTTCCTTGGG - Intronic
1089750322 11:120647148-120647170 TGCCAGGGCTCTGCTTCCCTTGG + Intronic
1090315939 11:125788455-125788477 TGCCAGGGCTTGGGATTATGGGG - Intronic
1202808046 11_KI270721v1_random:15329-15351 TGCCAGGGCATGGGCTCCTGTGG - Intergenic
1091651634 12:2314515-2314537 AGTCAGGGCAGTGGTTCCTGGGG - Intronic
1091949021 12:4576186-4576208 TGCCAGGGGTTTTGTTGTTGGGG - Intronic
1092069360 12:5620344-5620366 TCCCAGGGCTGTGGGTCCTAGGG - Intronic
1092159005 12:6305223-6305245 TGCCAGGGTCTTGGTTCATAGGG - Intergenic
1095077909 12:37955244-37955266 TGTGAGTGCTTTGGGTCCTGTGG - Intergenic
1097985701 12:65780961-65780983 TGCGAGGTGTTTGGATCCTGGGG - Intergenic
1102905418 12:116670953-116670975 TGCCAGGGCCTGGGTGCCAGGGG - Intergenic
1104239328 12:126972261-126972283 AGCCAGGGCTTTCAGTCCTGAGG + Intergenic
1105638726 13:22240710-22240732 TGCCAGGGCTTATTTTGCTGCGG - Intergenic
1106332846 13:28755076-28755098 AGCCAGGGCGTTTGTTCCTGCGG - Intergenic
1106755857 13:32822048-32822070 TGTCAGGGGTGTGGTTCCCGTGG - Intergenic
1107129258 13:36877955-36877977 TGCCAGCGCTTTGGTTTCCTGGG + Intronic
1107613958 13:42144984-42145006 TGCCATGGCATTGATTCTTGCGG + Intronic
1112237653 13:97650856-97650878 GGCCAGGGCTTTGGGTTCAGAGG - Intergenic
1112353445 13:98655290-98655312 TTCCAGGGCTGTGGCTCCAGGGG + Intergenic
1113573935 13:111381698-111381720 TTCCAGGGCTGTGGTGACTGCGG + Intergenic
1113573952 13:111381756-111381778 TTCCAGGGCTGTGGTGACTGGGG + Intergenic
1113574013 13:111381976-111381998 TTCCAGGGCTGTGGTGACTGGGG + Intergenic
1113945361 13:114040959-114040981 TCCCAGGGCTCTGGTTTCCGGGG + Intronic
1115957573 14:38798319-38798341 TGCCATGACTGTGTTTCCTGAGG + Intergenic
1116299499 14:43159476-43159498 TGCCAGGTGTTTGGGTCATGGGG - Intergenic
1123014354 14:105366704-105366726 TCCCTGGGCATTGGCTCCTGTGG + Intronic
1124367259 15:29080958-29080980 TGCCAGGCCTTAGGGTCCTGGGG + Intronic
1128555068 15:68625997-68626019 TGCCACAGCTTTTCTTCCTGGGG + Intronic
1129480868 15:75824461-75824483 AGTCAGGGCATTTGTTCCTGAGG + Intergenic
1129537147 15:76322999-76323021 AGCCAGGGCTCTGGTCTCTGAGG + Intergenic
1131250143 15:90825072-90825094 CCCCAGTGCTTTGGTGCCTGGGG - Intergenic
1131438864 15:92443597-92443619 TGCCAGGGACTTGGTTCTGGGGG - Intronic
1132087058 15:98917073-98917095 GACCAGGGCTTGGGTTGCTGGGG + Intronic
1132704558 16:1237482-1237504 TGCCAGGCGCATGGTTCCTGAGG - Intergenic
1132706955 16:1248943-1248965 TGCCAGGCGCATGGTTCCTGAGG + Intergenic
1133744718 16:8677312-8677334 TGCCAGGGCCAAGGTGCCTGGGG + Intronic
1134178094 16:12024936-12024958 TGCCATGGTTTTGGTTTCTGTGG + Intronic
1134826992 16:17292940-17292962 TGCCAGAGTCCTGGTTCCTGAGG - Intronic
1137394487 16:48107151-48107173 TTCCAGGGGTTTGGGTCCTGTGG + Intronic
1137711684 16:50571273-50571295 GGCCAGGGCTCTGCCTCCTGTGG + Intronic
1137818939 16:51425354-51425376 TGACAGGGCTATGATTTCTGGGG - Intergenic
1138549701 16:57740676-57740698 TGCCTGTGCTTTGCTCCCTGCGG + Intronic
1139592936 16:67943381-67943403 AGCCTGGGCTTTGGCTACTGGGG - Intronic
1140636797 16:76924503-76924525 TCCCAGGGCTTTTGGTTCTGTGG + Intergenic
1141759749 16:86020294-86020316 TCCAAGGGCTTTGGCTCTTGGGG + Intergenic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1143514670 17:7413812-7413834 TGCCAGGCCTAGGGTCCCTGGGG - Intronic
1143539899 17:7562555-7562577 TGCCAGGGATATGGTTCAGGGGG - Intronic
1143628394 17:8123618-8123640 TCCCGGGGCGTTGGTTCCAGAGG - Intronic
1144349590 17:14382209-14382231 TGCCATTGCTTTGCTTCTTGGGG - Intergenic
1145801741 17:27691087-27691109 TCCCAGGACTTTGATCCCTGAGG - Intergenic
1146315780 17:31805775-31805797 GGCCAGGGCTGTGGTCTCTGTGG + Intergenic
1148199434 17:45740136-45740158 GGCCTGGACTTTGGGTCCTGTGG + Intergenic
1148679797 17:49466969-49466991 TGCCAGGACTATGGCTCTTGGGG + Intronic
1148749319 17:49935546-49935568 TCCCAGGTCTTTGGCTCCTATGG + Intergenic
1149019946 17:51951343-51951365 AGCCAAGGCTTTGCTTCCTTGGG - Intronic
1149550783 17:57537906-57537928 TGCCAGGGCTTTTATTCCAAAGG - Intronic
1150630986 17:66880364-66880386 TAGCAGGGCTTTTGTCCCTGAGG - Intronic
1151575654 17:74951514-74951536 AGGCAGGGCCTTGGTCCCTGAGG - Exonic
1152096523 17:78275372-78275394 TGCCAGGGGTTGGGGTCCAGGGG - Intergenic
1153288463 18:3477891-3477913 TCACAGAGCTTTGGTTCCTAAGG - Intergenic
1153998922 18:10466706-10466728 AGCCAGGGCTTCCTTTCCTGAGG - Intronic
1155157870 18:23172606-23172628 TACCAAAGCTTTGGTTACTGTGG - Intronic
1156728630 18:40161850-40161872 TGGCAGGGCTTTGGCTCTTACGG - Intergenic
1159191115 18:65043900-65043922 TGACAGGGTTTTGTCTCCTGAGG + Intergenic
1159245903 18:65804805-65804827 TACCAGGGCTCTGTCTCCTGGGG + Intronic
1160047623 18:75401244-75401266 TGCCCCAGCTTTGGTACCTGAGG - Intergenic
1160843554 19:1156967-1156989 AGGCAGGGCTGTGGGTCCTGAGG - Intronic
1161107516 19:2451969-2451991 TGCCAGGCCTTACGTTCCCGAGG - Intronic
1161108113 19:2454723-2454745 TGCCATGGGTTGGGGTCCTGGGG - Intronic
1162927853 19:13938992-13939014 TCCCAGGGCTTTGGCACCCGTGG + Intronic
1164884281 19:31764279-31764301 TGAGAGGGGTTTGGATCCTGGGG + Intergenic
1165903810 19:39181377-39181399 TGGCAGGGATTTGGTACCGGTGG + Intronic
1166181644 19:41113092-41113114 GGCCAGGGCTCTGGTGCCAGGGG - Intergenic
1166804008 19:45474105-45474127 GGCCAGGGCTGAGGGTCCTGAGG - Exonic
1168488126 19:56782405-56782427 AGCCAGGACTCTGATTCCTGAGG - Intronic
925500757 2:4501653-4501675 TGACAGGGCTGTGCTTCCTTTGG - Intergenic
926163942 2:10506414-10506436 TGTCAGGTCACTGGTTCCTGAGG + Intergenic
932876505 2:75457804-75457826 TGCCTTGGCCTTTGTTCCTGGGG - Intergenic
934619888 2:95797551-95797573 TGCCAGGGCTGTGGTCCAGGCGG + Intergenic
934641000 2:96027006-96027028 TGCCAGGGCTGTGGTCCAGGCGG - Exonic
935218140 2:100990587-100990609 GGACAGGGCTTGGGATCCTGAGG + Intronic
937487347 2:122328705-122328727 TGCCAGGGCATGGGTTCCTGAGG + Intergenic
941491726 2:166150885-166150907 TTCCAGTTCTTTGCTTCCTGAGG - Intergenic
946204715 2:218095839-218095861 TTCCAGGGCAGAGGTTCCTGCGG - Intergenic
948590914 2:239049734-239049756 TCCCAGGGCTCTGGTTCTGGAGG - Exonic
948733346 2:239981052-239981074 TGCCAGGCCTCAGATTCCTGAGG - Intronic
1168906397 20:1407400-1407422 TGCCAGGGCTATGCTCCCTCTGG - Intergenic
1170715067 20:18824269-18824291 TGCCATTGTTTTGTTTCCTGAGG + Intronic
1171958488 20:31476818-31476840 TGACAGGGCTTTCGCTCCTTTGG - Intronic
1172284595 20:33731977-33731999 TAGCCGGGCTTCGGTTCCTGTGG + Exonic
1173318323 20:41964891-41964913 TGCCAGGGCCTCACTTCCTGGGG + Intergenic
1174594355 20:51671735-51671757 TGCCAGGGCTAGGGTTGGTGGGG - Intronic
1175800599 20:61799064-61799086 TGTCAGAGCTGTGGTTACTGAGG + Intronic
1176094126 20:63332016-63332038 AGTCAGGGCTGTGGCTCCTGTGG - Intronic
1176243870 20:64088173-64088195 TCCCAGGGCTGGGGGTCCTGGGG + Intronic
1176763281 21:12983276-12983298 TGGCAGGGCTTTGAGGCCTGTGG - Intergenic
1177817085 21:25988980-25989002 TGCCAGAGCTCTGTTTTCTGGGG + Intronic
1179397069 21:41050413-41050435 TCCCAGGGCTTTGGAGGCTGAGG + Intergenic
1179818661 21:43923767-43923789 TACCAGGGCTTCTGTCCCTGGGG + Intronic
1181546315 22:23604479-23604501 TGCCAGGGCTGAGGTCCCAGAGG - Intergenic
1181812403 22:25411721-25411743 TGCCAGGGCTGTGCTCCCTCTGG - Intergenic
1181901245 22:26157892-26157914 TGTCATGGCTTTAGTTGCTGGGG + Intergenic
1182191903 22:28469719-28469741 TGCCAGGGCTGTGTTCCCTCTGG - Intronic
1183344761 22:37301103-37301125 TGCCAGGGTCTGGGTACCTGGGG - Intronic
1184055238 22:42043137-42043159 TGCCATGGCATTGGTTCTAGTGG + Intronic
1184406369 22:44302980-44303002 AGACAGGGCTTTGGGCCCTGAGG + Intronic
1184966195 22:47973905-47973927 TGGCAGGGAGTTAGTTCCTGGGG - Intergenic
1185339310 22:50284450-50284472 TGGCTGGGCTCTGGTCCCTGGGG + Intronic
949582322 3:5401037-5401059 TGCTAGGGCTTTTGGTCCTGGGG + Intergenic
950109195 3:10407648-10407670 TGCTGGGGCTTTGGAACCTGTGG + Intronic
950577770 3:13843042-13843064 TGCCATGGCTTGGTGTCCTGTGG + Intronic
953150722 3:40322109-40322131 TGCCAGGGCTATGTTTACTAGGG - Intergenic
953489627 3:43337688-43337710 TGCCATGACTGTGTTTCCTGAGG - Intronic
954108175 3:48420180-48420202 GGCCAGGGCTTTGGGGGCTGTGG + Exonic
954541742 3:51397596-51397618 GGTCAGGGCTTTGTTCCCTGTGG - Exonic
954711546 3:52507482-52507504 TGCCAGTGCTGGGCTTCCTGTGG + Intronic
954833928 3:53448067-53448089 TGCCAGGGGTTCGGATCCTGGGG + Intergenic
955874330 3:63474225-63474247 TGCCAGGGAATTAGCTCCTGGGG + Intronic
956586067 3:70866328-70866350 TCCCAGGGCTTTGGGTCCCCTGG + Intergenic
957432373 3:80127464-80127486 TGCCATTGCTTTGGTTCCACTGG - Intergenic
957487605 3:80882825-80882847 TGCAAGGTGTTTGGCTCCTGGGG - Intergenic
957732689 3:84161824-84161846 TGCCAGGGCTTGGGGGCCGGGGG - Intergenic
961038301 3:123658919-123658941 TCCCAGGGCTTTGGTTATTGGGG - Intronic
962370210 3:134814877-134814899 GGCCAGGGCTTGGGTTCCCATGG + Intronic
962978985 3:140470824-140470846 GTCCAGGGCTGGGGTTCCTGGGG - Intronic
963328851 3:143892132-143892154 TGCCCAGGCTTTGTTTCCTAGGG + Intergenic
963591570 3:147267322-147267344 TTTAATGGCTTTGGTTCCTGAGG - Intergenic
963711326 3:148750939-148750961 TGCCAAGGCTGAGGTCCCTGGGG + Intergenic
963800258 3:149669112-149669134 TGCCAGGGGTTTTGTTTTTGTGG + Intronic
964847438 3:161059205-161059227 TGCCATGGCTTTGGATGGTGTGG + Intronic
965670522 3:171143155-171143177 TGCCAGGGCTTTGGTTCCTGTGG + Intronic
966811157 3:183846116-183846138 TGACAGTGCTGTGGTGCCTGTGG - Intronic
966866339 3:184260879-184260901 TGCCAGGGCTCTGCTTCCAGAGG + Intronic
967000430 3:185328645-185328667 TGGCTGGGCTTTGGTTTCCGAGG - Intronic
968392681 4:205788-205810 TGCCAGGGAGTGGGGTCCTGGGG - Intergenic
969284401 4:6193813-6193835 TCCCAGGGCTTTGGCTGCTCAGG - Intronic
969354111 4:6615061-6615083 TGCCAGGCCTTGGGGACCTGAGG - Intronic
969593791 4:8136842-8136864 TGACAGGACTTGGTTTCCTGAGG - Intronic
970075051 4:12208762-12208784 TGGAAGGGGTTTGGGTCCTGGGG - Intergenic
970324291 4:14907029-14907051 TGGCTGGGCCTTGCTTCCTGTGG + Intergenic
973715436 4:53671092-53671114 TACCAGGGCCATGCTTCCTGGGG + Intronic
976372938 4:84311093-84311115 TTCCAGAGCTTTGGGTTCTGTGG + Intergenic
981173906 4:141658243-141658265 TGCCATGATTTTGTTTCCTGAGG + Intronic
981303983 4:143226220-143226242 TGCCATGACTGTGTTTCCTGAGG - Intergenic
981971520 4:150667904-150667926 TGGCAGGGCTGTGTTTCCTCTGG - Intronic
982397475 4:154927673-154927695 TGTCAGGGGTTTGGTGTCTGAGG + Intergenic
985150745 4:186944824-186944846 TGCCAAGTATATGGTTCCTGGGG + Intergenic
985368451 4:189259811-189259833 TGCCAGGATTGTGTTTCCTGAGG - Intergenic
985508996 5:301240-301262 TCCAGGGGCTTTGGCTCCTGGGG + Intronic
985739126 5:1604674-1604696 TCCAGGGGCTTTGGCTCCTGGGG - Intergenic
985914926 5:2910466-2910488 AGCCTGGGCTGTGTTTCCTGGGG + Intergenic
989791170 5:45403431-45403453 TGCCATGGTTATGTTTCCTGAGG - Intronic
990337719 5:54791680-54791702 TGTCAAGGCTTGGGCTCCTGGGG + Intergenic
990694038 5:58395409-58395431 TGCCAGGGTTTTCATTCCTGGGG - Intergenic
992273748 5:75092512-75092534 GGCCAAGGCTTTAGTCCCTGAGG + Intronic
992510360 5:77426857-77426879 CACCAAGGCTTTGCTTCCTGTGG - Exonic
995598340 5:113770808-113770830 TGCTAGGGCTAGGGCTCCTGGGG - Intergenic
996695275 5:126387639-126387661 TGGCAGGCTTTTGTTTCCTGTGG + Intronic
998232934 5:140373023-140373045 TGCCTGGGCTTGGCTCCCTGTGG + Intronic
999347897 5:150840516-150840538 GACCAGGCCTTTGGGTCCTGGGG + Intergenic
999664144 5:153895236-153895258 TGGCAGGGATTTGAGTCCTGAGG + Intergenic
1000259145 5:159569240-159569262 TGCAAAGGCTGTGATTCCTGGGG + Intergenic
1000294129 5:159898074-159898096 TGCCAGGGCTTCTCTGCCTGTGG - Intergenic
1000561226 5:162791921-162791943 TGCCATGACTGTGTTTCCTGAGG - Intergenic
1002313352 5:178328037-178328059 GGCCTGGGCTCTGGATCCTGTGG + Intronic
1003303209 6:4903577-4903599 TGCCAGGGCTTGGGTGCCGGAGG + Intronic
1007052266 6:38844186-38844208 GGCCAGGCCTTTGGTTCCCATGG - Intronic
1007581752 6:42964065-42964087 GGCCAGGGCCTTGGGTTCTGGGG - Exonic
1010257387 6:73774656-73774678 TGCCAGGACTGTGTGTCCTGAGG + Intronic
1011263363 6:85490848-85490870 TGCCAGGGCTTTGGGGCTTTGGG - Intronic
1014406076 6:121052776-121052798 TTTCAGAGTTTTGGTTCCTGTGG - Intergenic
1016349566 6:143152844-143152866 TGCCTGGGCTTGGCTTCCAGTGG - Intronic
1016528161 6:145026954-145026976 TGCCAGGAAATTAGTTCCTGGGG + Intergenic
1017462765 6:154666840-154666862 TGCAAGGGCTTATGTGCCTGTGG + Intergenic
1018029107 6:159828083-159828105 TGCCATGATTTTGTTTCCTGAGG - Intergenic
1018848801 6:167573132-167573154 TGGCAGGGCTTTGCTGGCTGGGG - Intergenic
1019278609 7:188803-188825 TCCCAGGGCTTTGCATACTGAGG + Intergenic
1019453640 7:1113332-1113354 TTTCAGGGCATTGGTTGCTGGGG - Intronic
1019738261 7:2660834-2660856 TGCCAGGCCTGTGGGTCCTTTGG + Intronic
1019751831 7:2735434-2735456 GTCCAGGGCTTTGTGTCCTGTGG - Intronic
1019966933 7:4506999-4507021 AGCCAGCGCTGTGGTTTCTGAGG + Intergenic
1020066151 7:5190132-5190154 TGCCTGGGCTTGGGTTCCGGTGG - Intergenic
1022817695 7:33929151-33929173 TGCCAGGGCCTGGGTCTCTGGGG + Intronic
1022998617 7:35784582-35784604 AGGCTGGGCTTTGGTTCCGGTGG + Intergenic
1024000350 7:45185354-45185376 TTCCAGGGCTTGGGTTCCAGGGG - Intronic
1024062647 7:45710396-45710418 TTTCAGGGCTTTGTTTCCTGGGG - Intronic
1026911220 7:74093018-74093040 TGCCTGGGCTTTGGTGCGGGTGG - Intronic
1026963736 7:74426120-74426142 AGCCAGGGCCATGGTCCCTGAGG - Intergenic
1029679271 7:102096814-102096836 TCCCTGGGCTTTAGTTTCTGAGG + Intronic
1029877260 7:103767277-103767299 TACTAGGGCTGTGGTTCCTGAGG + Intronic
1030424289 7:109354010-109354032 TAGCAGGCATTTGGTTCCTGGGG + Intergenic
1031587256 7:123547132-123547154 TGTCAGGGCTGTGCTTCCTTTGG - Intronic
1031657783 7:124379802-124379824 TGCCATGGCTGTGCTGCCTGTGG - Intergenic
1032186958 7:129734957-129734979 TGGTAGGGCTGTGGATCCTGGGG + Intronic
1037096155 8:14990329-14990351 GGCCAGGGATCTGGTACCTGGGG - Intronic
1037566862 8:20125436-20125458 TGCCATGACTGTGTTTCCTGAGG - Intergenic
1037812430 8:22095015-22095037 TGCCAAGGCTTTGGCTCTTTGGG - Intronic
1038702346 8:29860458-29860480 TGCCAGTCCTTTAGATCCTGAGG + Intergenic
1038866773 8:31447053-31447075 TGGCAGGGCTGTGGTTCCCCTGG + Intergenic
1041409316 8:57536019-57536041 GGCCAGGGCTCTGGCTCCAGAGG - Intergenic
1043245665 8:77997238-77997260 AGCTAGGGCTTTTCTTCCTGGGG - Intergenic
1044806959 8:96018177-96018199 TGGCAGGGCTATGAGTCCTGAGG + Intergenic
1046016823 8:108615405-108615427 TCCAAGGGCTTTGGTTTATGTGG - Intronic
1049023365 8:139972615-139972637 GGCCAGGGCTGTGGTGTCTGGGG - Intronic
1049370200 8:142260789-142260811 GGGCAGGGCTTTAGTGCCTGAGG - Intronic
1052888792 9:33676851-33676873 TGCCAGGCCTCTGGCTGCTGAGG - Intergenic
1053409537 9:37906607-37906629 AGGCAGGGCCTGGGTTCCTGGGG + Intronic
1057141253 9:92727967-92727989 TGCCAGGGCCTCGGTGTCTGTGG - Intronic
1057972855 9:99574024-99574046 TGCCCAGGCTTTGGTGCCTCAGG - Intergenic
1061565833 9:131439236-131439258 TGCCAGCTCTTTGGTTTCTTTGG + Intronic
1061858326 9:133455279-133455301 TGGCAGTGCTCTGTTTCCTGTGG + Exonic
1189011267 X:37048035-37048057 TGCCATGATTTTGTTTCCTGAGG + Intergenic
1189398355 X:40643425-40643447 TGCCAGGGCTTTGGGGAATGAGG - Intronic
1189996720 X:46646282-46646304 TACCAGGGCTTTGTGTACTGAGG - Intronic
1190123962 X:47686982-47687004 TTCCAGGGATTTGGGACCTGAGG + Intergenic
1195155765 X:102122858-102122880 TGGCAGAGCTTTGCTTCCTCTGG + Intergenic
1195621791 X:106963644-106963666 TGCCAGGACTTTGAATCCTCTGG - Intronic
1197467470 X:126821814-126821836 ATCCAAGGCTTTGGTTCCTGGGG - Intergenic
1198375029 X:136030401-136030423 TGCCTGGGCTTTTGTCCCAGAGG + Intronic
1199571528 X:149271568-149271590 TGCCAGAGCCTAGGGTCCTGGGG - Intergenic
1200037706 X:153344163-153344185 TGCCAGGACCTGGTTTCCTGGGG - Intronic
1200930752 Y:8694971-8694993 TGTCAGGATTTGGGTTCCTGTGG - Intergenic