ID: 965679181

View in Genome Browser
Species Human (GRCh38)
Location 3:171232862-171232884
Sequence AGGGAGGAGTTGAAGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 793
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 740}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965679181 Original CRISPR AGGGAGGAGTTGAAGGAGTA GGG (reversed) Intronic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900808667 1:4784858-4784880 AGGGAGTGATTGAAGGAGAATGG - Exonic
900932844 1:5747664-5747686 AGGGAGGAGGAGAGGGAGGAAGG + Intergenic
901082549 1:6591739-6591761 AGGGAGCAGAGGAAGGAGAAGGG + Exonic
903788183 1:25875197-25875219 TGGGAGGAGCAGAAGGAGCACGG - Intergenic
903953803 1:27011653-27011675 AGGGAAGAGTTGGAGGAGGGAGG + Intronic
904069729 1:27784899-27784921 AGGGAGGGGTTGAGGAAGTGGGG - Intronic
904183180 1:28681430-28681452 AGGGAGAAGATGAGGGAGAAAGG + Intronic
905311487 1:37052001-37052023 AGGGAGGAGACGAAGGGTTAAGG + Intergenic
905317318 1:37091586-37091608 ATGTAGGAGGTGAAGGAGAAAGG - Intergenic
905514729 1:38554017-38554039 AGGGACTTGTTGAAGGAGTTTGG - Intergenic
905898305 1:41563427-41563449 AGGGAGGAGGGGAAGAAGGAGGG - Intronic
906491743 1:46273917-46273939 AGGGAGTACCTGAAGGACTAGGG - Intronic
906872738 1:49502478-49502500 AGGCAGAAGTTGAAAGAGTTTGG + Intronic
907019605 1:51054027-51054049 TGGGAAGAGTTTAAGGAGAAAGG + Intergenic
909389280 1:75100040-75100062 AGGGAGGAAGGGAAGGAGTAGGG - Intergenic
909897740 1:81094085-81094107 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
910760713 1:90728792-90728814 AGGGAGGAGGAGGAGGAGGAAGG + Intergenic
911315730 1:96354586-96354608 AGGTAGGAGTAGAGGGAGGATGG - Intergenic
912453523 1:109782998-109783020 AAGGAGGAGATGGAGGAGTGCGG + Intergenic
912933471 1:113983574-113983596 AGGGAGGGGTTGAGGGGGAAGGG + Intergenic
913277249 1:117150766-117150788 GTGGAAGAGTTGAAGGAGAAAGG - Intronic
914343559 1:146779661-146779683 AGGGGGCAGTGGAAGGAGCAAGG - Intergenic
914686806 1:149987317-149987339 TGAGAGGAGTTGAAGCAGTGAGG - Intronic
914799648 1:150951184-150951206 AGGGAGGAGGTAAAGGAAGATGG - Intronic
914898238 1:151696019-151696041 AGGAAGGAGTAGTAGGAATATGG + Exonic
915195043 1:154183003-154183025 AGCGAGAAGTTGAGGGAGAAAGG - Intronic
915940980 1:160117945-160117967 AGGGAGGAGTGGAGGGAGGTTGG + Intronic
916045718 1:160998685-160998707 AGGGAGGGCATGAAGGAGGATGG + Exonic
916195216 1:162216092-162216114 AGGGAGGAGATGGGGGAGGAGGG - Intronic
916309427 1:163378691-163378713 AGGGATGAGTTGGAGTAGTCTGG + Intergenic
916410847 1:164545582-164545604 AGCGAAAAGTTGAAGGAGTCAGG - Intergenic
916735939 1:167607128-167607150 AGGCAGAGGTTGGAGGAGTATGG + Intergenic
916941372 1:169682155-169682177 AAGGAGGAGTTTAAGGTGAAGGG - Intronic
918661342 1:187092443-187092465 TGCCAGGAGTAGAAGGAGTAGGG + Intergenic
918753790 1:188309518-188309540 AGAGAAGAGTTAAAGGAGCATGG + Intergenic
918886318 1:190198829-190198851 AGGGAGAAGTTGGAAGAGTTTGG - Intronic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919449341 1:197751886-197751908 AGGGAGGAGGAGGAGGAGGAGGG + Intronic
919681945 1:200444378-200444400 GGGGAGGAGTAGAAAGACTAGGG - Intergenic
919709934 1:200716370-200716392 AGGGATGAGTTAAAAGAGAAAGG + Intergenic
919956297 1:202420286-202420308 GGGGAGGAGAAGAGGGAGTATGG + Intronic
920089548 1:203442511-203442533 AGAGAGGAATAGAAGGAGGAAGG - Intergenic
920679327 1:208060515-208060537 AGGGTGGAGGTGAGGGAGGAGGG + Intronic
921284429 1:213596323-213596345 AGAAAGGAGTTGAAGGAGACAGG - Intergenic
922210016 1:223479323-223479345 AGTGAGGAGGTGAGGGAGTGAGG + Intergenic
922723225 1:227909638-227909660 AGGAAGGAGGGGAGGGAGTAAGG + Intergenic
922982539 1:229839848-229839870 AGGGAGCTGTTGAAGGGGAAGGG + Intergenic
923233377 1:232009685-232009707 AGTGAGGAGTGGAAGGGGAAGGG - Intronic
923649026 1:235854786-235854808 AGAGAGGAGTTGAAGGTCTAAGG - Intronic
923727840 1:236523212-236523234 AGGGAACAGTTTAAGCAGTATGG - Intronic
924762274 1:246999298-246999320 AGGTAGGGGTTGAAGGATCAAGG - Intronic
924795139 1:247287518-247287540 AGGGCGGTGATGAAGGAGAATGG - Intergenic
1062803188 10:395121-395143 AGGGAGGAGTTGGGGGAGGGAGG + Intronic
1062962172 10:1580743-1580765 AGGGAGGAACAGAAGGAGCATGG - Intronic
1063225731 10:4013305-4013327 GGGGAGGGGGAGAAGGAGTAGGG - Intergenic
1063460872 10:6214352-6214374 AGGGAGGGGTTGTGGGTGTACGG - Intronic
1063539576 10:6918686-6918708 AGGGAGGAGTAGAAGGATGGAGG + Intergenic
1064720480 10:18224314-18224336 AGGGAGAAGTTGAAAGAGGGAGG - Intronic
1064834998 10:19516759-19516781 AGGGAGGAGAAGAAGGTGAAGGG - Intronic
1065188249 10:23189613-23189635 AGGGAGGAGGAGGAGGAGGAAGG + Intergenic
1065269975 10:24019038-24019060 GGGCAGGGGTTGAAGGAGCAGGG + Intronic
1065318506 10:24487115-24487137 AGGGAGAAGAAGAAGGAGAAGGG - Intronic
1065497229 10:26341848-26341870 GGGGAGGAGTGGAGGGAGGAAGG + Intergenic
1065905466 10:30247327-30247349 TAGGAGCAGTTGAAGGAGGAGGG - Intergenic
1067166507 10:43869881-43869903 GAGGAGGAGGTGAAGGAGTGGGG + Intergenic
1067740499 10:48891871-48891893 AAGAAAGAGTTGAAGGAGTGCGG + Intronic
1068030770 10:51702163-51702185 AGAGAGTAGCTGAAGGACTATGG + Intronic
1068401753 10:56536740-56536762 AGGGAGGAGTTGAACTAATGTGG + Intergenic
1068819215 10:61353499-61353521 AGGGAGGAGTTAAAGAACCAGGG - Intergenic
1068942286 10:62691776-62691798 AGGGAGAAGTTAAAGGTGTAAGG + Intergenic
1069511498 10:69046049-69046071 AGGTAGGACTTGAAGGATGAGGG + Intergenic
1069893215 10:71664835-71664857 AGGGAGGAGGAGAAGGAAGAGGG - Intronic
1069948049 10:72000909-72000931 AGGGAGGAGGTGATGCAGCATGG + Intronic
1070523769 10:77277170-77277192 AGGGAGGAGAAGAAGGGGTGAGG + Intronic
1070570034 10:77633985-77634007 AGGGAGGAGTTGAGGAATGAGGG - Intronic
1070694692 10:78553097-78553119 AGGGAGGCCTTCAGGGAGTATGG - Intergenic
1070736097 10:78864921-78864943 AGGGATGTGTTGGAGGAGGAGGG - Intergenic
1070768273 10:79068604-79068626 AGGGAGTAGCGGAGGGAGTAGGG + Intergenic
1071734991 10:88288622-88288644 AGGAAGGAGTTTAAGGAAAAAGG + Intronic
1071794429 10:88990340-88990362 GGGGAGGTCTTGAAGGAGAATGG - Intronic
1071955304 10:90751287-90751309 AGAGAGGGAGTGAAGGAGTAAGG + Intronic
1072307510 10:94121703-94121725 AGGGTAGAGTGGAAAGAGTATGG - Intronic
1072496789 10:95969554-95969576 AGGGAGGTGCTTGAGGAGTAGGG + Intronic
1073700022 10:105916216-105916238 AGGGAGGGATTGAAGGAATTAGG - Intergenic
1073761451 10:106632902-106632924 ATGGAGGAGATGAATGAGTGAGG + Intronic
1074253304 10:111775639-111775661 AGGGAGCAGATAAAAGAGTAGGG + Intergenic
1074271056 10:111953799-111953821 AGAGATGAGATGAAGGAGTCTGG - Intergenic
1074382431 10:112991777-112991799 AGGGAGCCTTGGAAGGAGTAGGG + Intronic
1074874032 10:117600641-117600663 AGGGAGGAGGAGAAGGAGAAGGG - Intergenic
1074907611 10:117878885-117878907 AGGGAGGAGCTGACAGAGGAAGG - Intergenic
1074913480 10:117933922-117933944 AGGGAAGGGTTGAGGGAGGAGGG + Intergenic
1075180104 10:120203813-120203835 AGGGAGGAGGGCAAAGAGTAAGG - Intergenic
1075477972 10:122753035-122753057 AAGGAGAATTTGCAGGAGTATGG - Intergenic
1075938391 10:126364814-126364836 AGGGAGGAGTTGAGGGAAGGAGG - Intronic
1076217957 10:128710994-128711016 AGGGAGGGCTTGCAGGAGGAGGG + Intergenic
1077060583 11:616073-616095 AGGGAGGAGTGGAGGGCGTTGGG + Intergenic
1077392572 11:2306913-2306935 AGGGAGGAGGAGATGGAGGAGGG + Intronic
1078423846 11:11233749-11233771 AGAGAGGAGATGAAGGAGGCGGG + Intergenic
1078465252 11:11545549-11545571 AGTGAGGATTTCAAGGAGTGTGG - Intronic
1079048407 11:17130179-17130201 AGGGAGGAAAGGAAGGAGGAAGG - Intronic
1079636555 11:22749189-22749211 AAGGAGAAGGTGAAGGAGAAGGG - Exonic
1079761591 11:24336001-24336023 AGGGAGGGGGTGAGGGAGGAAGG - Intergenic
1081212733 11:40355891-40355913 AGGGAGGAGATGAAGCAAAATGG - Intronic
1081639272 11:44741888-44741910 AGAGAGGAGAGGAAGGAGAAGGG - Intronic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1083213837 11:61206309-61206331 AGGGAAGACTTCAAGGAGGAAGG + Intronic
1083216721 11:61225138-61225160 AGGGAAGACTTCAAGGAGGAAGG + Intronic
1083219603 11:61243964-61243986 AGGGAAGACTTCAAGGAGGAAGG + Intronic
1083431112 11:62613890-62613912 AGGGAGGAGGAGGAGGAGGAAGG - Intronic
1083541357 11:63513743-63513765 AGGGATGAGGTGAAGAAGGAGGG - Intronic
1084265984 11:68005327-68005349 AGGGAGGAGGTGGGAGAGTATGG + Intergenic
1084725674 11:70940202-70940224 AGGGAGGAAGGGAAGGAGGAAGG - Intronic
1084726414 11:70945338-70945360 AGGGAGGAGGTGAAGGCAGAAGG + Intronic
1084834534 11:71793058-71793080 AGAGAGGTGTTGAAAGTGTAGGG - Intronic
1085174427 11:74473834-74473856 AGGAAGGAGTAGAAGAACTAAGG + Intergenic
1085502722 11:77038125-77038147 AGGGAGGAGGGGGAGGAGGAGGG + Intronic
1085596999 11:77820099-77820121 TGGGAGGAGGGGAGGGAGTAAGG + Intronic
1086099014 11:83079611-83079633 AGGGAGCAGTTGAACAAGCATGG + Intergenic
1087795726 11:102453100-102453122 AGGGAGGAGTTGCAGGGCAAAGG + Intronic
1087912254 11:103767742-103767764 AGGGTGAAGGTGAAGGAGTGTGG + Intergenic
1088028532 11:105217275-105217297 AGGGAGGAGTTGAACTGGGAAGG + Intergenic
1088615942 11:111628360-111628382 GGGGAGGAGTGGCAGGAGCATGG - Intronic
1088799604 11:113293499-113293521 GGGGAGGAGTTGGAGGAGGAGGG - Intergenic
1088975531 11:114813031-114813053 AAGGATGAGTTGAGGGAGTGTGG - Intergenic
1088993171 11:114972276-114972298 AGGGAGGACATGAAAGAGGAAGG - Intergenic
1089064280 11:115650593-115650615 AGGGAGGAGTTGCAAGGGGAGGG - Intergenic
1089386630 11:118072593-118072615 AGGGAGGAGAGGAAGGAGGAAGG + Intergenic
1089625644 11:119749132-119749154 ATGGAAGAGGTGAAGGAGAAGGG - Intergenic
1090943944 11:131413084-131413106 AGGGAAGAGTTGAGGCAGGAAGG - Intronic
1091800708 12:3323015-3323037 AAGGAGGAGAGGAAGGAGAAGGG + Intergenic
1091815822 12:3437080-3437102 AGGGTGGGGTTGAAGGGGTAAGG - Intronic
1091862998 12:3803644-3803666 ATGGGTGAGCTGAAGGAGTAAGG + Intronic
1092442514 12:8519379-8519401 AGGGAGGGGTAGAATGAGGAAGG - Intronic
1092910939 12:13144480-13144502 AGGGAGGAGGAGGAGGAGGAAGG + Intergenic
1092944734 12:13442176-13442198 AGGGAGAAGTGGAAAGAGAAGGG - Intergenic
1095879327 12:47115532-47115554 AGGGAGGAGGGCAAGGAGAATGG - Intronic
1096187417 12:49590605-49590627 GGGGAGGGGGTGAAAGAGTAAGG + Intronic
1096815429 12:54198901-54198923 AGGGAGGAGATGAAGGCCCAGGG + Intergenic
1097070446 12:56350716-56350738 AGGTAGGATTGGAAGGAGGAAGG + Intronic
1097630178 12:62051252-62051274 AGGCAGGAGGAGGAGGAGTAAGG - Intronic
1097983307 12:65756316-65756338 AGGGAAGAGAAGAAGGAGGAAGG - Intergenic
1098217509 12:68235887-68235909 AGGCGGGAGGAGAAGGAGTAGGG + Intergenic
1098819027 12:75207252-75207274 TGGGAGAAGTTGAAGCAGCAGGG + Intronic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1100281309 12:93120795-93120817 AGGGAGGAGGGGAAGAAGAAGGG - Intergenic
1100370699 12:93966681-93966703 AGGAAGGAGTGGAAGGATGAAGG - Intergenic
1100370720 12:93966760-93966782 AGGGAGGAGTGGAGGGATGAAGG - Intergenic
1100370739 12:93966835-93966857 AGGGAGGAGTGGAGGGATGAAGG - Intergenic
1100550727 12:95644333-95644355 AGGAAGGAGAAGAAGGAGGAAGG - Intergenic
1100874680 12:98949535-98949557 AGGAAGGGGTTGGAGGAGGAAGG + Intronic
1100996777 12:100309371-100309393 GAGGAGGAGTTGGAGGAATAAGG - Intronic
1101051968 12:100873283-100873305 GGGCAGAAGTTGAAAGAGTATGG + Intronic
1101843226 12:108342356-108342378 GGGGAGGAGAAGAAGGAGTGGGG + Intergenic
1101965596 12:109279900-109279922 TGGGAGGAGATGAAGGATGAGGG - Exonic
1102230355 12:111257588-111257610 AGTGAGGAGGAGAAGGAGGAGGG - Intronic
1102501160 12:113353574-113353596 AGGGAGGAGTGGAGGGAGGGAGG - Intronic
1102876019 12:116449356-116449378 AGATAGGAGTGGAAGCAGTATGG + Intergenic
1103030215 12:117606655-117606677 AGGGAGGAAGGGAAGGAGGAGGG - Intronic
1103340758 12:120220001-120220023 TGGGAGGAGGAGAAGGAGGAAGG + Intronic
1103662074 12:122528236-122528258 AGTGAGGAGATGAAGAAGGAGGG - Intronic
1103946754 12:124531491-124531513 AGGGAGGAGAAGGAGGGGTAGGG + Intronic
1105417984 13:20229777-20229799 GGGGGGGAGTTAAAGGAATATGG - Intronic
1105544856 13:21343963-21343985 AGGGAGGAGATGGAGAAGGAGGG - Intergenic
1105750296 13:23416910-23416932 AGGGAGGAGGGGAAGGAAGAGGG + Intronic
1106048664 13:26169312-26169334 AGGGAGAAGGGCAAGGAGTAGGG + Intronic
1106068482 13:26382087-26382109 AAGGAAGAGCAGAAGGAGTAAGG - Intronic
1106791796 13:33162837-33162859 AGGCAGAAGTTGAAAGAGTGTGG - Intronic
1107801972 13:44116820-44116842 AGGGATGAGTTACAGGTGTATGG - Intergenic
1108655062 13:52523254-52523276 GGAGAGGGGTTGAAAGAGTAGGG + Intergenic
1108800783 13:54092444-54092466 AGTGAGGAGTAGCAGGAGCAGGG + Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1109687328 13:65838467-65838489 AGGGAGGTTTTGAAGAAGTGAGG + Intergenic
1109702832 13:66048771-66048793 AGGCAGGAGTTGCAAGAGTATGG - Intergenic
1110815416 13:79855261-79855283 AGGGAGGAGTTGACTTAGTGTGG - Intergenic
1112488747 13:99843105-99843127 AGTGAGGACTTGAAGCAGGATGG + Intronic
1112490726 13:99861028-99861050 GGGGAGGAGATGAAGTAGCAGGG - Intronic
1113366771 13:109683737-109683759 AAGGAGGAGATGAAGGATTAAGG + Intergenic
1114574860 14:23702992-23703014 AGGGAGGACTTGTAGTAGGAAGG + Intergenic
1115020149 14:28669992-28670014 AGGGAGGAGTGGAGGAAGGAAGG + Intergenic
1116074822 14:40097889-40097911 AGGGAGGAATAAAAGGAGAATGG - Intergenic
1116928904 14:50670305-50670327 AGGCGGGAGCTGAAGGAGGAAGG + Intergenic
1117070142 14:52048818-52048840 CTGGAGGTGTTGAAGGAGTGAGG + Intronic
1117755891 14:58973625-58973647 AGGGAGGTATTGAAGAAGTATGG + Intergenic
1117972037 14:61261296-61261318 AGGGAATAGTTGAAGCAGCATGG + Intronic
1118503112 14:66381905-66381927 ATGGAGGAGATGAAAGGGTATGG + Intergenic
1118632468 14:67718291-67718313 AGGGAAGAGGAGAAGGAGGAAGG + Intronic
1118743217 14:68756181-68756203 AGGGAGGAGTTGTTGTACTAGGG - Intergenic
1118995418 14:70831291-70831313 GAGGAGGAGTGGAAGGAGAAAGG - Intergenic
1119077854 14:71662035-71662057 AGTTAGGAGTTGAAGGAGATAGG + Intronic
1119589620 14:75873406-75873428 AGGGAGTTGTTCAATGAGTACGG - Intronic
1119638892 14:76298980-76299002 AGGGAGGAGTGGCTGAAGTAGGG + Intergenic
1120273161 14:82340114-82340136 AGGGTGGAGTGGTAGGAGGAGGG - Intergenic
1120290612 14:82565520-82565542 AGGGAGGAATTGAATTAGAAAGG - Intergenic
1120699794 14:87686476-87686498 AGGGAGGAGGTGTAAGAGGAGGG - Intergenic
1121263208 14:92581592-92581614 GGGGAGGTGGGGAAGGAGTATGG - Intronic
1121332818 14:93059270-93059292 AGGCAGGGGTGGAGGGAGTATGG + Intronic
1121557703 14:94850848-94850870 AGGAAGGAGTGGAGGGAGGAAGG + Intergenic
1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG + Intergenic
1121802918 14:96790119-96790141 AAGGATGAGCAGAAGGAGTAGGG + Intergenic
1122912857 14:104841920-104841942 AGGGAGGAAGGGAAGGAGGAAGG - Intergenic
1202904417 14_GL000194v1_random:60079-60101 AGAGAGGAGGTGAAGGTGGAAGG - Intergenic
1124153108 15:27199976-27199998 AGAGAGGAGTAGAGGGAGGAAGG - Intronic
1124967530 15:34447479-34447501 AGGGAAGAGATGAGGGAGGAGGG - Intergenic
1125612590 15:40981934-40981956 AGGGAGGAGAAGAATGAGGAAGG - Intronic
1126361068 15:47846588-47846610 GAGGAGGAGAAGAAGGAGTAAGG + Intergenic
1126361073 15:47846609-47846631 GGGGAGAAGAAGAAGGAGTAGGG + Intergenic
1126798846 15:52282287-52282309 AGGGAGGAGTGGGAGGAGACTGG - Intronic
1128117644 15:65120993-65121015 AGGGAGGAGTTGAGAAAGTCAGG - Intronic
1128722089 15:69957564-69957586 AGGGAGGAATTGGAGGAGAGGGG - Intergenic
1128866417 15:71118074-71118096 AAGGAGGAGTTCAAGGAGATGGG + Intronic
1129057985 15:72835720-72835742 AGGGAGGAGATAAGGGAGGAGGG + Intergenic
1129245567 15:74276836-74276858 AGGGAGGACCTGAAGGACAAGGG - Intronic
1129803627 15:78436647-78436669 AGGGAGTGGATGAAGGAGTCAGG + Intergenic
1129913488 15:79247345-79247367 AGGAAGGAATGGAAAGAGTAGGG - Intergenic
1129944280 15:79525494-79525516 AGGAAGGAGATGAAGGAAGAAGG + Intergenic
1130186479 15:81688413-81688435 AGGGTGGAGATGATGGAGAATGG - Intergenic
1130226009 15:82058873-82058895 AGAGAGGAGAGGAAGGAGAAGGG - Intergenic
1130418044 15:83712928-83712950 TAGGAGGAGGTGAAGGAGAAGGG - Intronic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1130959867 15:88652484-88652506 AAGGAGGAGGGGAAGGAGGAGGG - Intronic
1130959872 15:88652496-88652518 AAGGAGGAGGGGAAGGAGGAGGG - Intronic
1130959877 15:88652508-88652530 GGGGAGGAGGGGAAGGAGGAGGG - Intronic
1130981469 15:88814690-88814712 AGAGAAGGGTTGAAGGAGTCGGG - Intronic
1131014192 15:89043665-89043687 AGGGAGGAGGAGAAGGAGGAGGG + Intergenic
1131104923 15:89727075-89727097 TGGGAAGAGTGGAAGAAGTAGGG + Intronic
1131599258 15:93830068-93830090 AGAGAGGAGAGAAAGGAGTAGGG - Intergenic
1132119911 15:99167766-99167788 AGGCAGGAGTTGGAACAGTAAGG + Intronic
1132191180 15:99862439-99862461 AGGGAAGAGATGAGGGAGGAGGG + Intergenic
1132698413 16:1212122-1212144 AGAGAGGAGGCGCAGGAGTAAGG + Exonic
1132719406 16:1308654-1308676 AGGGAGGGAATGACGGAGTAGGG + Intergenic
1132989936 16:2787274-2787296 AGGGAGGGGGTGAAGGATGAGGG - Intronic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1133978132 16:10614923-10614945 AGGGAGGGATGGAAGGAGGAAGG - Intergenic
1134254987 16:12603242-12603264 AGGAGGGAGTTGAAGGGGAATGG + Intergenic
1134710889 16:16326517-16326539 AGGGAGGGGAGGAAGGAGGAGGG - Intergenic
1135645343 16:24156801-24156823 AGGGAGAAGGTAAGGGAGTAGGG - Intronic
1136716394 16:32286878-32286900 ATGGAGGAGATGGAGGAGAAGGG - Intergenic
1136834780 16:33493156-33493178 ATGGAGGAGATGGAGGAGAAGGG - Intergenic
1137386481 16:48047418-48047440 AGGGAGGGAATGGAGGAGTAGGG + Intergenic
1137557056 16:49477296-49477318 GGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557066 16:49477317-49477339 GGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557081 16:49477347-49477369 GGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137557091 16:49477368-49477390 GGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1137975941 16:53032321-53032343 TGGGAGGTGGGGAAGGAGTAGGG - Intergenic
1138360257 16:56422429-56422451 GGGGAGGAGGTGAAGGAGGTGGG - Intronic
1138457608 16:57130456-57130478 AGGGAGGAAGTGAAGGAGGGAGG + Intronic
1138545365 16:57716010-57716032 AGCGAGGGGTTGGAGGAGGATGG + Intronic
1138572364 16:57884162-57884184 AGGGAGGAGAAGGCGGAGTAAGG - Exonic
1139136673 16:64212938-64212960 AGGGGGGAGTTGATGGTGGATGG - Intergenic
1139511197 16:67429646-67429668 AGGCAGGACTTGAATGAGGAGGG - Intergenic
1139640874 16:68290608-68290630 AGGGAGGAGGAGAAGGATGAGGG - Intronic
1139946330 16:70644909-70644931 AGGGAGGAGAAGGAGGAGGAAGG + Intronic
1139990432 16:70935673-70935695 AGGGGGCAGTGGAAGGAGCAAGG + Intronic
1140270149 16:73458313-73458335 AGGGAGGAAGTGAGGGAGGAAGG - Intergenic
1140541492 16:75760312-75760334 AGGGAGGGATGGAAGGAGGAAGG - Intronic
1140566596 16:76049544-76049566 AGGGATGAGTTGAATAGGTAAGG - Intergenic
1140818534 16:78642277-78642299 AGGGAGGAGGTGGAGGATAAAGG + Intronic
1141056851 16:80824811-80824833 AGGGAGGAAGAGAAGGAGGAAGG + Intergenic
1141410784 16:83831573-83831595 AGGGAGGAGTGGAGAGAGGAGGG - Intergenic
1141634441 16:85306492-85306514 GGGTAGGAGTTGCAGGAGAAAGG + Intergenic
1141775666 16:86121449-86121471 AGGGAGGAGGAGAAGGAGGGAGG - Intergenic
1141942502 16:87286927-87286949 TGGGAGGAGGGGAAGGAGAAGGG + Intronic
1141957554 16:87383139-87383161 AGGGAGGGGTTGAGGGCGTCAGG - Intronic
1142254331 16:89006718-89006740 GGGGAGGAGATGGAGGAGGAGGG - Intergenic
1142254356 16:89006779-89006801 GGGGAGGAGATGGAGGAGGAGGG - Intergenic
1142305677 16:89283603-89283625 CGGGAGGAGCTGAAGGAGTGTGG - Exonic
1203010023 16_KI270728v1_random:230876-230898 ATGGAGGAGATGGAGGAGAAGGG + Intergenic
1203144950 16_KI270728v1_random:1793444-1793466 ATGGAGGAGATGGAGGAGAAGGG - Intergenic
1143070001 17:4283750-4283772 AGAGAGGAGTTGGAGGAGAGAGG + Intronic
1143111272 17:4554354-4554376 TGGGAGAAGTTGAAGGGGGAAGG - Intronic
1143136010 17:4712617-4712639 AGAGTGGATTGGAAGGAGTAAGG + Intronic
1143743894 17:8975618-8975640 GGGGAGGAGCTGAAGGAGATAGG + Intergenic
1144068107 17:11642115-11642137 AGGCAGGGGTTGAAGCAGGAAGG + Intronic
1144719900 17:17462049-17462071 AGGGAGGTGGTGCAGGAGAAAGG - Intergenic
1145818885 17:27816065-27816087 GGGGATGAGTGGAAGAAGTAGGG + Intronic
1145890077 17:28407994-28408016 AGGGAGGAGTTGGAAGGGGAGGG - Intergenic
1146297194 17:31659270-31659292 AGGGAGGAGGAGAGGGAGAAAGG + Intergenic
1146534314 17:33637010-33637032 GGGGAGGAGAAGAAGGAGGAAGG - Intronic
1146630301 17:34464769-34464791 TGGGAGGAGTAGCAGGAGAAGGG - Intergenic
1146944546 17:36864754-36864776 AGGGAGGAGGGGAGGGAGGAAGG - Intergenic
1147191637 17:38741423-38741445 GTGGAGGGGTTGAGGGAGTAAGG - Intronic
1147304156 17:39551809-39551831 AGGGAAGAAATGAAGGAGAAAGG + Intronic
1147331082 17:39699999-39700021 AAGGAGGAGGTGGAGGAGGAGGG + Intronic
1147371440 17:39995585-39995607 AGGCAGGAGTGGGAGGAGTTTGG + Intronic
1147674397 17:42194537-42194559 AGGGAGGAGCTGAAGGAGGGGGG + Intergenic
1147768064 17:42850049-42850071 AAGGAGGAGCTGGAGGACTATGG - Intronic
1147951203 17:44109025-44109047 AGGGAGGAGATGAGAGAGCAGGG + Intronic
1148141731 17:45333851-45333873 AGGGAGGAGAAGAAGGAATCAGG + Intergenic
1148221828 17:45868399-45868421 AGGTAGGAGATGAAGTAATAGGG - Intergenic
1148365838 17:47055081-47055103 AGGGAGGTGCTGGAGGGGTAGGG + Intergenic
1148641382 17:49190310-49190332 AGGGAGAAGTGGAAGTAGGAAGG + Intergenic
1148735871 17:49864578-49864600 GGGGCAGAGTTCAAGGAGTAGGG + Intergenic
1148950100 17:51303285-51303307 AGGGGGGTGTTGGGGGAGTATGG - Intergenic
1149304608 17:55335740-55335762 AGGGAGGGAGTGGAGGAGTAAGG - Intergenic
1149696456 17:58620181-58620203 AGGCAGGAGATGAAGGGGGAGGG + Intronic
1149775729 17:59355566-59355588 AGGAGGGAGGTGAAGGAGAACGG - Intronic
1149867891 17:60160896-60160918 AGGGAGGAGTAGAGGGAGGGAGG + Intronic
1150007642 17:61479592-61479614 AGGGTGGAGAGCAAGGAGTAGGG + Intronic
1150572831 17:66402745-66402767 AGGGAGAAGTTGAAGATTTAGGG + Intronic
1150592775 17:66578042-66578064 GAGGAGGAGTTGCAGGAGAAAGG - Intronic
1151117269 17:71751617-71751639 AGGAAGGAGTTGAAGGGAGAAGG - Intergenic
1151354265 17:73549208-73549230 AGGGAGGAGTAGAAGGAGAGAGG + Intronic
1151408236 17:73903108-73903130 AGGGAGGAGTGGAAGGGGGCGGG + Intergenic
1151784441 17:76268500-76268522 AGGGAGTAGTGGAGGGAGGAGGG + Intronic
1152043074 17:77917555-77917577 AGGAAGGAGAGGAAGGAGAAGGG + Intergenic
1152266282 17:79296846-79296868 AGGGAGGAGAAGCAGGAGGAGGG - Intronic
1152287717 17:79422336-79422358 AGGGAGGGGTTGAATGTGTGGGG - Intronic
1152435388 17:80273297-80273319 GGGCAGGAGCTGAAGGAGGAAGG + Exonic
1152473727 17:80504141-80504163 AGGGAGGAGTGGATGGATGATGG + Intergenic
1152635989 17:81430743-81430765 AAGGAGGAGCTGAAGGGGTCTGG - Intronic
1153051219 18:905045-905067 CGGGAGGAGTTGAAGGGTAAGGG + Intronic
1153385101 18:4484246-4484268 AGAGAGGAGTTCCCGGAGTATGG + Intergenic
1153463276 18:5361180-5361202 AGGGAGAAGAAGCAGGAGTATGG + Intergenic
1153720524 18:7896830-7896852 AAAGAGGAGTTGAGGGAATAGGG + Intronic
1155308449 18:24501377-24501399 AGGGAAGAGATAAAGGAGAAAGG + Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156411716 18:36835160-36835182 AGGAAGGAGTTGATGGGGGAGGG + Intronic
1156541761 18:37918991-37919013 AGGCAGGGGTAGAGGGAGTAGGG + Intergenic
1156560542 18:38120591-38120613 ATGGAGGAGTGGAAGCAATATGG - Intergenic
1156736845 18:40270336-40270358 AGGGAGGAATGGAAGGATGAAGG + Intergenic
1157284978 18:46371486-46371508 AGGGAGAAGTTAAAGGAGATTGG + Intronic
1157470287 18:47983173-47983195 GGGGAGGAGAAGAAGGAGGAAGG - Intergenic
1158813447 18:61065516-61065538 TGGGAGGATTTGCAGGAATAAGG + Intergenic
1158840744 18:61383872-61383894 AGGGAGAAGCTGAAGTAGTAGGG + Intronic
1159870488 18:73755568-73755590 GGAGAGGAGATGAAGGAGGAAGG - Intergenic
1160373021 18:78390343-78390365 AGGGAGGAGGGGAAGGAGCGGGG + Intergenic
1161415663 19:4145236-4145258 GGGGAGGAGTGGGAGGAGGAGGG + Intergenic
1161957941 19:7506664-7506686 AGGGAGGAGCTGGAGGAGGACGG - Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162359572 19:10210440-10210462 TGGGAAGAGTTGAGGGAGGAAGG - Intronic
1163102849 19:15108238-15108260 AGGAAGGAGTTAAAGGAGGAAGG + Intronic
1163207267 19:15812727-15812749 AGGGAGGAATGGAGGGAGGAAGG + Intergenic
1163779607 19:19239564-19239586 AGGGAGGAGGGGAGGGAGGATGG - Intronic
1164551924 19:29219182-29219204 GGGCATAAGTTGAAGGAGTATGG + Intergenic
1164680384 19:30130699-30130721 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680487 19:30131008-30131030 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680513 19:30131081-30131103 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164680539 19:30131154-30131176 AGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1164733087 19:30520492-30520514 GGGGAGTAGGTGAAGGAGTTGGG - Intronic
1164771934 19:30816223-30816245 AGGGAGGAAAAGAAGGAGGAAGG - Intergenic
1165073705 19:33269528-33269550 AGTGAGGAGTCCCAGGAGTAAGG - Intergenic
1165079304 19:33298523-33298545 AGAGAGGAGGGGAAGGAGTGAGG + Intergenic
1165112559 19:33510902-33510924 AGGGAAGAGCTGCAGGAGGAAGG - Intronic
1165573007 19:36791435-36791457 AGGGGGGAGTTGGGGGAGCAGGG - Intergenic
1165632331 19:37312453-37312475 AGGGGGGAGTTGGGGGAGCAGGG - Intergenic
1165741992 19:38210233-38210255 CGGGAGGAGGAGAAGGAGGACGG - Intergenic
1165940107 19:39410586-39410608 AGAGAAGAGGAGAAGGAGTAAGG - Intergenic
1166242950 19:41506246-41506268 AGCGAGAAGTTGAGGGAGAAAGG + Intergenic
1166676888 19:44746373-44746395 AGGGAGGAGGTGAAGGTCTGAGG - Intergenic
1166686730 19:44800779-44800801 AGGGAGGAGGGGCTGGAGTATGG - Intergenic
1166686751 19:44800851-44800873 AGGGAGGAGGGGCTGGAGTATGG - Intergenic
1166686762 19:44800887-44800909 AGGGAGGAGGGGCTGGAGTATGG - Intergenic
1166686782 19:44800959-44800981 AGGGAGGAGGGGCTGGAGTATGG - Intergenic
1166686845 19:44801175-44801197 AGGGAGGAGGGGCTGGAGTATGG - Intergenic
1166686889 19:44801319-44801341 AGGGAGGAGGGGCTGGAGTATGG - Intergenic
1166686942 19:44801499-44801521 AGGGAGGAGGGGCTGGAGTATGG - Intergenic
1166687004 19:44801715-44801737 AGGGAGGAGGGGCTGGAGTATGG - Intergenic
1166929896 19:46296384-46296406 AGGGTGGAGTAGAGGGGGTAGGG + Intergenic
1167195174 19:48023394-48023416 AGGGAGGAAGTGAGGGAGGAGGG + Intronic
1167290502 19:48622487-48622509 AGGGAGGAGGAAAAGGAGAAAGG - Intronic
1167295552 19:48646884-48646906 GGGGAGGAGGTGAAGGAGGAGGG + Intergenic
1167396567 19:49233261-49233283 AGGGAGACGCTGAAGGAGAAGGG - Intergenic
1167409487 19:49336663-49336685 GAGGAGGAGCTGAAGGAGGAAGG + Intronic
1167622036 19:50566072-50566094 AGGGAGGAGGAGGAGGAGGAAGG + Intronic
1167779928 19:51592688-51592710 GGGGAGGAGGAGAAGGAGAAGGG + Intergenic
1167798735 19:51726963-51726985 AGGGAGGAGGAGATGGAGTCTGG - Intergenic
1168261854 19:55199701-55199723 AGGGAGGAGGGGAGGGAGAAAGG + Intronic
1168646447 19:58062004-58062026 AGGGAGGTGTTGAAGAAGGAGGG - Intronic
925034238 2:673732-673754 AGGGAGGAGGAGGAGGAGGAGGG + Intronic
925034257 2:673775-673797 AGGAAGGAGGGGAAGGAGGAGGG + Intronic
925071965 2:976824-976846 TGGCAGGAGTGGAAGCAGTAAGG - Intronic
925443333 2:3907122-3907144 AGGGAGGAATGGAAGCAGAAGGG - Intergenic
925837623 2:7961159-7961181 AGGGAGAAGTTGGAGAAGTTAGG - Intergenic
925903869 2:8527592-8527614 CGAGAGGAGGTGAAGGAGGAAGG - Intergenic
925955958 2:8964154-8964176 TGGGAGGGGTGGAAGGAATAGGG - Intronic
926394847 2:12430403-12430425 AGGAAGGAGAAGAAGGAGGAAGG + Intergenic
926480518 2:13387354-13387376 AGGGGGCAGTTGACTGAGTAAGG - Intergenic
926701994 2:15810038-15810060 AGGCAGGAGGTGAAGGAGAGAGG - Intergenic
927491725 2:23525581-23525603 GGGGAGGAGATGCAGGAGCAAGG + Intronic
927521880 2:23703897-23703919 ACGGAGGAGTGGGAGGAGGAGGG + Intronic
927766180 2:25810540-25810562 AGCGAGAAGCTGAAGGAGAAAGG - Intronic
928022589 2:27715947-27715969 AGGGGGGAGGTGAGGGAGTGTGG - Intergenic
928504327 2:31934200-31934222 AAGGAGCAGTTTAAGGTGTAAGG - Intronic
929045472 2:37784867-37784889 AGAGATGAGGTGAAGGAGTCAGG - Intergenic
929362142 2:41104499-41104521 AGAAAGGAGTGGAAGGAGAAAGG + Intergenic
929593196 2:43160067-43160089 AGGGAGGAGAAAAAGGAGGAGGG - Intergenic
929794079 2:45045435-45045457 AGGGAGGAGAGGAAGAAGGAAGG - Intergenic
929794171 2:45046330-45046352 AGGGAGAAGTTTCAGGAGGAGGG + Intergenic
930231281 2:48846344-48846366 GGTGGGGAGTTGAAGGAGTGGGG + Intergenic
930539999 2:52693480-52693502 AGGGAGGAGGGAAAGGAGGAAGG + Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931426469 2:62176442-62176464 AGAGTGGAGTGGAAGCAGTAGGG - Intergenic
931686359 2:64797283-64797305 AGGGAGGTGTTTAAGGAGAATGG + Intergenic
931899211 2:66769378-66769400 AGGGAGGAGGTGAACAAGGAAGG - Intergenic
932753649 2:74389533-74389555 AGGGAGGAGTCAAAGTAGTTGGG - Intronic
933355034 2:81199291-81199313 CGCGAGGAGCTGAAGGAGTGAGG - Intergenic
934532950 2:95106961-95106983 AGGGAGGACTTGACGGAATTGGG - Intronic
934909129 2:98234610-98234632 AGGGAAGAGTTAAAGGAATTGGG - Intronic
935521415 2:104109753-104109775 AGGAAGGAGTTAAAGCAGTTAGG + Intergenic
935735294 2:106101956-106101978 ATGGAGGAGGAGAAGGAGAAGGG - Intronic
936330915 2:111547395-111547417 AGCCAGGGGTTGAAGGAGAAAGG - Intergenic
936379399 2:111970725-111970747 AGGGAGGAGTAGGGGGAGGAAGG - Intronic
936379409 2:111970751-111970773 AGGGAGGAGGAGGAGGAGAAGGG - Intronic
936768091 2:115877985-115878007 AGGGAGAAGGAGAAGGAGAAAGG - Intergenic
937609739 2:123846414-123846436 AGGGATGACTAGAAGGAGGATGG + Intergenic
938188872 2:129256387-129256409 TGTGAGAAGGTGAAGGAGTAAGG - Intergenic
938380189 2:130832135-130832157 AGGGAGGAGGTGGGGGAGGAGGG - Intergenic
939251997 2:139693366-139693388 AGGGAAGATCTGAAAGAGTATGG - Intergenic
940195428 2:151089147-151089169 AGGGAAGAGATGAGGGAGTAGGG - Intergenic
941038253 2:160590654-160590676 AGGGAGGAGGGGAAGGGGGAGGG - Intergenic
941038269 2:160590686-160590708 AGGGAGGAGGGGAAGGGGAAGGG - Intergenic
941038278 2:160590705-160590727 AGGGAGGAGGGGAAGGGGAAGGG - Intergenic
941204862 2:162559104-162559126 ATGGTGCAGTTGAAAGAGTATGG + Intronic
941474881 2:165938737-165938759 AGGGAAGAGGGGAAGGAGAAAGG + Intronic
941637499 2:167950868-167950890 AGCAAGGAGCTGAAGGAGCATGG - Intergenic
941756319 2:169190435-169190457 AAGGAGGAGGTGAAGGAGCAGGG - Intronic
942224645 2:173804647-173804669 AGGGAGGAGATTAAGGACTCAGG - Intergenic
942297199 2:174529080-174529102 AGAGAGGAGAGGAAGGAGAAAGG + Intergenic
943147630 2:184065605-184065627 AGGCAGGAGGTGCAGGAGTCAGG + Intergenic
944016925 2:195051726-195051748 AGAGAGGAGCTGAAAGAGTAGGG - Intergenic
946162996 2:217847471-217847493 AGGAAGGGGTAGAAGGAGTCAGG + Intronic
946179867 2:217942785-217942807 GGGGAGGAGATGGAGGAGGAGGG - Intronic
946480238 2:220048828-220048850 AGAGAGGAGTAGAAGGACTATGG + Intergenic
946954270 2:224911626-224911648 AGGCAGGAGCTGAAGGAGGCTGG + Intronic
947077746 2:226363986-226364008 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077751 2:226363998-226364020 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947077793 2:226364105-226364127 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077799 2:226364117-226364139 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077804 2:226364129-226364151 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947077824 2:226364177-226364199 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947077841 2:226364213-226364235 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077847 2:226364225-226364247 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077853 2:226364237-226364259 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077859 2:226364249-226364271 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077865 2:226364261-226364283 AGGGAGGAGGGGAGGGAGGAGGG + Intergenic
947077870 2:226364273-226364295 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947077884 2:226364309-226364331 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
947119267 2:226799263-226799285 TGGGAGGAGGCGAAGGAGGAGGG - Exonic
947394327 2:229672388-229672410 AGAGAGGAGGTGAAGGAGGGAGG + Intronic
947447687 2:230176981-230177003 AGGGAGAAATGGAAGGAGAAAGG - Intronic
947488471 2:230573795-230573817 AGCGAGAAGTTGAGGGAGAAAGG - Intergenic
947837735 2:233187812-233187834 AGGGAGGAGGAGCAGGAGGACGG - Intronic
948283250 2:236764854-236764876 AGGGAAAAGGTGCAGGAGTAAGG - Intergenic
948382883 2:237563412-237563434 AGAGAGGACTGGAAGGAGTCCGG + Intergenic
948538992 2:238672320-238672342 AAGGAGGAGAAGAAGGAGAAGGG - Intergenic
948766074 2:240219780-240219802 AGCGAGGAGTTCAGGGAGGATGG - Intergenic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1168826749 20:819303-819325 AGGGAGGAGTAGGAGGAGAGAGG - Intergenic
1169125933 20:3126616-3126638 AGGGAGGGAGTGAAGGAGGAAGG + Intronic
1169178631 20:3542573-3542595 AGGGAGAAGGGGAAGGAGAAAGG - Intronic
1171209047 20:23302904-23302926 ATGGAGAGGTTGAAGGAGAAGGG + Intergenic
1172596265 20:36153271-36153293 AGGGAGGAGTTGGGGGAGGGAGG + Intronic
1174195445 20:48769573-48769595 TGGGAGGAGATGAGGGAGAAGGG - Intronic
1174927469 20:54776298-54776320 AGGAATCAGATGAAGGAGTAGGG - Intergenic
1176520195 21:7818475-7818497 AGGGAGGAGTGGAAGGCGGAAGG + Exonic
1176864835 21:14041612-14041634 GGAGAGGAGTAGAAGTAGTAGGG + Intergenic
1177513764 21:22121993-22122015 GGGGAGGACCTGAAGGAGCAGGG - Intergenic
1178163326 21:29943862-29943884 CGGGAGTAGGTGAAGAAGTAAGG - Intergenic
1178654221 21:34448487-34448509 AGGGAGGAGTGGAAGGCGGAAGG + Intergenic
1179270025 21:39843689-39843711 AGGGAGGAGGAGAAGGAGAGAGG + Intergenic
1179388931 21:40969846-40969868 AGGGAGGAATGGAAGGAGAGAGG + Intergenic
1179603374 21:42496149-42496171 TCGGAGGAGTTGGAGGAGGAGGG - Exonic
1181138290 22:20785011-20785033 AGGGAGGAATGGAAGGAGGCAGG - Intronic
1182004039 22:26944249-26944271 GGGGAGGACTTGATGGAGTATGG - Intergenic
1182776684 22:32836681-32836703 AGGGAGGTGCTGAGTGAGTAGGG + Intronic
1182931386 22:34177480-34177502 AGGGAGAGGTGGAAGGAGGAGGG - Intergenic
1183375861 22:37464664-37464686 AGGGAGGAATGGAATGAGAATGG - Intergenic
1183613053 22:38923682-38923704 AGGGAGGAGAGGAAGGAGGAAGG - Intergenic
1183796296 22:40121206-40121228 AGGGAGGAGGGAAAGGAGGAAGG - Intronic
1184304175 22:43584211-43584233 AGGGAGGAGGAGAAGAAGTGAGG + Intronic
1184449799 22:44576096-44576118 AGGGAGGAGGTAGAGGAGGAGGG + Intergenic
1184706997 22:46221409-46221431 AGGGAGTAGTTTTAGGAGAAAGG - Intronic
1184986294 22:48137869-48137891 AGGGAGGAGCTGCAGGGGTGTGG - Intergenic
1185091601 22:48778670-48778692 AGGGAGGAGTGGCAGGAGGTAGG + Intronic
949108639 3:231292-231314 AGAGAGGAGAGGAAGGAGGAAGG - Intronic
949667620 3:6358654-6358676 AGGTAGGAGGTGGAGGAGAAAGG - Intergenic
949700271 3:6748673-6748695 AAGGAGGAGGAGAAGGAGAAGGG - Intergenic
950230915 3:11275080-11275102 TGGGAGGAGTTGAGAGATTAAGG + Intronic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950523335 3:13509164-13509186 AGGGAGGGCTTGAAGGAGCCTGG + Intergenic
950704902 3:14773530-14773552 AGGGAGGAGGGGAACAAGTAAGG + Intergenic
951587907 3:24234085-24234107 AAGGAGAATTTGAAGGAGTGAGG - Intronic
951690242 3:25387442-25387464 GGGGAGGAGTTGAAGCAAAAAGG + Intronic
952218603 3:31302129-31302151 AGGGAGAAGGTGAAGGAGAGAGG - Intergenic
952871832 3:37907533-37907555 GTGGAGGAGGTGAAGGAGAAAGG + Intronic
953440435 3:42911369-42911391 GGGGAGTAGTGGAAGGGGTATGG + Intronic
953536219 3:43778818-43778840 AGAGAGGGTTTGAAGAAGTAAGG + Intergenic
953592211 3:44269348-44269370 AGGGAGGAGAAGGAGGAGGAGGG - Intronic
954390225 3:50264785-50264807 AGGGAGGAGTGGGAGGAGAGGGG - Intergenic
954842533 3:53524571-53524593 AGGGATGAGATGATGGAGCAGGG + Intronic
954932353 3:54295259-54295281 AGGTAGGAGATGAGGGAGTGTGG + Intronic
955086588 3:55708761-55708783 ATGGAGGAGTGGAAGAAGAAAGG + Intronic
955406631 3:58629850-58629872 AGAGAGGAGGAGAAGGAGGATGG + Intergenic
955526413 3:59824850-59824872 AGGGATGGGTGGAAGGATTAAGG - Intronic
955545386 3:60023092-60023114 AGTTAAGACTTGAAGGAGTATGG + Intronic
956188396 3:66584205-66584227 AGGGAGAATTTGAAAGAGTGAGG + Intergenic
956440926 3:69279752-69279774 GGGGAGGAGGAGAAGGAGGAGGG - Intronic
956627839 3:71283952-71283974 AGGCAGGGTTTGAAGGAGTGGGG - Intronic
956871855 3:73426067-73426089 AGGGAGTATTTGTAGGAGCAGGG + Intronic
957131377 3:76226415-76226437 AGGGTGGTGATGAAGGAATAAGG + Intronic
957562417 3:81839657-81839679 ATGGGGGAGGGGAAGGAGTAGGG + Intergenic
957849188 3:85783430-85783452 TGGGAGGAGATGAAGGAAAAAGG + Intronic
958750853 3:98192214-98192236 AAGGAGGAATTGAGGGTGTAAGG - Intronic
959258130 3:104040720-104040742 AATGAGAAATTGAAGGAGTAAGG - Intergenic
959322149 3:104890397-104890419 AGGGAGGATTTGAAGGAGCCAGG + Intergenic
960018804 3:112925446-112925468 AGGGAGGAATAGAAAGAGCAAGG + Intronic
960320982 3:116235462-116235484 AGGGAGAAATGGAAGGAGAAAGG + Intronic
960734756 3:120766573-120766595 AAGGAGAAGATGAAGGGGTAAGG - Intronic
961225822 3:125244891-125244913 TTGGAGAGGTTGAAGGAGTATGG - Intronic
961340128 3:126212297-126212319 AGGGAGGAAGGGAAGGAGGAAGG + Intergenic
961836749 3:129667894-129667916 ATAGAGGAGTTGACGGGGTATGG + Intronic
961911119 3:130317621-130317643 AAGGAGGAGTAGAAGAATTAGGG - Intergenic
962072167 3:132044611-132044633 AGGGAGGGGATGAAGGGGGAGGG + Intronic
962319167 3:134376766-134376788 AGAGAGGAGGTAAAGGAGAATGG - Intergenic
963626159 3:147676700-147676722 GGGGAGGGGTTGAAGGTGTGGGG - Intergenic
964007157 3:151845587-151845609 AGTGGGGATTTGAAGGAATATGG + Intergenic
964486052 3:157186260-157186282 AGGGATGAGTTGAATGGGCAAGG + Intergenic
965679181 3:171232862-171232884 AGGGAGGAGTTGAAGGAGTAGGG - Intronic
965796301 3:172442986-172443008 AGGGAGTAGTTAATGTAGTAGGG - Intergenic
965856531 3:173095196-173095218 TTGTAGGAATTGAAGGAGTATGG + Intronic
966627426 3:182033419-182033441 GGGGAAGATTTGAAGTAGTATGG - Intergenic
966683790 3:182671703-182671725 GGGGAGGGGTAGAAGGAGCAGGG + Intergenic
967031285 3:185609747-185609769 CAGGAGGAGGTGAAGGAGAAAGG - Intronic
967332820 3:188308966-188308988 AGGGAGGAGGAGAAGGAGAAAGG - Intronic
967826993 3:193884924-193884946 CGGGTGGAGGAGAAGGAGTAGGG + Intergenic
968493055 4:900830-900852 AGGGAGGAAAGGAAGGAGAAGGG + Intronic
969166124 4:5315628-5315650 AGGAAGGAATAGATGGAGTAAGG + Intronic
969233889 4:5851694-5851716 AGGGAGGAGAAGGAGGAGGAAGG + Intronic
969239799 4:5890677-5890699 AGGGAGAAGAGGAAGGAGTAGGG + Intronic
969256963 4:6008758-6008780 AGGGAGCTGTTGAAGGTGCAGGG - Intergenic
969838137 4:9860165-9860187 AGGGAGGAGAAGGAGGAGGAAGG - Intronic
970981578 4:22105049-22105071 ATGGAGGACTTGCAGCAGTAAGG + Intergenic
971574540 4:28256593-28256615 AGGGAGGAGGAGGAGGAGGAGGG - Intergenic
972125437 4:35759190-35759212 AGGGAGGAGGTGAAGCAAGATGG - Intergenic
972163486 4:36254178-36254200 AAAGAGGAGATGAAGGAGAAGGG - Intergenic
972169217 4:36324284-36324306 AGCCAAGAGTTGAAGGAGGAAGG - Intronic
972375585 4:38466599-38466621 AGGGTGGAGTTGGAGAAGGAGGG - Intergenic
972599841 4:40562438-40562460 AGGGAGAAGTGGGAGGAGAAGGG - Intronic
972903208 4:43711088-43711110 AGGGAGGAAGAGAAGGAGTCAGG - Intergenic
973603336 4:52562865-52562887 AAGGAGTAATTGATGGAGTAGGG - Intergenic
973739080 4:53901877-53901899 AGGGAGGGGTTGAGGGAGGGAGG + Intronic
975294576 4:72718144-72718166 CTGGGGGAGTTGAAGGAGAATGG + Intergenic
975319537 4:72994742-72994764 AGGGAGGAAGAGAAGGAGGAGGG - Intergenic
975393554 4:73848662-73848684 GGGAAGGAGGTGAAGGTGTAGGG - Intronic
975523325 4:75323501-75323523 CGGGAGGAGTAGAAGAAGTTGGG + Intergenic
975986443 4:80204968-80204990 AGGGAAGAGTAGAAAGAGGAGGG - Intergenic
976090926 4:81456744-81456766 CGTGAGGAGTTGAAGGATTTTGG + Exonic
976542605 4:86295365-86295387 GGGAAGGAGGTTAAGGAGTAGGG - Intronic
976786102 4:88823339-88823361 ATTGAGGAGCAGAAGGAGTAGGG - Intronic
977323716 4:95549283-95549305 TGGGGGGAGTTGGAGGAGGAGGG + Intergenic
979346194 4:119590337-119590359 AGGGAGTAGTTTGAGGAGTATGG - Intronic
979708594 4:123750470-123750492 AGTGAGGAGTTGAAGGTCTGAGG + Intergenic
979844346 4:125489877-125489899 TGGGAGAAGAAGAAGGAGTAAGG - Intronic
980259560 4:130430881-130430903 AGGGAGAAGTTGAAGCATCATGG + Intergenic
980598442 4:134987488-134987510 AGGGAGGAGTTGGAAGAGTTTGG + Intergenic
980981146 4:139655516-139655538 AGGGTGGACTGGAAGGAGAAAGG - Intergenic
981043286 4:140242893-140242915 AGGAAGGAGTGGAGGGAGGAAGG + Intergenic
981086549 4:140689668-140689690 AGGGAGGGGAGGAAGGAGAAAGG - Intronic
981616086 4:146646469-146646491 AGGGAGGAAGAGAAGGAGGAAGG - Intergenic
981864906 4:149405941-149405963 AGGAAGGGGTTTAAGGAGAAAGG - Intergenic
982233835 4:153233639-153233661 AGGAAAGGGTTGAAGGAGTGAGG + Intronic
982560307 4:156921478-156921500 AAGGAGGAGGAGAAGGAGAAAGG + Intronic
982946443 4:161630104-161630126 GGGGAGGGGAAGAAGGAGTAAGG - Intronic
983575430 4:169256292-169256314 AGGGAGGAAGGGAAGGAGGAAGG + Intronic
983928932 4:173432393-173432415 AGGGAGGAGAAGGAGGAGTAAGG - Intergenic
984070387 4:175103526-175103548 AGGGAGGAGTGGGAGGGGGAGGG + Intergenic
984126193 4:175814027-175814049 AGGGATGAGTTGAAGCAGAGAGG - Intronic
984822052 4:183890547-183890569 AGGGAGGAATGGAGGGAGGAAGG + Intronic
985262424 4:188127480-188127502 AGGGAGGAAGAGAAGGATTAAGG + Intergenic
985487314 5:158721-158743 AGGAAGGAGTAGAACGAGGAAGG - Intronic
985511890 5:318054-318076 AGGGGGGAGGTGAAGGATTGGGG - Intronic
985511989 5:318304-318326 AGGGGGGAGGTGAAGGATTGGGG - Intronic
985895929 5:2750160-2750182 AGGGAGGGGAAGAGGGAGTAGGG - Intronic
986342745 5:6805168-6805190 AGGGAGCAGTTGAAGGAATGGGG + Intergenic
986577351 5:9226103-9226125 AGGGAGGAGTTGGATGATAAGGG - Intronic
988801198 5:34698154-34698176 AGGGAGGAGGGGAGGGAGGAAGG - Intronic
989265731 5:39471423-39471445 AGAGAAGATTTGAAGGAATAGGG - Intergenic
989717238 5:44478676-44478698 AAGGAGCAGTTGAAGGAGTAAGG + Intergenic
989795935 5:45472513-45472535 AGGGAGGAAGGGAAGGAGGAAGG + Intronic
990184216 5:53195736-53195758 AGGGAAGAGTAGAAGCAGGAAGG + Intergenic
990210490 5:53478636-53478658 AGAGAAGAGGGGAAGGAGTAGGG + Intergenic
990681074 5:58245020-58245042 GGGGAGGAGCTGACTGAGTAGGG + Intergenic
990762308 5:59143145-59143167 AGGGAGGAAGGGAAGGAGGAAGG - Intronic
991062827 5:62396607-62396629 AGGAAGGAGTAGAAGTATTATGG + Intronic
991433595 5:66573397-66573419 AGGGAGGAGAGGAAGGAGGGAGG + Intergenic
991613405 5:68471321-68471343 AGGGATGAGTTGAAAGAAGAGGG - Intergenic
991927435 5:71719194-71719216 AGGGAGGAGGCGAAGAAGGAAGG - Exonic
992817627 5:80460937-80460959 AGAGGAGAGTAGAAGGAGTATGG - Intronic
992896909 5:81253531-81253553 AGGGTGGACCTGAAGGAGGAGGG - Intronic
993507858 5:88733248-88733270 AGGTAGGAGTTTAAAGAGCATGG + Intronic
994200887 5:96974455-96974477 AATGTGGAGGTGAAGGAGTAGGG - Intronic
994404690 5:99329589-99329611 AGGGAGGACTTAAAGGTGAAAGG + Intergenic
994558094 5:101330648-101330670 AGTGATGAGTTGAACAAGTAAGG + Intergenic
995129054 5:108610460-108610482 AAGGAAGAGGTGAAGGAGGAGGG + Intergenic
996646390 5:125823399-125823421 TGGAAGGAGTTGAAGGATGATGG - Intergenic
997462978 5:134067624-134067646 AAGGAGGAGGAGAAGGAGAAGGG + Intergenic
997854204 5:137358510-137358532 AGGGAGGAGGTGGAGGAGTGGGG + Intronic
998184049 5:139965307-139965329 TGGGAGGAGTTGAGAGAGTCGGG - Intronic
999059525 5:148618486-148618508 AGGCAGGAGATGAAGAAATATGG - Intronic
999121061 5:149209716-149209738 AGGGAGGAGTTGAAAGGGTTGGG + Intronic
999231487 5:150064741-150064763 AGGGAGGGGATCAAGGAGGATGG + Intronic
1000166740 5:158657163-158657185 AGGCAGAAGTAGAAGCAGTAGGG - Intergenic
1000198960 5:158988604-158988626 AGGGAGGAGTTGAGGGGATAGGG + Intronic
1000747655 5:165055053-165055075 GAGGAGGAGTAGAAGGAGGAAGG - Intergenic
1000888897 5:166781076-166781098 AGGGAGGAATTGAGGGAGAGAGG + Intergenic
1001003814 5:168031810-168031832 AGGGAGGAAGGGAAGGAGGAAGG + Intronic
1001004374 5:168037325-168037347 AGAAATGAGTTGAAGAAGTAAGG - Intronic
1002279084 5:178120460-178120482 AGGGAGGAGCTGAAGGGGCTAGG - Exonic
1002553420 5:180015540-180015562 AAGGAGTAGGGGAAGGAGTAGGG + Intronic
1002773239 6:307262-307284 AGGGAGGGGAGGAAGGAGAAGGG - Intronic
1002935679 6:1670145-1670167 AGGGAGGAGTTGAGGGGGTGGGG - Intronic
1003101623 6:3180315-3180337 AGGGAGGGGGTGAGGGAGTTGGG + Intergenic
1003354358 6:5352736-5352758 AGGGAGGAAGGGAAGGAGGAAGG - Intronic
1003479653 6:6519304-6519326 AGGGAAGAGCCGAAGGAGTAAGG - Intergenic
1003527363 6:6909498-6909520 AAGGTGGAGTTGAAGGAGAAAGG - Intergenic
1003868944 6:10386571-10386593 AGAGAGAACTTGGAGGAGTAAGG - Intergenic
1003874363 6:10423175-10423197 AGGGAGAAGGTGAAGAAGGAAGG + Intergenic
1004001487 6:11600841-11600863 AGGGAGGTCTGGAAGGAGGACGG - Intergenic
1004131175 6:12921531-12921553 AGGGAGGAGGGAAAGGAGGAAGG + Intronic
1004751473 6:18566172-18566194 AGGGAGGAATAAAAGGAATAAGG - Intergenic
1004902323 6:20205917-20205939 GGGGAGGAGTTGGAGGGGTCTGG - Intronic
1004980396 6:21016905-21016927 AGGGTGGATTGGAAGGAGTGAGG - Intronic
1005677118 6:28165952-28165974 ATAGAGCAGATGAAGGAGTATGG - Intergenic
1006520857 6:34570345-34570367 AGCGAGGGGGTGAAGGAGGAGGG - Intergenic
1006582612 6:35085631-35085653 AGGGAAGAGTGGAAGGAGGTAGG + Intronic
1006919000 6:37615369-37615391 TGGGAGGAGGGAAAGGAGTAAGG - Intergenic
1007091675 6:39188711-39188733 AGGAAGGAGTGGGAGGAGCAAGG - Intergenic
1007289175 6:40772164-40772186 AGGAAGGGGGTGAAGGAGTAGGG + Intergenic
1007940744 6:45778893-45778915 AGGGAGGAGAGGAAAGAGTTGGG - Intergenic
1008124649 6:47654636-47654658 ATGGAGGAGTTGATGGAGGCTGG - Intergenic
1008294903 6:49763668-49763690 AAGGAGAAGTTGAAGGGGTAAGG - Intergenic
1008461898 6:51785155-51785177 TGGGAGGAGGTAAAGGAGGAAGG + Intronic
1008928382 6:56911188-56911210 AGGGAGGAAGGGAAGGAGGAAGG + Intronic
1009633725 6:66235440-66235462 AGGGAAGAGTTGATGGCCTATGG - Intergenic
1010650723 6:78452676-78452698 AAGGAGGAATTGAAGGGGTAAGG - Intergenic
1011515646 6:88149656-88149678 AGGGACAAGGTGAAGGAGGAAGG - Intronic
1012422279 6:99078467-99078489 AGGGAGGAAGGGAAGGAGGAAGG + Intergenic
1012608165 6:101183812-101183834 AGGTAGCAGTTGAGGGAGAAAGG - Intergenic
1014055301 6:117007564-117007586 AGCCAGGAGTTGAAGGAGATTGG + Intergenic
1014154923 6:118099458-118099480 GGGGAGGAGGAGAAGGAGTGGGG - Intronic
1014205684 6:118652279-118652301 AGGAAGAACGTGAAGGAGTAGGG - Intronic
1014950194 6:127545319-127545341 AGGGAAGAATGGAAGGAGAAAGG - Intronic
1015151647 6:130045801-130045823 AGGGAGGAAGGGAAGGAGAAGGG + Intronic
1015625809 6:135180773-135180795 AATTAGGAGTTGGAGGAGTAGGG - Intergenic
1015859990 6:137665802-137665824 AGGGAAGGGTTTAAGGAATAAGG - Intergenic
1015866032 6:137727672-137727694 AGGGAGAAGTAGAAGGGGTTTGG + Intergenic
1016402365 6:143694206-143694228 AGGAAGAAGTAGAAGGAGGAAGG + Intronic
1016466099 6:144327177-144327199 AGGGAGGGGGTGAAGGAGAGGGG + Intronic
1016466107 6:144327203-144327225 TGGGAGGAGGAGAAGGAGGAGGG + Intronic
1016560667 6:145392419-145392441 AAGGAGCAGTAGAAGGAGAATGG - Intergenic
1016986189 6:149897655-149897677 AGGGAGGATCTGAGGGAGAATGG + Intronic
1017041864 6:150314416-150314438 AGGGAGGAGGAGGAGGAGAAAGG + Intergenic
1017300445 6:152851682-152851704 AGGGAGGAATTTGAGGACTAAGG + Intergenic
1017395506 6:153994717-153994739 AGGGAGCAGTAGGGGGAGTAGGG + Intergenic
1017770101 6:157638298-157638320 AGGAAGGAGTAGGAGGAGGACGG - Intronic
1018316517 6:162562051-162562073 GGAGAGGAGATGGAGGAGTAGGG + Intronic
1021258230 7:18421370-18421392 AGGGAGGGATGGAAGGAGAAAGG + Intronic
1021899389 7:25268484-25268506 ACGGAGGGGTTGAAGGAGGTTGG + Intergenic
1022100791 7:27167957-27167979 AGGGAGGAGTTGAAGGGAATGGG + Intronic
1022318391 7:29265175-29265197 CAGGAGAAGTTGAAGGAATAGGG - Intronic
1023088939 7:36600204-36600226 AGGGAGGAGAGGAGGGAGGAAGG - Intronic
1023142354 7:37114015-37114037 TGGGTGGAGTTGAGGGAGGAAGG + Intronic
1023168762 7:37369901-37369923 AAGGAGGATCAGAAGGAGTAGGG - Intronic
1023595204 7:41822417-41822439 AGGGAGGAGGAGAGGGAGGAAGG + Intergenic
1023860329 7:44214455-44214477 AGAAAGGAGGTGAAGGAGTCAGG - Intergenic
1024171334 7:46791058-46791080 AGGGAAGAGGTGAAGGATAAGGG + Intergenic
1024273601 7:47660067-47660089 GGGCAGGAGATGAAGGAGCAGGG - Exonic
1024977518 7:55127428-55127450 AAGGAGAGGATGAAGGAGTAAGG - Intronic
1025143958 7:56488874-56488896 AGGGAGGAGTGGCTGAAGTAGGG - Intergenic
1025259558 7:57409365-57409387 AGGGAGGAGTGGCTGAAGTAGGG - Intergenic
1026191913 7:68136509-68136531 AGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1026191921 7:68136528-68136550 AGGGAGGAGGGGAAGGAGGAGGG + Intergenic
1026311777 7:69192060-69192082 AGGGAGGAGCTGCAGGGGTGAGG + Intergenic
1026539771 7:71269535-71269557 AGGAGGCAGTAGAAGGAGTAGGG + Intronic
1026571911 7:71538789-71538811 AGGGAGGAAGGGAAGGAGGAAGG + Intronic
1027197684 7:76042352-76042374 AGGGAGCAGTTGGTGGAGGAGGG - Intronic
1027254217 7:76420169-76420191 AAGGAGGAGGTGGAGGAGGAGGG - Intronic
1027712523 7:81623512-81623534 AGGAAGAAGGTGAAGGAGAAGGG + Intergenic
1028116444 7:87002888-87002910 TGGGAGGTTTTGAAGGAGTGTGG - Intronic
1029628873 7:101737821-101737843 AGGGAGGAGGGGAGGGAGGAAGG + Intergenic
1031053855 7:116972795-116972817 AGTGAGAAGTTGAGGGAGAAAGG - Intronic
1031350721 7:120727829-120727851 AGGGGAGAGTAGAAAGAGTATGG + Intronic
1031709015 7:125021794-125021816 AGGCAGAAGTTGAAAGAGTTTGG + Intergenic
1032085585 7:128881766-128881788 AGGGAGCTGGTGGAGGAGTAAGG + Intronic
1032566404 7:132951326-132951348 AGGGAGGGGTGCAAGGAGAAGGG + Intronic
1032996129 7:137448592-137448614 AGGGAGGAAGGGAAGGAGGAGGG + Intronic
1032996143 7:137448628-137448650 AGGGAGGAAGGGAAGGAGGAGGG + Intronic
1032996157 7:137448664-137448686 AGGGAGGAAGGGAAGGAGGAGGG + Intronic
1032996170 7:137448700-137448722 AGGGAGGAAGGGAAGGAGGAAGG + Intronic
1033077055 7:138259386-138259408 AGGGAGTAGATGAAGGGGGAGGG + Intergenic
1033553003 7:142464682-142464704 AGGGAGGAGTTGCAGGCAGAGGG + Intergenic
1034270253 7:149800216-149800238 AGGGAGGTGACGAAGGAGAAAGG + Intergenic
1034453411 7:151150014-151150036 TGGGAGGACTGGAAGGAATATGG + Intronic
1034975732 7:155448471-155448493 AGTGTGGAGGTGAAGGAGCAGGG + Intergenic
1034998781 7:155594993-155595015 AGGCAGGAGGGGAAGGAGGAAGG + Intergenic
1036063749 8:5355681-5355703 AGGGAGGAATTAAAACAGTAGGG - Intergenic
1036111478 8:5907586-5907608 AGGGAGAAAGTGAAGGAGGAAGG + Intergenic
1037462948 8:19131504-19131526 AGAGAGGAGTAGAGGGAGGAAGG + Intergenic
1037720513 8:21439635-21439657 AGGGAGGAGATGGGGGAGGAAGG + Intergenic
1037829346 8:22178787-22178809 AGGAAGGAGTTTGAGGAGGAGGG - Intronic
1039742685 8:40396766-40396788 AGGGCAGAGTGGAAGGGGTAGGG + Intergenic
1041291170 8:56310133-56310155 AGGGAGGAGGAGGAGGAGGAAGG + Intronic
1041291181 8:56310165-56310187 AGGGAGGAGGAGGAGGAGGAAGG + Intronic
1041396764 8:57399573-57399595 AGGGAGGAAATGAGGGAGAAAGG - Intergenic
1042528489 8:69791029-69791051 AGGGAGGAATGGAGGGAGGAGGG + Intronic
1042889339 8:73589985-73590007 AGGGAGGAGGAGAAGGAAGAGGG + Intronic
1043533735 8:81177309-81177331 AGGGAGAGGTTGAAAGAGTTTGG - Intergenic
1044172416 8:89071701-89071723 AGGGAGGAGAAGAAGGAAAAGGG - Intergenic
1045495570 8:102705306-102705328 AGGGAGGAATGGAAGGAAAAAGG - Intergenic
1046324404 8:112621619-112621641 AGGAATGATTTCAAGGAGTAAGG - Intronic
1046412653 8:113867375-113867397 AAGGAGGAGGAGAAGGAGAAAGG - Intergenic
1046719957 8:117608352-117608374 AGGGAGGAATGAAAGGAGGAAGG - Intergenic
1046776007 8:118164096-118164118 AGGGAGGAGTAGGAAGAGGAGGG + Intergenic
1047698422 8:127426800-127426822 AGGGAGGAGCTGGGGGAGGAGGG - Intergenic
1047780164 8:128104710-128104732 AGGCAGGAGTTTGAGGGGTATGG - Intergenic
1048224487 8:132571538-132571560 AGGGAGGGGAAGAAGGAGCAGGG + Intergenic
1048417556 8:134243627-134243649 AAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1048690342 8:136955820-136955842 AGGGAGGAAGTGAGGGAGGAAGG - Intergenic
1048798394 8:138172714-138172736 AGGGAGGAAGGGAAGGAGAAAGG + Intronic
1049266802 8:141671920-141671942 AGGCAGGAGATGAAGGACTGGGG - Intergenic
1049310453 8:141931296-141931318 AGGGAGGAGTGGCAGGCCTAGGG + Intergenic
1049853968 8:144850065-144850087 AGCGAGGACTTGAAGGAGCCGGG - Intronic
1050043137 9:1516226-1516248 AGGGAGTTGTGGAAGGAGTGGGG + Intergenic
1050475911 9:6040925-6040947 AAGGAGAAGATGAAGAAGTAAGG - Intergenic
1050490862 9:6186557-6186579 AGGGAGAAGGTGAAGGGGAAGGG + Intergenic
1050598045 9:7223771-7223793 AGGGAGGAAAGGAAGGAGGAAGG - Intergenic
1050676069 9:8054044-8054066 AGGGATGAGTTGAACAAGCAAGG - Intergenic
1050695664 9:8276603-8276625 AGGCAGAAGTTGAAAGAGTTTGG - Intergenic
1050985937 9:12082310-12082332 AGAGAGAAGTGGAAGGAGGAAGG + Intergenic
1051599830 9:18861826-18861848 AGGGAGCAGGAGGAGGAGTAAGG - Intronic
1051953549 9:22662985-22663007 AGGGAGGAATGGAAGGTGGAAGG + Intergenic
1053021804 9:34700353-34700375 AGGGAGGAGATGATGGTGCATGG + Intergenic
1054995863 9:71388574-71388596 AGGTAGGACTGGGAGGAGTATGG - Intronic
1055418727 9:76113107-76113129 AGAGACGAGTTGAGGCAGTATGG - Intronic
1055480287 9:76702930-76702952 TGGGGGGAATGGAAGGAGTAGGG - Intronic
1056546836 9:87620542-87620564 AAGGAGGAAGAGAAGGAGTAGGG + Intronic
1056672547 9:88642827-88642849 AGGGAGGGGGAGAAGGAGAAGGG - Intergenic
1057023991 9:91722227-91722249 AGGGAGGGGGTGAAAGAGAATGG - Intronic
1057130598 9:92651662-92651684 AGGGAGGAGCTGGAGGTGGAGGG - Intronic
1059388573 9:113984516-113984538 AGGGAGGAGCTGTAGGAGCCAGG - Intronic
1059431205 9:114251406-114251428 AGGGAGGAGGAGGAGGAGGAAGG - Intronic
1059586393 9:115612001-115612023 AGGGAGGAGTTGAAGAAGGAAGG + Intergenic
1061865695 9:133490862-133490884 AAGGAGGAGTTGGAGGAGGATGG + Intergenic
1061865759 9:133491074-133491096 GAGGAGGAGTTGGAGGAGGAGGG + Intergenic
1061905111 9:133692694-133692716 CGGGAGGAGGTGAAGGAGGCCGG - Intronic
1062050506 9:134444402-134444424 AAGGAGGAGGGGAAGGAGGAGGG - Intergenic
1062071489 9:134557491-134557513 AGGGAGGTTTTGAATGAGCAAGG + Intergenic
1185591635 X:1281152-1281174 AAGGAGGAGTAGGAGGAGAAGGG - Intronic
1185698427 X:2213301-2213323 AGGGAGGAAGGGAAGGAGGAAGG + Intergenic
1185954613 X:4475726-4475748 AGGGAGGAAGGGAAGGAGAAAGG + Intergenic
1186007780 X:5093410-5093432 AGGGTGGAGGTGCAGGAGGAAGG + Intergenic
1186239999 X:7555444-7555466 AGGGAGGAAGAGAAGGAGGAAGG + Intergenic
1186264634 X:7818805-7818827 AAGGAGAAGGGGAAGGAGTAGGG + Intergenic
1186471166 X:9823100-9823122 AGGGAGAAGGAGAAGGAGAAGGG - Intronic
1186641763 X:11463134-11463156 AAGGTGGTGTTGGAGGAGTAGGG + Intronic
1186908744 X:14139037-14139059 AAGGAGGAGAAGAAGGAGAAGGG + Intergenic
1187186959 X:16996056-16996078 TGGCAGGAGTTGTAAGAGTAGGG + Intronic
1187551631 X:20311934-20311956 AAGGAAGAGGTGAAGAAGTAAGG - Intergenic
1187696786 X:21930411-21930433 AGGGAGGAAGTGGAGGAGTTAGG - Intergenic
1188102660 X:26109087-26109109 AGTGAGGTGTTTAAGGAGTGAGG + Intergenic
1188973817 X:36649868-36649890 AGGGTGGAGTAGAGGGAGAAAGG + Intergenic
1189110642 X:38286209-38286231 AGGAAGGAGAGGAAGGAGAAGGG - Exonic
1189110660 X:38286269-38286291 AGGGAGAAGAGGAAGGAGAAGGG - Exonic
1189110675 X:38286320-38286342 AGGGAGAAGAGGAAGGAGAAGGG - Exonic
1189236585 X:39491724-39491746 AGGGAGGAGTTGGTGGATAAGGG - Intergenic
1189726187 X:43969904-43969926 CGGGAGGAGGTGGAGGAGGAAGG + Intronic
1190058119 X:47193935-47193957 GGGGAGGAGGAGAAGGAGGAGGG + Exonic
1190291404 X:48995183-48995205 TGGGAGGAGTTGGAGGAGGAAGG + Intronic
1190515882 X:51223211-51223233 AGGGAAGAGTTGAAGGACAGTGG - Intergenic
1190569358 X:51766082-51766104 CTGGAGGAGTTGGAGGAGTTCGG + Intergenic
1190598066 X:52066209-52066231 AGGGAGGAGAGGAAGGAGATGGG + Intronic
1190610758 X:52187864-52187886 AGGGAGGAGAGGAAGGAGATGGG - Intronic
1194839992 X:98728344-98728366 AGGAAGGAGTTCAAATAGTATGG - Intergenic
1196001615 X:110793414-110793436 AGGGAGGAGGTAAAGAAGGAAGG - Intronic
1196904273 X:120416678-120416700 AGAGAGGAGGTTAAGGAGAATGG - Intergenic
1197852426 X:130877400-130877422 AGGAAGGAGATAAAAGAGTACGG - Intronic
1198217732 X:134571403-134571425 GGGGTGGAGTGGAAGGGGTAAGG + Intronic
1198368419 X:135967072-135967094 AGGAAGGAATGGAAGGAGAAAGG + Intronic
1198510117 X:137341929-137341951 AGGAAGTAGTTTAAGGAGAAAGG + Intergenic
1198890336 X:141387828-141387850 CAGGGGGAGTTGAAGGAGGAGGG - Intergenic
1199061518 X:143361204-143361226 AGGGAAGAGTTGTAGGAGGATGG - Intergenic
1199364301 X:146960906-146960928 AGAGATGAAGTGAAGGAGTAGGG - Intergenic
1199377779 X:147133586-147133608 AGGGAGGAGTGGAGGGTGGAAGG + Intergenic
1200254406 X:154572292-154572314 AGGGAGGAAAGGAAGGAATAAGG - Intergenic
1200263363 X:154632116-154632138 AGGGAGGAAAGGAAGGAATAAGG + Intergenic
1201380492 Y:13371801-13371823 ATGGAGAAGTTGTAGGGGTATGG + Intronic
1201411427 Y:13702976-13702998 AGGGGAGGGTAGAAGGAGTAAGG - Intergenic
1201458931 Y:14201342-14201364 GGGGAGGAAGAGAAGGAGTAAGG + Intergenic
1201494379 Y:14576968-14576990 AGGATGGACTTGAAGGAGTACGG - Intronic
1202578296 Y:26350879-26350901 GGGGAGGAGAAGAGGGAGTATGG - Intergenic