ID: 965681136

View in Genome Browser
Species Human (GRCh38)
Location 3:171252886-171252908
Sequence CAGAAAATTTAAATGGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 411}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965681132_965681136 5 Left 965681132 3:171252858-171252880 CCATGTAAGACAGGAAAAATGGG 0: 1
1: 0
2: 1
3: 21
4: 274
Right 965681136 3:171252886-171252908 CAGAAAATTTAAATGGAGTAGGG 0: 1
1: 0
2: 2
3: 34
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965681136 Original CRISPR CAGAAAATTTAAATGGAGTA GGG Intronic
901112918 1:6813465-6813487 AAAAAAACTTAAAAGGAGTAGGG - Intronic
903087954 1:20881207-20881229 CAAAACATTTCAATGGAGAAAGG + Intronic
903795889 1:25928648-25928670 CAAAAAATTTGACTGGAGTCAGG + Intergenic
904764160 1:32829780-32829802 AAAAAAACTAAAATGGAGTATGG - Intronic
906015209 1:42570839-42570861 CAGAAAAAATAAATAAAGTATGG - Intronic
907057077 1:51379455-51379477 CAGAAACCTTGAAGGGAGTAGGG + Intronic
908416306 1:63916344-63916366 GAGAAAGTTTGAAAGGAGTAGGG + Intronic
909163988 1:72193847-72193869 TACAAAATTAAAATGGTGTATGG - Intronic
909915061 1:81307156-81307178 CAGAAAAGTTTAATGTAGCAAGG + Intronic
910058088 1:83055788-83055810 AAGAAAAATAAAAGGGAGTAAGG - Intergenic
910060239 1:83082614-83082636 AAGGAAATTTAAATGGAATTGGG - Intergenic
911302866 1:96197011-96197033 AAGAAAATTTGAATGAAATATGG + Intergenic
911336450 1:96586256-96586278 CAAAATATTTAAATGATGTATGG + Intergenic
911426918 1:97727924-97727946 TAGAAAATTTAAATTTAGAAGGG + Intronic
912141487 1:106734747-106734769 GAAGAAATTTAAATGAAGTATGG + Intergenic
913323182 1:117605187-117605209 CAGAAAGTTTAAGTGGTGCATGG + Intergenic
915631973 1:157159726-157159748 CTGAAAATTCATATGGACTAAGG + Intergenic
916119708 1:161518220-161518242 AGGAAAATTTAAATGGAGACTGG + Exonic
916122717 1:161543029-161543051 CCATAAATTTAAATGGAGAAAGG - Exonic
916129474 1:161599875-161599897 AGGAAAATTTAAATGGAGACTGG + Intronic
916697481 1:167253777-167253799 CACCAAATTAAAATGGGGTATGG - Intronic
917332024 1:173890745-173890767 AAGAAAATTATAATGGAATAGGG + Exonic
917464624 1:175265001-175265023 CAGAGAAGTTACATGAAGTAAGG + Intergenic
918097999 1:181350188-181350210 CCCAAAATTAAAATGGAGAACGG - Intergenic
918269008 1:182877700-182877722 CAAAGCATTTAAATGGAATATGG - Intronic
918381697 1:183962496-183962518 TAGGAACTTTAAATGGAATAGGG - Intronic
918765126 1:188472210-188472232 CAGAAAATTTAGATGAGGCATGG - Intergenic
919556402 1:199059876-199059898 CAGAAAATTTAAAGAAAGTATGG - Intergenic
921428644 1:215036299-215036321 CAGAGAATTTCAGTGGAGGAAGG - Intronic
921694891 1:218197685-218197707 GAAAATATTTAAATGGAGAAAGG + Intergenic
922640026 1:227220773-227220795 AAGAAATTTTTAATGGAATAAGG - Intronic
923221952 1:231903409-231903431 CTGTAGATTTACATGGAGTAAGG + Intronic
924635049 1:245778404-245778426 AAGAACAATTCAATGGAGTAAGG + Intronic
924655235 1:245968765-245968787 CAGAATTATTAAATGGAATATGG - Intronic
924902546 1:248416960-248416982 TAGCAAATTTAAATGTTGTAGGG + Intergenic
1062901434 10:1149612-1149634 CAGAAAACATAAACGGAGTCAGG - Intergenic
1063246975 10:4231502-4231524 AAAAAAATTTCAATGCAGTATGG + Intergenic
1063319850 10:5042681-5042703 CAGGAAATCAAAATGGTGTATGG + Intronic
1063649733 10:7921432-7921454 CAGAAAGTTTAAACGGGGGAGGG - Intronic
1064489596 10:15838385-15838407 CTGAGAATTTTAAGGGAGTAAGG - Intronic
1064677036 10:17770676-17770698 CAGAAAATTTAAATGTGGCCGGG - Intronic
1064716763 10:18184514-18184536 GAGAAAATTTGAATAAAGTATGG - Intronic
1064739484 10:18417829-18417851 AACAAAATTTAAATAGAGCAAGG + Intronic
1064904209 10:20328077-20328099 CAGAAAATGAAAGTGAAGTACGG + Intergenic
1066073048 10:31840476-31840498 GAGAAAATTTAAGTGGAGGTGGG - Intronic
1068134892 10:52941588-52941610 CAAAAAAATTTAATGGAGAAAGG - Intergenic
1068334317 10:55612395-55612417 CTGAAAATTAAAATTGAATATGG + Intronic
1069138526 10:64795371-64795393 AAGAAAATCTAAATTAAGTATGG + Intergenic
1069747218 10:70723302-70723324 CAGGAAGTTTAAATGGAATGTGG + Intronic
1070307608 10:75248888-75248910 CAGATCATTTGAATGGAGTTCGG + Intergenic
1070375298 10:75824928-75824950 CAAATAATTTAAATGTACTATGG - Intronic
1070389825 10:75959929-75959951 CAAAAAATATAAGTGGATTAAGG + Intronic
1071841935 10:89480783-89480805 CAAAAGAGTTAAATGGAGTGAGG + Intronic
1073393215 10:103196025-103196047 TAGAGAATTTAAATGAAGCATGG + Intergenic
1075225255 10:120623128-120623150 GAGAAAACTTTAATGGGGTATGG + Intergenic
1075609181 10:123837629-123837651 CACAAAATTATAATGCAGTAGGG + Intronic
1076264991 10:129102834-129102856 TAGAAAAATGAAATGGAGTAAGG + Intergenic
1076476192 10:130753662-130753684 CAGAAAACTTAAAAGGAAAAGGG - Intergenic
1078633021 11:13021739-13021761 CAGATAAATGAAATGGAGAATGG - Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1079745429 11:24122403-24122425 AAAAAAATATAAATTGAGTAGGG + Intergenic
1080096665 11:28416483-28416505 CAGAACCTTTACATGGAGTGAGG - Intergenic
1080978341 11:37369306-37369328 TAGAAAATATAAATTGAGGAAGG + Intergenic
1081497113 11:43623121-43623143 AACAAAATTCAAATGGTGTATGG + Intronic
1082213469 11:49535804-49535826 CAGAGAATTCAAATGTTGTAGGG - Intergenic
1082294452 11:50421834-50421856 CAAAGCATTTAAATGGAATATGG - Intergenic
1082570386 11:54730949-54730971 CAGAAAATTTGTATGGACAATGG + Intergenic
1085354186 11:75820741-75820763 AAGAAAATCTAAATGAACTATGG - Intronic
1086046465 11:82538034-82538056 AAGTAAATTAAAATGGAGAATGG + Intergenic
1086636140 11:89088630-89088652 CAGAGAATTAAAATGTTGTAGGG + Intergenic
1087143005 11:94784771-94784793 CAGACAATTTGAATGCAGTCAGG - Intronic
1087465854 11:98504265-98504287 TAGCAAATTTAACAGGAGTAAGG + Intergenic
1087953593 11:104256244-104256266 CAGATAATTTAAATGGCTAAAGG + Intergenic
1089237618 11:117045510-117045532 CAGAATATTAAAATGGCTTATGG - Intronic
1089803075 11:121054010-121054032 CAGAAGATTAAAACAGAGTAAGG - Intronic
1090039606 11:123278853-123278875 CAGAAAATTTCAAATGAGCATGG + Intergenic
1090575672 11:128100333-128100355 CAGAAAATTTAAAAATAGGAAGG - Intergenic
1091607717 12:1970387-1970409 CAGAAAATTTAAATAGCCAAAGG + Intronic
1092660359 12:10732216-10732238 TTGGAAATTTAAATGGAGTTGGG - Intergenic
1093203493 12:16218954-16218976 CAGAAATTTTAAATTAAGGAAGG - Intronic
1093672289 12:21891435-21891457 CAGAAAAATCAAATGGTGTTGGG + Intronic
1094449595 12:30570864-30570886 CTGAAAAGTTAACTGCAGTATGG - Intergenic
1097559414 12:61184366-61184388 TAGTAGATTTAAATGGAGAATGG + Intergenic
1097811606 12:64024991-64025013 TAGCAAATGTAAATGGAGGATGG + Intronic
1097960184 12:65524644-65524666 AAGGAAATATAAATGGAGAATGG - Intergenic
1098493659 12:71110646-71110668 AAGAAAATTGAAATGCAGTGAGG - Intronic
1099160799 12:79239427-79239449 CAGAAAATCTGAATAAAGTATGG + Intronic
1099272791 12:80532928-80532950 AATAAATTTTAAATGAAGTAAGG - Intronic
1099596938 12:84678857-84678879 CAGAAAATATAAATGTACTTTGG - Intergenic
1099739499 12:86614409-86614431 CAGAATAATTAAAGGGATTATGG + Intronic
1100681757 12:96931367-96931389 CACAAAATTTAAATGAAATAGGG + Intronic
1101454481 12:104816023-104816045 GAGAAAATTTAGATGCAGAAAGG + Intronic
1101707885 12:107237577-107237599 CAGACAATATATATGGAGAAGGG + Intergenic
1102655492 12:114479611-114479633 CAGGAAATTCAAAAGGAATAAGG - Intergenic
1102966768 12:117133674-117133696 CAGAAAATTGAAGTGCTGTAAGG + Intergenic
1104544063 12:129695256-129695278 AAGGAAATTTGAATGAAGTATGG + Intronic
1107700753 13:43045283-43045305 CAACAAATTTAAAGTGAGTAGGG - Intronic
1107774951 13:43829185-43829207 CCGAAAATTAGAAAGGAGTATGG - Intronic
1108736049 13:53284254-53284276 CAGAAATCTAAAATGGAGTTGGG - Intergenic
1108759403 13:53545110-53545132 CAGAAAATTTCAATAAAATACGG - Intergenic
1109032441 13:57209000-57209022 GGGAAAATTAAAATGGAATATGG + Intergenic
1109037070 13:57277469-57277491 CAGAAAACTCAAATAGAGAATGG + Intergenic
1109386049 13:61630121-61630143 CACAAAATTTAAAATGATTAAGG - Intergenic
1110089575 13:71428845-71428867 CAGAAAAATTACATAGAATAAGG + Intergenic
1110303080 13:73952146-73952168 CAGAAAAGTTACTTGGAGTCAGG + Intronic
1110791074 13:79587548-79587570 AAGAAAATCTGAATGGAGTATGG - Intergenic
1111081409 13:83313821-83313843 CAGGAAATTTAAATAAATTATGG - Intergenic
1111780025 13:92711018-92711040 GAAAAAATATAAATGGAGTTTGG + Intronic
1112143628 13:96673653-96673675 CAGAAGATTTAAGTGAATTAGGG - Intronic
1112973941 13:105293994-105294016 CAGAAAATTTAAGTGAAGGGTGG - Intergenic
1115095066 14:29625007-29625029 CAGAAAATAGAAATGGAAAATGG + Intronic
1115896165 14:38090119-38090141 CAGAAAAATTAAGAAGAGTAAGG + Intergenic
1116732545 14:48642776-48642798 AAGAAAAATTAAATTGAATATGG + Intergenic
1120612252 14:86656911-86656933 CATAAAATTTGAATGGAATATGG - Intergenic
1124357982 15:29012146-29012168 AAGAAAATGTGAATGAAGTATGG - Intronic
1124815063 15:32981908-32981930 CAGAAAATTTTAATTGTGAAAGG - Intronic
1125117976 15:36118139-36118161 CAGAAAATAGAAAAGAAGTAAGG - Intergenic
1125348899 15:38747152-38747174 GAGAATATCTGAATGGAGTATGG - Intergenic
1125582508 15:40796592-40796614 CAGAAAATTTAAGTGTGGAAAGG + Intronic
1125706074 15:41737453-41737475 CTGAAAATTTTAATTTAGTAAGG + Intronic
1127795925 15:62438276-62438298 CAGAATGTTTAAAGGGAGTGGGG + Intronic
1129647441 15:77449508-77449530 CATACAATTTAACTGGAGGAAGG - Intronic
1130161537 15:81405885-81405907 CAGGACAATTAAATGTAGTATGG + Intergenic
1130335024 15:82951397-82951419 CAGAAACTTAACCTGGAGTACGG + Intronic
1130668890 15:85892865-85892887 CAGAATATTTAAATTCAGGAAGG - Intergenic
1133631438 16:7625793-7625815 AATAAAATTAAAATGGAGGATGG - Intronic
1133647672 16:7779377-7779399 CAGAAAATTGAACTGCAGGAAGG - Intergenic
1134852615 16:17493365-17493387 CAGAAAATTTGAAAGAAGAAAGG - Intergenic
1134900610 16:17934519-17934541 CAGAAAATTAAAATGGTTTTAGG + Intergenic
1136651344 16:31674308-31674330 AAGAAAATCTAAATTTAGTATGG - Intergenic
1138188779 16:54997611-54997633 CAGAAAATTAAAATAAACTATGG - Intergenic
1139717419 16:68824578-68824600 TTGAAAATTGACATGGAGTAGGG + Intronic
1139845606 16:69919137-69919159 AAGAAAATTTAAATGTGGTCGGG - Intronic
1142407576 16:89899434-89899456 CAGAAAATTTAAATTGGGCCGGG + Intronic
1143476763 17:7207600-7207622 CAGAAAATGGAAATGGAGGTTGG + Intronic
1144120685 17:12149955-12149977 CAGAGAATTTAAATGGACCTAGG + Intergenic
1144425175 17:15134680-15134702 CAGAAAGTATAAATAGAGCAGGG + Intergenic
1145190122 17:20833346-20833368 CTGAAAATTAAAATTGAATATGG + Intergenic
1145401320 17:22537215-22537237 CTGAAAATTAAAATTGAATATGG + Intergenic
1146067574 17:29648692-29648714 CATACAATTAAAATGCAGTATGG + Intronic
1146800886 17:35820544-35820566 AAGGAAATTTTAATGGAGTGTGG + Intronic
1149825767 17:59826557-59826579 TAGAAAATATAAATGAAGAAAGG + Intronic
1151112671 17:71697507-71697529 CAGAAAATCTGAATAAAGTATGG + Intergenic
1153033715 18:738755-738777 AAGAAAATTAAAATGGATGAGGG - Intronic
1154929220 18:20974854-20974876 GAGCATATTTAAATGGAGCATGG - Intronic
1155417487 18:25614709-25614731 CAGAAATTTCAAATGTAGTCAGG - Intergenic
1155566009 18:27135327-27135349 CAGAAAATATTACTGCAGTATGG - Intronic
1156088468 18:33438026-33438048 CTGAAAATATAAAGGGACTATGG + Intronic
1156333194 18:36145060-36145082 CATAAGATTTAACTGGAGTAAGG - Intronic
1157271888 18:46282565-46282587 CAGAAACCTTAAATGCAGTTGGG + Intergenic
1158046932 18:53167677-53167699 AATAAAATATAAATGGAATATGG + Intronic
1158217900 18:55119421-55119443 CAGAAAATTTAAATATAGTTTGG + Intergenic
1158791076 18:60781362-60781384 CAGAATATTTAAATGACATATGG - Intergenic
1158999305 18:62956915-62956937 CAAAGAATTTAAATCTAGTAGGG - Intronic
1159129078 18:64259493-64259515 CAGAAAATATTAATGGAATGTGG - Intergenic
1159162052 18:64655111-64655133 CAGAAAATATAAATAGCTTAGGG - Intergenic
1159267144 18:66097086-66097108 CAGAAATTTAAAATTGTGTATGG - Intergenic
1159433527 18:68385778-68385800 CAGAAAATATAAGTGAAGTAAGG + Intergenic
1159496169 18:69209084-69209106 CAGAAAATATAAAGGAAGCATGG + Intergenic
1159718210 18:71851297-71851319 CAGAAAAATAAAATGGAGATGGG - Intergenic
1159780634 18:72656722-72656744 TAGAAAATTAAAATGGCATAAGG + Intergenic
1160184574 18:76665605-76665627 CATTAAATTTAAATGGGTTATGG + Intergenic
1162853851 19:13452981-13453003 CAAAAAATTCCAATGAAGTATGG + Exonic
1163610336 19:18297704-18297726 CAAAAAATTAAAATAAAGTAAGG - Intergenic
1165205415 19:34180886-34180908 TAGAAAAGTGAAATGGATTATGG - Intronic
1165684077 19:37802930-37802952 CAGAAAAAGTAAATGTTGTATGG - Intronic
1166241156 19:41494983-41495005 AACAAAATTTGAATGGAGAATGG + Intergenic
1167283691 19:48586621-48586643 CAGAAAAATGAAATGGGGTTGGG + Intronic
1167826554 19:51978782-51978804 CAGAAAATTTAAAGTAAATAAGG - Intronic
924993319 2:334747-334769 TAGAGAAGTTAAATGGAGAAAGG + Intergenic
925147883 2:1593140-1593162 CAAAAAATTAAAATGGTGGAGGG + Intergenic
925578735 2:5387570-5387592 AAGAAGATTTAAAAGGAATAGGG - Intergenic
925659381 2:6186128-6186150 CAGAATATTAAAATTGAATAAGG + Intergenic
926974480 2:18500077-18500099 TAGAAAATTTAAACAGAGTTAGG + Intergenic
927168183 2:20345949-20345971 GAGAAAATATTCATGGAGTATGG - Intronic
927788780 2:25993419-25993441 AAGAAAAACAAAATGGAGTAAGG - Intergenic
928544457 2:32316214-32316236 CAGTAAATTTAAATGGGCAAAGG + Exonic
928915976 2:36470931-36470953 CAGAATATTAACATGGAGTTTGG + Intronic
929042625 2:37760369-37760391 CAGAAAAATAAAATGTGGTAAGG + Intergenic
929042797 2:37761779-37761801 CAGAAAAATAAAATGTGGTAAGG + Intergenic
929200887 2:39234453-39234475 CAGAAAGTTGAAATGGAGACAGG + Intergenic
929323359 2:40574489-40574511 AAAAAAATTTAAATGGCATAAGG - Intronic
930006985 2:46905756-46905778 CAAAAACTTTCAATGGAGTATGG + Intronic
930716088 2:54595478-54595500 CAGAAAAGGTAAACGGAGAATGG + Intronic
931892201 2:66685723-66685745 AAAAAAACTTAAATGGTGTATGG - Intergenic
932537492 2:72615047-72615069 CAAAATATTTAAATGGGGGAGGG + Intronic
932626046 2:73296608-73296630 CACAAAAGTTCTATGGAGTAAGG + Intergenic
933025174 2:77248958-77248980 AAGAAAATTTAGATGAACTAGGG + Intronic
933458809 2:82552213-82552235 CATAAAATCTAAATGGAAGATGG + Intergenic
933583700 2:84156569-84156591 TATAAAATTTATATGGAATAAGG - Intergenic
933932477 2:87167647-87167669 AAGAAAATTTTATTGGAATATGG + Intergenic
934964386 2:98707295-98707317 TTTAAAATTTAAATGGGGTAGGG + Intronic
935075256 2:99736464-99736486 CAGAAAATTTGAAAGGAAAAAGG - Intronic
935445898 2:103156445-103156467 AGGATAATTTAAATGGACTATGG - Intergenic
935539023 2:104327406-104327428 CAGAAAATAAAAATCAAGTATGG + Intergenic
935634524 2:105239840-105239862 CAGAAAATTGAGATGAAGAAGGG + Intergenic
936360634 2:111797794-111797816 AAGAAAATTTTATTGGAATATGG - Intronic
936877324 2:117206544-117206566 CAGAAAAAATTAATGGAGTTGGG + Intergenic
938775699 2:134539600-134539622 CAGAAAATTTAAAAAGTCTAAGG + Intronic
938835946 2:135104282-135104304 CAGAAAAGTTAAACAGAATATGG + Intronic
939588116 2:144030214-144030236 AAGAAGATTTAGATGGGGTAGGG - Intronic
939923121 2:148141545-148141567 CAGAAAATTAAAATGCAATAAGG + Intronic
940082899 2:149824770-149824792 CAGAAAATTACAATATAGTATGG + Intergenic
940251294 2:151679555-151679577 CAGAAAATTTAAATCTATTTAGG + Intronic
940843874 2:158618460-158618482 CATAATATTTAAAAGGAATATGG + Intronic
941107205 2:161368450-161368472 CAGGTAATTTGTATGGAGTACGG - Intronic
941210942 2:162638404-162638426 CAGAAAATATTAATGGCTTAGGG + Intronic
941834722 2:170003953-170003975 CAGAACATTTTGATGAAGTAAGG + Intronic
943588311 2:189766128-189766150 AAGAAAATTTAAGAGGAGAAAGG - Intergenic
943768314 2:191687583-191687605 TAGAAAATTTAAATGCTGTCAGG + Intronic
944644062 2:201760797-201760819 TAGAAACTTTAAAATGAGTAAGG - Intronic
945393518 2:209294350-209294372 CAGAAAATCAAAAAGGAGTATGG + Intergenic
945394681 2:209304199-209304221 CTGAAAAACTAAATGGAATAAGG - Intergenic
945452392 2:210008631-210008653 CAAAAAGATTAACTGGAGTAGGG + Intronic
946316272 2:218915235-218915257 CAGACAATTGGAATGGAGTCAGG - Intergenic
948871494 2:240801260-240801282 CAGAGAATATAAATGGAAAATGG + Intronic
1169962995 20:11183252-11183274 CAGAAAATTTGAAAAAAGTATGG - Intergenic
1170092531 20:12606343-12606365 GAGCAAATTTAACTGGAGAAAGG - Intergenic
1170509981 20:17066703-17066725 CAGGCAATTTATATGGGGTAAGG - Intergenic
1172579180 20:36033319-36033341 CATAAAATTTAAAAGGAGTTTGG - Intergenic
1172926547 20:38542172-38542194 CAGAAAATGTAAAAGCAGAAAGG + Intronic
1173125872 20:40335562-40335584 CTGTAAATTTAAGTGGAGAATGG - Intergenic
1175065831 20:56287475-56287497 CAGACAATTTGAATGCAGTCAGG - Intergenic
1176964869 21:15201161-15201183 TATAAAATTTAAATGGAATACGG - Intergenic
1177209055 21:18047169-18047191 CATAATAATTAAATGGAGAAGGG - Intronic
1177416931 21:20806181-20806203 CAGAAAGGTGAAATGGAGTCAGG - Intergenic
1177509827 21:22071943-22071965 CAGAAAATTAAAATAGAGAGAGG + Intergenic
1177965608 21:27722714-27722736 CAGAATGTTAAAATGAAGTAAGG + Intergenic
1178155598 21:29850131-29850153 CAGCAAATGTTAATGCAGTAAGG - Intronic
1178456924 21:32763660-32763682 CAGAAAAGTAAAAAGGAGTGTGG + Intronic
1181824244 22:25501414-25501436 CAGAAAATTTAAATAGATTTGGG - Intergenic
1182510563 22:30817029-30817051 CAGAAAATTGAAATGGGGGCTGG - Intronic
1183224664 22:36541341-36541363 CAGAAAAATTAAAGGGTTTATGG + Intergenic
1183844856 22:40534290-40534312 CAGATATTTTAATTGGAGTGGGG - Intronic
1203294807 22_KI270736v1_random:31864-31886 CAGAAAAATAAAATGTGGTAAGG + Intergenic
1203294982 22_KI270736v1_random:33270-33292 CAGAAAAATAAAATGTGGTAAGG + Intergenic
950686052 3:14619391-14619413 CAGCAGATTTAACTGGAGTGGGG + Intergenic
951147349 3:19243606-19243628 AACAAAACTTAAATGGAGAAAGG + Intronic
951831597 3:26934994-26935016 AGGAAAATTTAGATGGATTAAGG + Intergenic
951915285 3:27794286-27794308 CAGATAATATAATTGGAATATGG - Intergenic
952207115 3:31191278-31191300 TTGAAAATTCAAATGCAGTAAGG - Intergenic
952498279 3:33935247-33935269 AAGAAGATTAAAGTGGAGTAAGG - Intergenic
952710188 3:36423313-36423335 AAGAAAATTAAAATGGATTTTGG + Intronic
952971312 3:38651936-38651958 CAAAAAATTTAAATAGGGTCTGG - Intergenic
952975525 3:38691964-38691986 CATTAAATTTAAATGGACTCTGG - Intergenic
953164234 3:40450245-40450267 CAGAAAAATAAAAAGGAGGATGG - Intergenic
955118789 3:56034315-56034337 CAGAACATTTAAATATATTAAGG + Intronic
955465433 3:59231992-59232014 CAGAAAAATAAAATAGGGTAAGG + Intergenic
955499791 3:59572484-59572506 AAGAAAATTTAAATACAGTTAGG - Intergenic
955585481 3:60472912-60472934 CAGAAAACTTAAATGAATAATGG - Intronic
955736345 3:62042414-62042436 CAGAAAATCTAAATTCAGAAGGG - Intronic
955999952 3:64718996-64719018 TAATAAATTTAAATGGAGTCGGG - Intergenic
956087866 3:65632409-65632431 AAGAAAATTAATTTGGAGTATGG + Intronic
956648388 3:71479766-71479788 CAGAAAAATTATAAGGATTAAGG + Intronic
957677717 3:83392200-83392222 CAGAGAATTTAAAAGGAAAAAGG + Intergenic
957695044 3:83625135-83625157 CAGAAAAGCTAACTGGACTAAGG + Intergenic
957716564 3:83935994-83936016 CAGCAAATTTAAATGGGGCAGGG + Intergenic
957795255 3:84996211-84996233 CTCAAAATATAAATTGAGTATGG + Intronic
957890187 3:86346598-86346620 CAGAAAACTAAAATGGAGAAAGG + Intergenic
958022394 3:88013521-88013543 CAGAAAATTTTTATGGATAATGG + Intergenic
958147339 3:89642819-89642841 TAAAAAATTAAAATGGATTAAGG + Intergenic
958778437 3:98512824-98512846 CAGATATTTTAAAAGGTGTACGG + Intronic
958884107 3:99707077-99707099 CAGAAAAGTGAAATGCAGTATGG + Intronic
959547818 3:107618054-107618076 AAGAAAACTTAAATGAAGTTAGG - Intronic
960562917 3:119105379-119105401 CAGAAACTTTAATAGGAGAATGG + Intronic
961328075 3:126122432-126122454 AATAAAACTTAAATGGAGTAAGG + Intronic
961496967 3:127300566-127300588 AAGAAAATCTGAATGGAGTATGG - Intergenic
961999979 3:131285587-131285609 CAGAAAACTGAAATGGAGCTGGG - Intronic
962174687 3:133140772-133140794 CAGAAAATTAAAATGAAGTCTGG + Intronic
964132044 3:153300304-153300326 CAAAGAAATTAAATGGAGGAAGG + Intergenic
965242715 3:166224368-166224390 AAGAAAATTAAAATGTGGTATGG + Intergenic
965681136 3:171252886-171252908 CAGAAAATTTAAATGGAGTAGGG + Intronic
967290176 3:187911895-187911917 CAGTAAATTGAAATGGAGGCAGG + Intergenic
967543848 3:190700269-190700291 AAGAAAATTAAAATGTAGGAAGG - Intergenic
967879248 3:194287613-194287635 CAGAAAAATTAACTGCATTATGG - Intergenic
968013600 3:195304976-195304998 CAGAACACTTGAATGGAGTTGGG - Intronic
968025249 3:195436934-195436956 CAGAAAAATATAATGGGGTAGGG + Intronic
970028670 4:11652983-11653005 CACAAAAAGTAACTGGAGTAAGG + Intergenic
970991492 4:22218341-22218363 GAGTAAAGTTAAATTGAGTAAGG - Intergenic
972370385 4:38418258-38418280 CAGAATATTTACATGTAGTAAGG - Intergenic
977145256 4:93431664-93431686 CAGAAATTTTAGATGGAGAGGGG + Intronic
977550945 4:98443082-98443104 CATAAGATTTAAAAGGACTATGG - Intronic
977782877 4:100998654-100998676 CAGAAAATTTTAGTTGAATAGGG + Intergenic
977822094 4:101485056-101485078 CTCAAAATTTATATGGAATAGGG + Intronic
978631809 4:110756299-110756321 CAGAAACTTGAAACGTAGTAAGG + Intergenic
978737387 4:112099332-112099354 CAGAAAATTTCCATAGAGAAAGG + Intergenic
979353856 4:119679093-119679115 CAGCAAATATAAATGGACAAAGG + Intergenic
980145344 4:128976578-128976600 CTGAAAGTTTAAATTGGGTAAGG - Intronic
980145471 4:128978301-128978323 CTGAAAGTTTAAATTGGGTAGGG + Intronic
980292948 4:130869306-130869328 CAGAAATTTGAATTAGAGTAGGG - Intergenic
981759267 4:148175332-148175354 CAGTAAATCTGAATGGAGCACGG - Intronic
982226678 4:153173346-153173368 AAGAAAATTTAAATAGAGGTAGG - Intronic
982844698 4:160235338-160235360 TAGACAATTGAAATAGAGTAGGG + Intergenic
983338904 4:166432248-166432270 CAGAAATTTCAAAATGAGTAGGG - Intergenic
983720568 4:170846590-170846612 CAGAAAATGAAAATGTAATAGGG - Intergenic
984315613 4:178127673-178127695 CAGAAAATTTGAATGCAATTTGG + Intergenic
984439901 4:179754261-179754283 CATAAAATTTGAATGGAATTAGG - Intergenic
984582999 4:181532227-181532249 AAGAAGATCTAAATGGAGGAGGG + Intergenic
984845573 4:184105299-184105321 AAGAAAATTTAAAAGGATGATGG + Intronic
985038359 4:185863691-185863713 CAGAAACTGTAATTGGAGTGTGG + Intronic
988191124 5:27936324-27936346 GAGATAATTTTAATGAAGTAAGG + Intergenic
988222571 5:28368308-28368330 CAAAAAAATTAAATGGTGTGAGG + Intergenic
989278745 5:39618159-39618181 AAGAAAATATAAAAAGAGTATGG - Intergenic
990547421 5:56836877-56836899 TACAAAATTCAAATGGATTAAGG - Intronic
991164354 5:63545924-63545946 GATGAAATTTAAATGGAATAAGG - Intergenic
991255164 5:64605311-64605333 CAGAAAATTTAGAATGAGTGGGG + Intronic
991497397 5:67240380-67240402 CAGTAAATTTAAATGTACTTAGG - Intergenic
992501944 5:77351705-77351727 CACAAAATTTAACTGGAGGAAGG - Intronic
993086638 5:83371018-83371040 CTGAAAATGTCACTGGAGTAAGG - Intergenic
993360461 5:86968493-86968515 CCAAAAATTTAAATGGCCTAAGG + Intergenic
993408299 5:87540817-87540839 GAGAAAATTTAAATGGAATGAGG - Intergenic
993510615 5:88767138-88767160 AATAAATTTTAAATGAAGTAAGG - Intronic
995269178 5:110201790-110201812 CATAATATTTAACTGGAGAAAGG + Intergenic
995364712 5:111345409-111345431 CATAAAATTTATCTGAAGTAAGG + Intronic
995514384 5:112939521-112939543 CAGGAATTTTAAATGAAATATGG + Intergenic
995770730 5:115666072-115666094 CAGAAAAATTATCTGGATTATGG - Intergenic
996679045 5:126210250-126210272 CAAAAATTTTAAATGCAATAAGG + Intergenic
998232660 5:140371243-140371265 CAGAAAAGAAAAAAGGAGTAGGG - Intronic
998800189 5:145861337-145861359 CAAAAAATTTAAATCGGCTAAGG - Intronic
998800236 5:145861569-145861591 CAGGAACTTTCACTGGAGTATGG - Intronic
999820963 5:155228161-155228183 CTGAAAATTTAAAAGTTGTATGG - Intergenic
999982307 5:156969341-156969363 AAGAAAATATAAATAAAGTATGG + Intergenic
1000280724 5:159779712-159779734 CAGTAAATTTAAATAGAATTGGG + Intergenic
1000464186 5:161554742-161554764 GAGAAAATTTAAATAAAGAAAGG - Intronic
1002622494 5:180498235-180498257 AAGAAAATATAAATGGATGAAGG - Intronic
1002642876 5:180638879-180638901 CAGTAAGTTTCAATGGGGTAAGG + Intronic
1002672182 5:180876638-180876660 CAGTAAATTTTAAAGGGGTATGG + Intergenic
1002688790 5:181036517-181036539 GAGAAAATGAAAATGCAGTAAGG + Intergenic
1003984513 6:11421701-11421723 CAAAAACATTAAATGGAGAAGGG + Intergenic
1004009918 6:11674483-11674505 AAGGAAATTTCAATGAAGTATGG - Intergenic
1004040885 6:11973983-11974005 AAGAAAATTAAAATGCAGGATGG + Intergenic
1004592020 6:17060993-17061015 CATAGAATGTACATGGAGTAAGG - Intergenic
1005255752 6:24001322-24001344 CAGACAATTAAAATTGAGTAAGG - Intergenic
1008021051 6:46577598-46577620 CAGAAAATAAAAAAAGAGTAGGG + Intronic
1008392238 6:50965744-50965766 AAGGAAATTCTAATGGAGTATGG + Intergenic
1008456391 6:51715902-51715924 AAGGAAATTCAAATGGAGTCCGG + Intronic
1008730730 6:54479779-54479801 CATAAAATTTAAATAGGTTATGG - Intergenic
1009705222 6:67240675-67240697 CAGAAAAGTTCAAAGGAGGAGGG + Intergenic
1009747202 6:67832569-67832591 AAGAAAATGGAAATGGGGTATGG + Intergenic
1010058022 6:71588370-71588392 CAGGAAATTTTAATAAAGTAAGG + Intergenic
1010279170 6:74004055-74004077 CAGTAAATTATAATGGAGGATGG - Intergenic
1011312723 6:85998234-85998256 CAGAAAAATAAAATGAAGGAAGG + Intergenic
1011609313 6:89134795-89134817 CAGAAAATTGTAAGGGAGAAAGG + Intergenic
1014963810 6:127721472-127721494 CAGATAATTAAAATAGAGTGTGG + Intronic
1015187055 6:130429760-130429782 CAGAAAATTTCAATTGTATATGG - Intronic
1016141667 6:140620108-140620130 CAGGAAATCTAAATAAAGTATGG - Intergenic
1016324393 6:142882959-142882981 CAGACTATTTGAATGTAGTATGG - Intronic
1016439935 6:144072955-144072977 GAGAAAATTTGAATACAGTATGG - Intergenic
1016626825 6:146179991-146180013 GAAAAAAATTAACTGGAGTATGG + Intronic
1019120972 6:169803042-169803064 CAGAAAATGGAAATGAGGTACGG + Intergenic
1020459699 7:8414890-8414912 CATACAATTTAAATGAATTAAGG - Intergenic
1020484307 7:8702836-8702858 CAGAAAAGTTTCATGGAGTCAGG - Intronic
1020653256 7:10900391-10900413 GAGAAAAATTAAGTGGAGAAGGG - Intergenic
1021075035 7:16292578-16292600 GAGAAAATTTAAAAGGAGTCTGG - Intronic
1021436471 7:20623109-20623131 CAGAAACTTCAATTGGAGTGGGG + Intronic
1021723013 7:23522320-23522342 CAGAAAATTAAAATTGAATGGGG - Intronic
1023298137 7:38737987-38738009 CAGAAAAATAAAAGGGAGCAGGG - Intronic
1024979101 7:55142474-55142496 GAGAAAATCTAAGTGGAGAAAGG + Intronic
1025732531 7:64119178-64119200 CAAAAAATTTAAAATGAGTTGGG + Intronic
1025822788 7:64985629-64985651 CATAAAATTTAAATGCTTTAAGG + Intronic
1026484937 7:70809576-70809598 CAGGAAATTCAAATGGATTTAGG + Intergenic
1027561562 7:79738490-79738512 CATAAATTTTAAATGGAAAATGG + Intergenic
1027700106 7:81459201-81459223 TATAATATCTAAATGGAGTAGGG + Intergenic
1028008275 7:85606672-85606694 CAGAAAATTCAAATTTAGTATGG - Intergenic
1029908849 7:104122169-104122191 AAGAAAAATGAAATGGATTACGG + Intergenic
1030301681 7:107980515-107980537 CAGAAAATGTAAAAGGCTTAAGG + Intronic
1030752496 7:113246107-113246129 AAGAAAATTTGAATAAAGTATGG + Intergenic
1030818268 7:114063695-114063717 CATAACATTTAAATGTAGAATGG - Intronic
1030886201 7:114941023-114941045 CAGATGATTCCAATGGAGTATGG - Intronic
1031092881 7:117382563-117382585 AAGTAACTTTAAATGGGGTAAGG + Intronic
1031295736 7:120000933-120000955 AATAAAAATTAAATGGAGAAAGG - Intergenic
1032967048 7:137109864-137109886 CTGAAAATTTAAATTTAGTTTGG + Intergenic
1033333584 7:140434612-140434634 TAGAATTTTTAAATGGAATAAGG - Intergenic
1034007364 7:147488807-147488829 CAAATAATTTAAATGGCCTAGGG - Intronic
1034189732 7:149204813-149204835 CAGAGAATTAAAATGAAGAAAGG + Intronic
1038076444 8:24080432-24080454 CAGAAAATGTAAAAGGAGTGAGG - Intergenic
1038428762 8:27483154-27483176 CAGAAAGTTGAAGTGGAGTTTGG - Intergenic
1038695543 8:29803330-29803352 CAGAAAATTTGAGGAGAGTAGGG + Intergenic
1040775208 8:51034785-51034807 CAGACAATTTTAATAGAGTGTGG - Intergenic
1041040892 8:53844760-53844782 CAGACAATTTGCCTGGAGTAGGG + Intergenic
1041699118 8:60768186-60768208 TCGAAAATGAAAATGGAGTAAGG - Intronic
1041835171 8:62204079-62204101 CAGATACTTTAAAGGGAGTATGG - Intergenic
1042401447 8:68353071-68353093 CAGAAGTTTAAAATAGAGTAGGG + Intronic
1043022123 8:75016031-75016053 CAGAAATTTAAACTTGAGTATGG - Intronic
1043262732 8:78222120-78222142 TAGAAAAATTAAAAGGAATAGGG + Intergenic
1043823195 8:84893778-84893800 CAAAACATTTAAATGGATTAAGG + Intronic
1045352948 8:101359280-101359302 CAGAAAATTTAGAGGCAGTTGGG + Intergenic
1045712883 8:105006436-105006458 AAGAAAATTTAAATGTAAAAAGG + Intronic
1046320014 8:112560955-112560977 CAGAAAATTCAAATTAAGGAAGG - Intronic
1046362545 8:113181771-113181793 CAGAAACTTTAATGTGAGTATGG - Intronic
1046755858 8:117972193-117972215 CAGAAAAATGAAATGGAATTGGG + Intronic
1047556352 8:125935214-125935236 CAGAATATTTAACTGTAGAAAGG - Intergenic
1047658722 8:127008912-127008934 CAGAGAATTTGAATGGACTAGGG - Intergenic
1049459280 8:142716035-142716057 CACAAAATTTAAAAAGAGAATGG + Intergenic
1050058365 9:1679195-1679217 CAAGAACATTAAATGGAGTAAGG - Intergenic
1051577161 9:18629839-18629861 CAGAAAATTTCACTGGGGCATGG - Intronic
1052012197 9:23423625-23423647 CATAAAATTTAAATGAGGTAAGG - Intergenic
1052473617 9:28930714-28930736 GAGAAAATTAAAATGGAGGGAGG + Intergenic
1052741318 9:32395495-32395517 CAAAAAACTTAGATGCAGTAGGG + Intronic
1053041582 9:34878184-34878206 CAGAAAAATTGAGTGGAGTATGG - Intergenic
1053334001 9:37247408-37247430 AAGAACACTTAAATGCAGTAAGG - Intronic
1053603883 9:39637412-39637434 CAGAACAATTAAAAGGACTAAGG + Intergenic
1053861700 9:42393459-42393481 CAGAACAATTAAAAGGACTAAGG + Intergenic
1054249658 9:62705002-62705024 CAGAACAATTAAAAGGACTAAGG - Intergenic
1054563768 9:66739534-66739556 CAGAACAATTAAAAGGACTAAGG - Intergenic
1055169283 9:73235525-73235547 CATATAATTTAAATTGAGTTAGG + Intergenic
1055569063 9:77598128-77598150 CAAAAAGTCTAAATGGACTAAGG - Intronic
1056000255 9:82208581-82208603 CAAAAAATTTAAATGCAGGAAGG - Intergenic
1056412161 9:86340352-86340374 CAGAAAATTCAAATGTTATATGG + Intronic
1056451945 9:86724858-86724880 AAGAAAATTTGAATTAAGTATGG + Intergenic
1058460882 9:105181526-105181548 GAGGAAATTTGAATGAAGTATGG + Intergenic
1058751171 9:108039696-108039718 CAGAAAATTTGAGTGAAGTTAGG - Intergenic
1058901814 9:109448530-109448552 GAGAAATTTTAAAGGGAGGAGGG - Intronic
1059369767 9:113818128-113818150 CAGAATTTTAAAATGCAGTAGGG + Intergenic
1059634986 9:116161464-116161486 CACACAATTTAAGTGGAATAAGG - Intronic
1060573267 9:124663705-124663727 TTTAAAATTTAAATGGAGAATGG - Intronic
1062684826 9:137806385-137806407 CAGAAAAGGTAAAGGGAGTGAGG - Intronic
1188316949 X:28687181-28687203 AAGAAAAATAAAATGGAATATGG - Intronic
1189460070 X:41233909-41233931 CAAAATATTTAAATAGAATAGGG - Exonic
1189644886 X:43117359-43117381 AAGAAAATCTAAATGAAGTATGG - Intergenic
1189688598 X:43591978-43592000 CAGAAAACATAAATGGTGTTTGG + Intergenic
1190569510 X:51767281-51767303 CAGAAAATTTCATGGGACTAGGG - Intergenic
1190739927 X:53281851-53281873 CAGAAAATTGAGATGGAGAGAGG + Intronic
1192292332 X:69810898-69810920 CTGGACATTTAAAAGGAGTAAGG + Intronic
1193191540 X:78577097-78577119 CAAAATATTTGAATGGATTATGG + Intergenic
1194217785 X:91152138-91152160 AAAAAAATTTAAAAGGAGTGTGG - Intergenic
1194284275 X:91990569-91990591 CAGAAAATTTAAATGAAGTTTGG - Intronic
1194568875 X:95528201-95528223 CATTAAATTCAAATGGATTAAGG + Intergenic
1194832742 X:98644924-98644946 GAGAAAATTTAAATTTAGCAAGG + Intergenic
1196214056 X:113029391-113029413 CATAAAATTTATATGGAATCCGG - Intergenic
1196260096 X:113569030-113569052 GATAAAATTTAAATGGGGGAAGG - Intergenic
1196305701 X:114100313-114100335 CAGCAAATATAGTTGGAGTAGGG + Intergenic
1196685302 X:118505484-118505506 CAGAAAAGTTAACTGGAAGAGGG + Intronic
1197140559 X:123113255-123113277 CTGAAAATTTAAATGGATATGGG - Intergenic
1197140597 X:123113698-123113720 CTGAAAATTTAAGTGGATTTGGG + Intergenic
1197449888 X:126599303-126599325 CAGAAAATTAAAATCATGTAGGG + Intergenic
1197830329 X:130635135-130635157 CAGAGATTTTAAATGAAGTGTGG - Intronic
1197837244 X:130708565-130708587 CAGAAAAATATAATGTAGTAAGG - Intronic
1198488581 X:137114211-137114233 CAGAAAAACTAAATGGCGAAAGG - Intergenic
1199764085 X:150928105-150928127 TAGAAACTTTAGAGGGAGTACGG - Intergenic
1200554293 Y:4615934-4615956 AAAAAAATTTAAAAGGAGTGTGG - Intergenic
1200601843 Y:5215128-5215150 CAGAAAATTTAAATGAAGTTTGG - Intronic
1200860706 Y:7988794-7988816 CAGCAAATGGAAATGCAGTATGG + Intergenic
1201725019 Y:17141567-17141589 CACTAATTTTAAATTGAGTAAGG - Intergenic
1202274499 Y:23101682-23101704 AAGAAAAATAAAATGGAGTTGGG + Intergenic
1202291528 Y:23319004-23319026 AAGAAAAATAAAATGGAGTTGGG - Intergenic
1202427492 Y:24735417-24735439 AAGAAAAATAAAATGGAGTTGGG + Intergenic
1202443299 Y:24934677-24934699 AAGAAAAATAAAATGGAGTTGGG - Intergenic