ID: 965680691

View in Genome Browser
Species Human (GRCh38)
Location 3:171248222-171248244
Sequence CTGCCTTCATTGTTCTCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 226}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965680691_965680701 9 Left 965680691 3:171248222-171248244 CCTGTGGAGAACAATGAAGGCAG 0: 1
1: 0
2: 1
3: 17
4: 226
Right 965680701 3:171248254-171248276 AAGGGAGGAGAGGAGAGTGGTGG 0: 1
1: 8
2: 164
3: 1173
4: 7001
965680691_965680700 6 Left 965680691 3:171248222-171248244 CCTGTGGAGAACAATGAAGGCAG 0: 1
1: 0
2: 1
3: 17
4: 226
Right 965680700 3:171248251-171248273 CGGAAGGGAGGAGAGGAGAGTGG 0: 1
1: 5
2: 158
3: 1144
4: 7453
965680691_965680697 -9 Left 965680691 3:171248222-171248244 CCTGTGGAGAACAATGAAGGCAG 0: 1
1: 0
2: 1
3: 17
4: 226
Right 965680697 3:171248236-171248258 TGAAGGCAGGGGCAGCGGAAGGG 0: 1
1: 0
2: 3
3: 56
4: 685
965680691_965680699 -1 Left 965680691 3:171248222-171248244 CCTGTGGAGAACAATGAAGGCAG 0: 1
1: 0
2: 1
3: 17
4: 226
Right 965680699 3:171248244-171248266 GGGGCAGCGGAAGGGAGGAGAGG 0: 2
1: 0
2: 25
3: 301
4: 2633
965680691_965680698 -6 Left 965680691 3:171248222-171248244 CCTGTGGAGAACAATGAAGGCAG 0: 1
1: 0
2: 1
3: 17
4: 226
Right 965680698 3:171248239-171248261 AGGCAGGGGCAGCGGAAGGGAGG 0: 1
1: 0
2: 5
3: 125
4: 1355
965680691_965680703 17 Left 965680691 3:171248222-171248244 CCTGTGGAGAACAATGAAGGCAG 0: 1
1: 0
2: 1
3: 17
4: 226
Right 965680703 3:171248262-171248284 AGAGGAGAGTGGTGGAGATTGGG 0: 1
1: 0
2: 3
3: 48
4: 462
965680691_965680702 16 Left 965680691 3:171248222-171248244 CCTGTGGAGAACAATGAAGGCAG 0: 1
1: 0
2: 1
3: 17
4: 226
Right 965680702 3:171248261-171248283 GAGAGGAGAGTGGTGGAGATTGG 0: 1
1: 0
2: 8
3: 121
4: 1313
965680691_965680696 -10 Left 965680691 3:171248222-171248244 CCTGTGGAGAACAATGAAGGCAG 0: 1
1: 0
2: 1
3: 17
4: 226
Right 965680696 3:171248235-171248257 ATGAAGGCAGGGGCAGCGGAAGG 0: 1
1: 0
2: 2
3: 49
4: 547

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965680691 Original CRISPR CTGCCTTCATTGTTCTCCAC AGG (reversed) Intronic
901305148 1:8227375-8227397 CTGCCCTAACTGTTCCCCACAGG - Intergenic
903124248 1:21236909-21236931 TGGCCATCATTGTTCTGCACGGG - Intronic
905791147 1:40790346-40790368 CTGTCCTCATTCTTCTCCTCCGG + Intronic
906314737 1:44779118-44779140 CTGCCTTGCTTGGTCTCCAAGGG + Intergenic
908717118 1:67082721-67082743 CTGCCTTTTTTGTTTTCCATTGG + Intergenic
912114016 1:106381717-106381739 CCCACTTCATTATTCTCCACAGG + Intergenic
914994491 1:152530384-152530406 CTGCCTTCATTATGTTCCAGGGG + Intronic
915595680 1:156895140-156895162 CTGCCTTCCTCTCTCTCCACTGG + Intronic
916176782 1:162047235-162047257 GTGACTTCATTGAACTCCACTGG + Intergenic
917253220 1:173085539-173085561 CTGCCTGCATTGTGTTTCACTGG - Intergenic
918325812 1:183409733-183409755 GTGCCTGCTTTCTTCTCCACAGG - Intronic
918781905 1:188710293-188710315 CTGCCTGCCTTGGCCTCCACAGG - Intergenic
1062923912 10:1299988-1300010 CTGCCTCCAGGGTCCTCCACCGG - Intronic
1063092085 10:2874202-2874224 GTGCCTTCATTGTGCTCTAGTGG - Intergenic
1064422716 10:15204352-15204374 TTGCATTCATTGATCTGCACTGG - Intergenic
1066985492 10:42462768-42462790 CTGCCTGCATTGGTCTCCCCAGG - Intergenic
1068619319 10:59162398-59162420 CTGCCCTCCTTGTACTCCACAGG - Intergenic
1068619769 10:59169041-59169063 CTGCCTTCATTTTTCCCCCCAGG + Intergenic
1068975184 10:63001633-63001655 ATGCCATCATTGTGGTCCACTGG + Intergenic
1069004493 10:63301973-63301995 CTGGCTGCATTGTATTCCACTGG + Intronic
1070410867 10:76138671-76138693 CTGCTTTCATTGGTCTCCAGTGG - Intronic
1070965590 10:80528469-80528491 CAGCCTTCTTTCTGCTCCACAGG + Exonic
1071572817 10:86707477-86707499 CTGCCTTCGCTCTTCTCCCCTGG - Intronic
1071708601 10:88026523-88026545 CTGCCCTCATTGTTCTTAATAGG - Intergenic
1071879601 10:89881786-89881808 CTGCCTTCACTGTATTCCATAGG + Intergenic
1072595197 10:96865406-96865428 ATGCCTTCATGCTTCTCCAATGG - Intronic
1073010286 10:100353821-100353843 CTTCCTTCCTTTTGCTCCACAGG - Intronic
1073257138 10:102159988-102160010 CTGTCTTCACTGCTTTCCACAGG - Exonic
1073398628 10:103238999-103239021 CTTTCTTCATTCTTGTCCACAGG - Intergenic
1074307948 10:112296456-112296478 CTGCTTACATTATTTTCCACTGG + Intronic
1074674655 10:115834670-115834692 CTTCCTTGTTTGTTCTCCAATGG + Intronic
1075505546 10:123018245-123018267 CTGGTTTCATTTTTGTCCACTGG + Intronic
1079413993 11:20215860-20215882 CTCCCTGCATTGTTCACAACTGG + Intergenic
1081153200 11:39657582-39657604 CTGTCTTCATTCTTTTACACTGG - Intergenic
1082650654 11:55787707-55787729 CTGCCATCACTATTTTCCACGGG + Intergenic
1084895949 11:72269118-72269140 CTGCCTGCACTTTGCTCCACTGG + Intergenic
1086790230 11:91028220-91028242 CTGCCTTTATTGTTCCCCATTGG - Intergenic
1086985806 11:93247908-93247930 CAGCCTTCTTTGTAGTCCACAGG + Intergenic
1087370960 11:97283143-97283165 CTGCTTTCATTGTATTCCATAGG - Intergenic
1087589282 11:100165277-100165299 CTGCTTTCACTGTACTCCAGTGG + Intronic
1088075497 11:105843545-105843567 AAGCCTTGATTGCTCTCCACGGG + Intronic
1088231708 11:107679649-107679671 CTGCCTTTATGGTCCTCCAGAGG + Intergenic
1089344670 11:117783487-117783509 CTGACTTCATTGTTAACTACAGG + Intronic
1089629689 11:119776674-119776696 ATGCTTTCATTGTTCTCCTGCGG + Intergenic
1091361961 11:134984972-134984994 CTGCCTTCACTGCTCTCCCTAGG - Intergenic
1095236545 12:39803009-39803031 CTGCCTTCATTGTATCCCAAGGG - Intronic
1095721012 12:45400738-45400760 CTCCCTTTACTGCTCTCCACAGG + Intronic
1097757107 12:63418712-63418734 ATGCCTTCATAGCTCTACACAGG - Intergenic
1097960016 12:65523108-65523130 CTGCCGACATTCTTCTCCAGAGG - Intergenic
1098550827 12:71759335-71759357 ATGCCTTTAATGTTCTCAACAGG + Intronic
1100552734 12:95661542-95661564 CTGCCTTCATTGTAATCCAAAGG + Intronic
1101569019 12:105936149-105936171 CTGCCTTCTGTGAACTCCACAGG + Intergenic
1102272943 12:111555129-111555151 CTGCTTTCATTTTTCTCCTTTGG - Intronic
1103059694 12:117848526-117848548 CTGGCTTGATTGTTCTCCAGAGG - Intronic
1105333303 13:19438817-19438839 TTGCCTGCATTGTCCTCCCCAGG - Intronic
1105782609 13:23717156-23717178 CTGCCTCCACTGATCTGCACAGG - Intergenic
1106645747 13:31631918-31631940 CTTCTTTCATTGTGCTCCACAGG + Intergenic
1107955465 13:45506971-45506993 CTGCCTCCGTCGTCCTCCACGGG - Intronic
1113106385 13:106775935-106775957 CTCTCTTCATTGTTCACTACAGG + Intergenic
1114419885 14:22572937-22572959 CTGCATTCAAGGTTATCCACTGG + Intronic
1117735014 14:58760158-58760180 CAGGCATCATTGGTCTCCACAGG + Intergenic
1117842745 14:59877604-59877626 CTGCTTTCAGTGTATTCCACAGG + Intergenic
1118014019 14:61640303-61640325 CTGCCTTCAGTGTCCTCCTGGGG + Intronic
1120232556 14:81856021-81856043 CTTCCTTTATTGTACTCAACTGG - Intergenic
1120371515 14:83641486-83641508 CTGCCTTTTTTGTTTTCCATTGG - Intergenic
1122186851 14:100005839-100005861 CTGCCTTCTTTTTTTTCCACCGG - Intronic
1123139060 14:106057643-106057665 CTGGCTTCATTACTCTCTACAGG - Intergenic
1123628120 15:22241548-22241570 CTGACTCCATTCTTCTCCCCAGG - Intergenic
1123861330 15:24470335-24470357 CTTTCTTCATAGTTCTCCTCAGG - Intergenic
1124794902 15:32768344-32768366 TTTCCTTCATTGTTCTCTTCAGG - Exonic
1128113392 15:65090424-65090446 CTGCCTTCAGCCTGCTCCACTGG + Intergenic
1128388600 15:67167606-67167628 CTGGCTTCAGGGGTCTCCACTGG - Intronic
1130043768 15:80428437-80428459 CTGCCTGCGTTCTTATCCACAGG + Intronic
1130155561 15:81347228-81347250 TTGGCTTCATTTTTCTCCAAGGG - Intronic
1131988291 15:98066884-98066906 CTTCATTCAGTATTCTCCACAGG + Intergenic
1132052661 15:98620302-98620324 TTGCATTCTCTGTTCTCCACTGG - Intergenic
1132404796 15:101535784-101535806 CTGCCTGCCTTGGGCTCCACTGG - Intergenic
1132466611 16:80305-80327 CTGCCTTTCTGGTTCTCCAGAGG + Intronic
1138482250 16:57311191-57311213 ATGCCTCCTTTGTTCTCCAAAGG + Intergenic
1139642025 16:68298629-68298651 CAGTCTTCACTGATCTCCACAGG - Exonic
1141975823 16:87515786-87515808 CTGACTCCATTCTTCTCCCCAGG + Intergenic
1141990671 16:87607527-87607549 CGGCCTTGCTTGCTCTCCACTGG + Intronic
1143099352 17:4496933-4496955 CTGCCTTCCCTTTTCACCACTGG - Intergenic
1143742344 17:8963953-8963975 CTGTCTTCTTTGTCTTCCACGGG + Intronic
1147484624 17:40800757-40800779 CTGCCTTCATCCTTCTCACCTGG - Intergenic
1148847588 17:50538370-50538392 CTGCCTCCAGTCCTCTCCACTGG + Intronic
1151275078 17:73028071-73028093 CTGCCTTCATTCTGCTCCTGGGG + Intronic
1152343594 17:79738380-79738402 CTGCCATCTCTGTGCTCCACTGG + Intronic
1153235641 18:2984496-2984518 CTTCTTCCATTTTTCTCCACCGG - Intronic
1153376070 18:4380877-4380899 CTGCCAATATGGTTCTCCACTGG + Intronic
1155184012 18:23371864-23371886 CTTCCCTTATTATTCTCCACAGG + Intronic
1156508832 18:37617776-37617798 GTGCCTTTGTTCTTCTCCACAGG + Intergenic
1157632909 18:49117776-49117798 CTGCCTTCAGTGCTCTCCTTTGG + Intronic
1158455681 18:57605254-57605276 CTTCCTTCATTGTTCTTCCTTGG - Intronic
1160125803 18:76170277-76170299 CTGCTTTAATTGGTCTCCTCAGG - Intergenic
1160891602 19:1381520-1381542 CTGGCTTCATTGTTCCTCCCGGG + Intergenic
1163189342 19:15664967-15664989 CTGCCTGCATTGTGAACCACGGG - Intergenic
1164773056 19:30827319-30827341 CTGGCTTCCTTCTTCTCCAAAGG + Intergenic
1165412451 19:35670417-35670439 CTTCCTTCGTTTTTCTACACAGG + Intronic
1165412506 19:35670585-35670607 CTTCCTTCATTTTTCTAGACAGG + Intronic
1165491412 19:36125501-36125523 CTGCCATCATTTTTCCCCAGTGG - Exonic
1166407962 19:42535979-42536001 CTGCTTTCATTGTATCCCACAGG + Intronic
1168435228 19:56311478-56311500 ATGCCTTCATTCTTCTCTATTGG - Intronic
926820898 2:16850753-16850775 CTTCCTTCAGTGTTCTTCATAGG + Intergenic
926950564 2:18238334-18238356 CTGGCTGCATTGTTCTCGAGAGG + Intronic
927240902 2:20918848-20918870 GTGCTTTCTTTCTTCTCCACAGG - Intergenic
929264199 2:39900052-39900074 TTGCCTTCATTGATCTCCCAGGG - Intergenic
929757527 2:44779652-44779674 TAGCCTTCATTTTCCTCCACAGG + Intergenic
929921592 2:46175858-46175880 CTGTTTTCATTGTTGTCCAAAGG - Intronic
930198754 2:48532874-48532896 CTGCCTTCCTTGCTCTCCACTGG - Intronic
930883746 2:56300672-56300694 CTTCCTTTATTTTTCTCCAGAGG + Intronic
932619585 2:73257843-73257865 CCCCCTTCCTTGGTCTCCACGGG - Exonic
933280785 2:80330689-80330711 CTGCCTTCCAGGGTCTCCACAGG + Intronic
934036929 2:88096032-88096054 TTGCCTTCAGTGATCTCCAGTGG + Intronic
936433677 2:112484722-112484744 CTGCCTACATTCTTATCCACAGG - Intronic
937000876 2:118466549-118466571 ATCCCTTCATTGTTCACCAGAGG - Intergenic
937034261 2:118767833-118767855 CTGCCCTCATTATCCTCCATTGG - Intergenic
937657503 2:124393405-124393427 CTGCTTTCATAATTCTCCAAAGG + Intronic
939210089 2:139163454-139163476 CTTCCTCCATGGTTCACCACTGG - Intergenic
939312297 2:140497274-140497296 TTGCCTTCATTTTAATCCACTGG - Intronic
940743672 2:157542459-157542481 CTTCCATCATTTCTCTCCACTGG + Intronic
940948044 2:159640678-159640700 CTGCCTTCAGTGTATTCCATAGG - Intergenic
942605855 2:177689961-177689983 CTGCCTTCTCTCTTCCCCACTGG + Intronic
942636898 2:178017581-178017603 CTTCCTTCCTTCCTCTCCACAGG - Intronic
943041345 2:182808993-182809015 CTGTCTTCATTCTTCTTCACTGG - Intergenic
946371734 2:219285384-219285406 CTGCCTGCACTGCTCTCCAGTGG - Exonic
946964272 2:225020995-225021017 CTCCCTTGATTGTTGTCAACTGG - Intronic
947247550 2:228066351-228066373 CTGACTTCATTGTCAGCCACAGG + Intronic
948099978 2:235365688-235365710 CTGACTTCTTTGTTCTGCGCTGG - Intergenic
948852363 2:240714648-240714670 CTGCCTTCCTTGAGCTCCCCAGG - Exonic
1176739736 21:10589776-10589798 TTGCCTGCATTGTCCTCCCCAGG + Intronic
1178872321 21:36386680-36386702 TTGCTTTCATTGTTCACCGCAGG - Intronic
1182878629 22:33714050-33714072 CTGCTTTCATTATTGACCACTGG - Intronic
1183742084 22:39674392-39674414 CTGCCTTCCCTGATCTCCCCAGG - Intronic
1183795531 22:40113903-40113925 CTGCCTACATTGTTGGCAACTGG - Intronic
1184977324 22:48071643-48071665 GTGCATTCAGTCTTCTCCACAGG - Intergenic
950951322 3:17003350-17003372 CTGGCTTCAAATTTCTCCACTGG + Intronic
951280884 3:20747973-20747995 CTTGCTTCATTTTTCTCCCCAGG - Intergenic
951841915 3:27043725-27043747 CTTCCCTCATTGTACTCAACTGG - Intergenic
953937741 3:47060404-47060426 CTGCCTTCTTGGTTTTCCTCTGG - Intronic
955150774 3:56364833-56364855 CTGCCTGCATTCTTCTTCGCTGG + Intronic
955408985 3:58643688-58643710 CTGCCCACATTGTTTTTCACAGG + Exonic
957426115 3:80041373-80041395 ATGCCTTCATTGGTATCAACGGG - Intergenic
958555732 3:95673670-95673692 CTGCCTTCAAGGTTCTGCTCTGG + Intergenic
958609321 3:96403709-96403731 CAGCCTTTATTGTTCTACTCAGG + Intergenic
960528714 3:118739552-118739574 ATGCCTTCATTATTCTCCCCAGG + Intergenic
960648906 3:119924191-119924213 ATGCCTTTCTTTTTCTCCACTGG - Intronic
962309860 3:134317731-134317753 CTCCCTCCAGTGTTCTCCCCAGG - Intergenic
962846619 3:139279350-139279372 CTGCCACCATGGTTCACCACTGG - Intronic
963097246 3:141556999-141557021 CTGCCTTCTTTGTTTTCTCCAGG - Intronic
964369708 3:155987094-155987116 CTGACTTCATTTTTGTCAACCGG - Intergenic
965400893 3:168211007-168211029 CTGCCTCAATTATTTTCCACTGG + Intergenic
965680691 3:171248222-171248244 CTGCCTTCATTGTTCTCCACAGG - Intronic
968546490 4:1201373-1201395 CTGCCTGCATTGCTGACCACAGG - Intronic
970049662 4:11898971-11898993 GTGCTTTCATTGTTCTCCTGTGG + Intergenic
970674381 4:18432036-18432058 CCACCTTCATTCTTCCCCACTGG - Intergenic
971794994 4:31215904-31215926 CTGCCCCCATGATTCTCCACTGG - Intergenic
971877905 4:32328156-32328178 CTACCTTCATGGATCTCCTCTGG + Intergenic
972941740 4:44204024-44204046 CTGCCTTCATTTTTTTGTACTGG - Intronic
973980693 4:56305992-56306014 TTGTTTTCATTGTACTCCACTGG - Intronic
974847434 4:67367824-67367846 CTGCATTCTTTGTTCCCTACTGG + Intergenic
976509619 4:85893186-85893208 CTGCCTTTTTTGTTTTCCATTGG + Intronic
976518990 4:86004769-86004791 CTACCTTAAATGTTCTCCAAAGG - Intergenic
976524723 4:86074219-86074241 CTGCCTTTTTTGTTTTCCATTGG + Intronic
977008433 4:91603430-91603452 CTGCCTTCATTCTTTTCCATAGG - Intergenic
978057687 4:104292734-104292756 TTTCCTTCATTCTTCTCCAATGG + Intergenic
978885318 4:113761307-113761329 CTCGCTTCCTTCTTCTCCACTGG + Intronic
979077619 4:116294081-116294103 CTGGCTTAATTATTATCCACTGG + Intergenic
982173986 4:152688223-152688245 CTGCCTACATTCTCCTCCTCTGG + Intronic
983316150 4:166134754-166134776 CTGTTTTCATTCTTCTCCGCGGG + Intergenic
985806586 5:2048773-2048795 GTGCCTTCATTGTGCTCCGGAGG - Intergenic
986261066 5:6146779-6146801 CTGCTATCATTATTCTCCAGGGG + Intergenic
987537113 5:19203829-19203851 ATTCCTCCATTCTTCTCCACTGG - Intergenic
988583748 5:32491114-32491136 CTGGCTGCTTTGTTTTCCACAGG - Intergenic
988739183 5:34053197-34053219 CTGCTTTCATGGTTTGCCACAGG + Intronic
991070497 5:62474096-62474118 CTGCTTTAATTTTTCTTCACAGG - Intronic
992343279 5:75848434-75848456 CTTCCTTCATCCTTCTCCCCAGG - Intergenic
994791769 5:104236263-104236285 CTGCCTTCTTTACTTTCCACTGG - Intergenic
995784468 5:115814418-115814440 CTGTCTTGATTCTTCTGCACTGG + Intronic
996339842 5:122424391-122424413 CTGCCTACATTGTTCTTTTCTGG + Intronic
998600668 5:143581781-143581803 CAGTCTTCATTTTACTCCACTGG - Intergenic
1000467697 5:161600409-161600431 AATCCTTCATTGTTCTCCAGTGG - Intronic
1001128947 5:169047451-169047473 CTGCCTTCAGTAGTCTCCAGAGG + Intronic
1001826132 5:174746499-174746521 CTCCCTACATTGTTCTAGACAGG - Intergenic
1002187600 5:177461732-177461754 CTGCCTTATTTGCTCTCCATAGG + Intronic
1002318304 5:178359903-178359925 CAGCCCTCCTCGTTCTCCACTGG - Intronic
1002894189 6:1366295-1366317 CTGCCTTCATGGGTCTGCTCTGG + Intergenic
1003350047 6:5308189-5308211 CTGGCTTCATTGTTCTTCCCGGG - Intronic
1007197488 6:40075310-40075332 CTGCCTTAAGGTTTCTCCACAGG + Intergenic
1008261368 6:49369906-49369928 CTGCCTGCATTGACCTCCAAAGG + Intergenic
1010385694 6:75277060-75277082 CTTCCTTCATTCTTCTTCATAGG + Intronic
1013456582 6:110335025-110335047 CTGCCTGCCTTGTTCTGCCCTGG - Intronic
1016703795 6:147083133-147083155 CTGGCTTCCTTGATGTCCACAGG - Intergenic
1018117174 6:160598684-160598706 CTGCCTTTGTTCTTCTCCTCTGG + Intronic
1020617492 7:10477125-10477147 CTGCCAACATTGTTGCCCACTGG + Intergenic
1022374370 7:29799884-29799906 CTTCCTTCTTTGGTCTCCTCAGG + Intergenic
1024061090 7:45699257-45699279 CTGCCCTCAGTGTGCTCCAGAGG - Intronic
1024613295 7:51085348-51085370 CTGCCTTCTTTGTACTTCATAGG - Intronic
1028153166 7:87399101-87399123 ATGCCTTCTATGTTCACCACAGG + Exonic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1030483221 7:110130690-110130712 CAGCATTCATTCTTCTCCAGGGG - Intergenic
1033387343 7:140891255-140891277 CTGAGTTCAGTGTTCTCCAAAGG + Intronic
1034747036 7:153531944-153531966 CTGCATTCATGCTTCTTCACTGG - Intergenic
1034986338 7:155517727-155517749 CTGGCTTCACTTTTATCCACTGG + Intronic
1035831692 8:2701894-2701916 TTCCCTTCCTTGTTCTCCACAGG - Intergenic
1036780834 8:11646028-11646050 CTGTCTTCCTTGCCCTCCACAGG - Intergenic
1037000443 8:13711329-13711351 CTGCTTTCATTGTATTCCATAGG + Intergenic
1037826221 8:22162202-22162224 ATGCCTTCCTCCTTCTCCACCGG - Intronic
1038960400 8:32511927-32511949 CTGCCTTAATTCTACCCCACTGG - Intronic
1039804062 8:40983824-40983846 CTTCGCTCATTGCTCTCCACTGG + Intergenic
1044060274 8:87626991-87627013 CTGCCTTTTTTGTTTTCCATTGG - Intergenic
1044624237 8:94220577-94220599 CTGTCTTCATGGTCTTCCACAGG - Intergenic
1046788027 8:118288987-118289009 CTGTGTTTATTGTTCTTCACTGG - Intronic
1047105244 8:121724542-121724564 CTCCCTGCATTGTTCCCCAGGGG + Intergenic
1047798645 8:128285472-128285494 TTGCCTTCATTCTTCTCTCCTGG + Intergenic
1048027431 8:130599472-130599494 CTGCCTTCAAGGGTCTCCAAGGG - Intergenic
1048752674 8:137697710-137697732 CTGTCTTCACTGCTTTCCACAGG - Intergenic
1048952971 8:139511293-139511315 CTGCCTTCATTATTCCAAACAGG - Intergenic
1049196440 8:141318263-141318285 CTGCCTCCACCCTTCTCCACTGG - Intergenic
1050723053 9:8612784-8612806 ATGTCTTCATTGTTCTCTACTGG - Intronic
1050967764 9:11829504-11829526 CTGTCTTCATTGCCCTACACCGG - Intergenic
1051223793 9:14877747-14877769 CGGCCTTCATTCTTATCCAGGGG - Intronic
1051875990 9:21793916-21793938 ATGGCTTCATTGTTCCCCACAGG + Intergenic
1052197018 9:25730200-25730222 CTGCTTTCTTGGGTCTCCACAGG - Intergenic
1055218070 9:73891832-73891854 CTGCCTTCACTGTCCTTCATTGG + Intergenic
1057164328 9:92914242-92914264 CTGATTTCATTCTTCCCCACTGG + Intergenic
1057179544 9:93022351-93022373 CTGCCTTCGGTGGTCACCACAGG - Exonic
1057328193 9:94086223-94086245 CTGTCATTATTGTTCACCACAGG + Intronic
1057342291 9:94213737-94213759 CTGTCTTCATTGACCTCGACGGG - Intergenic
1058807029 9:108602683-108602705 CTGCCTTCATGGTGCCCCAGAGG - Intergenic
1059065044 9:111074904-111074926 GTGCTTTCATAGTTATCCACAGG - Intergenic
1060213412 9:121724128-121724150 CTGCCGTCATGGCTCCCCACTGG + Intronic
1060256726 9:122037427-122037449 CTACCTTCATTGTTTTCTAGGGG - Intronic
1185942066 X:4333039-4333061 CTGCCATCTTTGTTCCCCAGGGG + Intergenic
1186062773 X:5728581-5728603 CTACCTTGATTTTTCTCCTCTGG - Intergenic
1187457052 X:19450781-19450803 CTGTCTTCATTGCTCCTCACTGG - Intronic
1189640036 X:43058833-43058855 TTACCTTCTTTGTTCCCCACTGG - Intergenic
1189672886 X:43430389-43430411 CTTCCTTCAGTTTTCTCCATTGG + Intergenic
1196212666 X:113012836-113012858 CTGACTTAATTGGTCTCTACTGG + Intergenic
1198107546 X:133475931-133475953 TGGACTTCAATGTTCTCCACAGG + Intergenic
1199229493 X:145419665-145419687 CTGATTTAATTCTTCTCCACGGG + Intergenic
1199603901 X:149561261-149561283 CTGCTTTCAGTGTTATCCATTGG + Intergenic
1199646488 X:149918213-149918235 CTGCTTTCAGTGTTATCCATTGG - Intergenic
1199667596 X:150112927-150112949 TTGCCTTCAATATTCTTCACAGG - Intergenic
1202598036 Y:26563628-26563650 GTGCCTGCATTGTCCTCCCCGGG + Intergenic