ID: 965683189

View in Genome Browser
Species Human (GRCh38)
Location 3:171273225-171273247
Sequence AGGTGGGTCCCTGTAGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 309}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965683189_965683197 11 Left 965683189 3:171273225-171273247 CCTGGAGCTACAGGGACCCACCT 0: 1
1: 0
2: 1
3: 10
4: 309
Right 965683197 3:171273259-171273281 GAGTCTGGAGGTTCAATCTGTGG 0: 1
1: 0
2: 1
3: 15
4: 162
965683189_965683199 30 Left 965683189 3:171273225-171273247 CCTGGAGCTACAGGGACCCACCT 0: 1
1: 0
2: 1
3: 10
4: 309
Right 965683199 3:171273278-171273300 GTGGGTACCAGCCATAGTCTTGG 0: 1
1: 0
2: 0
3: 4
4: 80
965683189_965683198 12 Left 965683189 3:171273225-171273247 CCTGGAGCTACAGGGACCCACCT 0: 1
1: 0
2: 1
3: 10
4: 309
Right 965683198 3:171273260-171273282 AGTCTGGAGGTTCAATCTGTGGG 0: 1
1: 0
2: 0
3: 12
4: 114
965683189_965683193 -4 Left 965683189 3:171273225-171273247 CCTGGAGCTACAGGGACCCACCT 0: 1
1: 0
2: 1
3: 10
4: 309
Right 965683193 3:171273244-171273266 ACCTGATGCCAAGGTGAGTCTGG 0: 1
1: 0
2: 1
3: 14
4: 139
965683189_965683195 -1 Left 965683189 3:171273225-171273247 CCTGGAGCTACAGGGACCCACCT 0: 1
1: 0
2: 1
3: 10
4: 309
Right 965683195 3:171273247-171273269 TGATGCCAAGGTGAGTCTGGAGG 0: 1
1: 0
2: 3
3: 10
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965683189 Original CRISPR AGGTGGGTCCCTGTAGCTCC AGG (reversed) Intronic
900144014 1:1150269-1150291 AGGTGGGTCCCAGCACCTGCAGG + Intergenic
904352526 1:29918067-29918089 ACCTGGGTGCCTGAAGCTCCAGG + Intergenic
905368009 1:37466089-37466111 AGGTGGCTGCCAGAAGCTCCTGG + Intergenic
905414461 1:37794658-37794680 AGCTGGGGCCCTACAGCTCCCGG + Exonic
905752652 1:40479222-40479244 TGGTGTGTCCCTGCAGCACCAGG - Exonic
906174329 1:43757035-43757057 TGGTGGGTGCCTGTAGTCCCAGG - Intronic
906197765 1:43939469-43939491 AGGTGGCACATTGTAGCTCCTGG + Intergenic
907622928 1:56000491-56000513 AGGTGAGCCCCTGGAGCTCTCGG - Intergenic
909562993 1:77025816-77025838 AGCTGGGGCCCTGTAGCTGCAGG - Intronic
909804595 1:79858694-79858716 GGGTGGGAGCCTGTAACTCCTGG + Intergenic
915837932 1:159192789-159192811 AGATGGGTCCCTGAAGCAGCTGG + Intronic
916081036 1:161232428-161232450 TGGTGGGTGCCTGTAGTCCCAGG - Intronic
919655303 1:200191831-200191853 AGGTGGGTGCCTGTAATCCCAGG + Intergenic
921061522 1:211589256-211589278 AGCTGGCTCCCTGTAGTTCAGGG - Intergenic
921248006 1:213266768-213266790 TGGTGGGTGCCTGTAGTCCCAGG + Intronic
921349509 1:214221411-214221433 TGGTGGGCGCCTGTAGTTCCAGG - Intergenic
922595728 1:226811311-226811333 AGATGGGGCACTGGAGCTCCTGG - Intergenic
922795926 1:228339828-228339850 GGCTGGGGCCCTGTGGCTCCTGG - Intronic
924461808 1:244266299-244266321 AGCTGGGTCCCTCTGGCTCAGGG - Intergenic
1064823692 10:19370708-19370730 TGGTGTGTCCCTGTAGTTTCAGG - Intronic
1065351977 10:24803993-24804015 TGGTGGGTGCCTGTAATTCCAGG - Intergenic
1066165887 10:32788178-32788200 AGGTCAGCCCCAGTAGCTCCAGG + Intronic
1066295907 10:34054374-34054396 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
1066958762 10:42200293-42200315 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
1067844731 10:49710718-49710740 GGGTGGCTCCCTGCAGCTCCTGG + Intergenic
1069432431 10:68349669-68349691 TGGTGGGTGCCTGTAGTCCCAGG - Intronic
1070432185 10:76351897-76351919 AGGTGGGTGCCAGTACCTCTAGG + Intronic
1072913090 10:99520949-99520971 AGGAGGTTCCCTGAAGCCCCTGG + Intergenic
1073232233 10:101981884-101981906 TGGTGGGTGCCTGTAGTCCCAGG + Intronic
1074311984 10:112329988-112330010 TGGTGGGTGCCTGTAATTCCAGG + Intergenic
1075442876 10:122493777-122493799 AGGTGGGGCCCTCAAGGTCCTGG - Intronic
1075684777 10:124355868-124355890 TGGTGGGCGCCTGTAACTCCAGG + Intergenic
1075823779 10:125336391-125336413 ATGTGGGTCTCTGTGGCTGCAGG - Intergenic
1076368249 10:129935922-129935944 AGGAGGGGCCCTGGTGCTCCAGG - Intronic
1076887797 10:133270565-133270587 AGGTGGGTCACTGTGGCTCCTGG - Intronic
1077141951 11:1028625-1028647 AGGTGAGTCCCTGCCTCTCCAGG - Exonic
1077273950 11:1694610-1694632 AGGTGGCTCCACGTGGCTCCGGG - Intergenic
1077574136 11:3366930-3366952 CGGTGTGCCCCTGTAGTTCCAGG + Intronic
1079209277 11:18446770-18446792 AGATGGGTCACAGTAGCTGCAGG + Intronic
1079631846 11:22687192-22687214 TGGTGTGTTCCTGTAGCCCCAGG + Intronic
1080188602 11:29520493-29520515 AGAGGGGTCCCTGTATTTCCTGG - Intergenic
1080384741 11:31804651-31804673 AGGTGGGGCTCTGTAGCTGGAGG - Intronic
1082769915 11:57199842-57199864 AGGTGGGACCCTCTAGTTGCAGG + Intergenic
1083211342 11:61189014-61189036 TGGTGTGTGCCTGTAGTTCCAGG - Intergenic
1083469464 11:62873353-62873375 TGGTGGGCCCCTGTAGTCCCAGG + Intronic
1084043238 11:66554814-66554836 AGGAGGGTTCCAGTAACTCCTGG + Intronic
1084051353 11:66602237-66602259 AGCTGGGTGCCTGCAGCTCAGGG + Intronic
1085689947 11:78656638-78656660 AGGTGGGTGCCCGTAGATCTGGG - Exonic
1086171595 11:83842681-83842703 TGGCGGGTGCCTGTAGCCCCAGG + Intronic
1086458037 11:86978500-86978522 AGGTGGCTCCCATTAGCTCAAGG + Intergenic
1086507705 11:87523075-87523097 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
1088523857 11:110730121-110730143 TGGTGGGTGCCTGTAACTCCAGG + Intergenic
1088869233 11:113876998-113877020 AAGCGGATCCCTGTATCTCCAGG - Intergenic
1090295490 11:125584133-125584155 AGGAGTGTCCCAGTTGCTCCTGG + Exonic
1091409061 12:227397-227419 AGTTGGCTCCTTGCAGCTCCTGG + Intronic
1091997839 12:5009000-5009022 GGTTGTGTCCCTGTAGATCCAGG + Intergenic
1092638286 12:10475868-10475890 TGGTGGGTGCCTGTAGTCCCAGG - Intergenic
1093329082 12:17813166-17813188 AAGCTGGTCCCTGTAGATCCAGG + Intergenic
1093569984 12:20655653-20655675 AGGTGGGACTCTGTAGGTCACGG + Intronic
1094749991 12:33394953-33394975 TGGTGGGTGCCTGTAGTCCCAGG + Intronic
1094841643 12:34344877-34344899 ACGTGGGGCCCAGCAGCTCCAGG + Intergenic
1095084379 12:38045623-38045645 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
1095931987 12:47636723-47636745 AGGAGGGTCCCTGTGGTTCCAGG - Intergenic
1098390727 12:69967158-69967180 AGGTGGTTCTCAGAAGCTCCAGG - Intergenic
1099877821 12:88431089-88431111 TGGTGGGTGCCTGTAGTCCCAGG - Intergenic
1101259826 12:103017712-103017734 AGGTGGGCACCACTAGCTCCAGG + Intergenic
1101937106 12:109067244-109067266 TGGTGGGTGCCTGTAGTCCCAGG - Intronic
1102154328 12:110712505-110712527 TGGTGGGTGCCTGTAATTCCAGG + Intergenic
1104154878 12:126121628-126121650 TGGTGGGCACCTGTAGTTCCAGG + Intergenic
1104941240 12:132396359-132396381 GGCTGGGTCCCTGGAGATCCAGG - Intergenic
1107804370 13:44140553-44140575 AGTTGGGACCGTGTAGCTGCAGG + Intergenic
1107848617 13:44546901-44546923 TGGTGTGTCCCTGTAGTCCCAGG - Intronic
1111928006 13:94483632-94483654 TGGTGGGTGCCTGTAGTCCCAGG - Intergenic
1113727280 13:112614668-112614690 AGGTGGGTCTCTGTGACCCCAGG - Intergenic
1113986270 13:114318548-114318570 AGGTGGATCCCTTGAGCTCAGGG - Intronic
1114524672 14:23360166-23360188 AGCTGGGTCCCACTAGCTCTGGG + Exonic
1115446332 14:33494570-33494592 GTCTGGGTCCCTGTAGATCCAGG - Intronic
1115600755 14:34953650-34953672 TGGTGGGTGCCTGTAGTCCCAGG - Intergenic
1116372552 14:44154598-44154620 AGGTTGGCCCCTGTAGGACCAGG + Intergenic
1116728109 14:48588260-48588282 CGGTGGGTTCCTGTAAATCCCGG - Intergenic
1116805769 14:49492769-49492791 AGCTGCGGCCCTGAAGCTCCAGG - Intergenic
1117434549 14:55703562-55703584 TGGTGGGTGCCTGTAGTCCCAGG - Intergenic
1118156621 14:63248849-63248871 AGATGGCTCCCAGCAGCTCCTGG + Intronic
1118163556 14:63314543-63314565 TGGTGGGTGCCTGTAGTCCCGGG - Intronic
1121211123 14:92208485-92208507 AGGTGGGTCAGTGAAGCTCAAGG - Intergenic
1122264732 14:100541311-100541333 AGGTGGGTCACTGGGCCTCCGGG - Intronic
1122862799 14:104590050-104590072 GGGTGTGTCCCTGCAACTCCAGG + Intronic
1125017840 15:34954988-34955010 TGGTGTGTGCCTGTAGTTCCAGG + Intronic
1126362452 15:47860492-47860514 GGGTGGGTCCCTGCTTCTCCAGG - Intergenic
1127529823 15:59832926-59832948 TGGTGTGTGCCTATAGCTCCAGG + Intergenic
1128136194 15:65265428-65265450 AAGTAAGTCTCTGTAGCTCCAGG + Intronic
1128150174 15:65358236-65358258 TGGTGGGTGCCTGTAGTCCCAGG - Intronic
1128502616 15:68237988-68238010 TGGTGGGTGCCTGTAGTCCCAGG + Intronic
1129294642 15:74593235-74593257 AGGTGAGGCCCTGGAGCTCTGGG + Exonic
1129446196 15:75620159-75620181 AGATGGTTCCCTGTGGCTCTGGG - Intronic
1129677365 15:77639193-77639215 AGCTGGGTACCTCTAGCTCAGGG - Intronic
1129696239 15:77742043-77742065 GGATGGGTCCATGGAGCTCCTGG - Intronic
1130801532 15:87268771-87268793 AGAGGGGTCCCCTTAGCTCCAGG + Intergenic
1132067851 15:98747327-98747349 CGGTGGGTGCCTGTAATTCCAGG - Intronic
1132881110 16:2162100-2162122 AGGTGGGGCCAGGTAGCTCGTGG + Intronic
1134105606 16:11484138-11484160 TGGTGGGTGCCTGTAGTCCCAGG - Intronic
1135668676 16:24356567-24356589 TGGTGGGTGCCTATAGTTCCAGG + Intronic
1135981769 16:27153355-27153377 AGATGGCTCCAGGTAGCTCCAGG - Intergenic
1136050100 16:27644152-27644174 TGGTGTGTGCCTGTAGTTCCAGG - Intronic
1138003809 16:53311051-53311073 TGGTGTGCCCCTGTAGTTCCAGG + Intronic
1138061570 16:53896804-53896826 TTGTGAGTCCCTTTAGCTCCTGG - Intronic
1138410530 16:56835994-56836016 TGGTGGGTACCTGTAGTCCCAGG + Intronic
1138588916 16:57988805-57988827 CTGTGGGTCCCTGAAGCCCCAGG - Intergenic
1138688962 16:58750084-58750106 TGGTGGGTGCCTGTAGTCCCAGG - Intergenic
1139292000 16:65867663-65867685 ATGTGGCTCCCTGAGGCTCCTGG - Intergenic
1140116378 16:72045006-72045028 CCGTGGGACCCTGTAGCCCCTGG + Intronic
1140336426 16:74109200-74109222 AAGTGGTTCCCAGAAGCTCCAGG - Intergenic
1140714731 16:77712135-77712157 TGATGGGCCCCTGTAGCTGCTGG - Intergenic
1141190539 16:81821543-81821565 AGGTGGGTCCTGGGGGCTCCTGG + Intronic
1142880174 17:2877863-2877885 TGGAAGGTCCCTGTAGCTCCTGG + Intronic
1143681834 17:8481478-8481500 AGCAAGGTCGCTGTAGCTCCAGG - Intronic
1144637400 17:16919010-16919032 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
1144722731 17:17483493-17483515 AGGTGGGTCCCTGGGGGTACAGG - Intronic
1146024007 17:29303818-29303840 AGCTGGGTGCCTCTAGCTCAGGG + Intergenic
1146325674 17:31883893-31883915 AGGTGGATCCCTTGAGCTCAGGG - Intronic
1147743458 17:42681560-42681582 AGGTGGGACCCTGGACCTCTAGG + Intronic
1149445576 17:56710772-56710794 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1151268025 17:72971633-72971655 AGGCGGGTCTCAGCAGCTCCTGG + Intronic
1152337404 17:79706567-79706589 GGGTGGGTGACTGTAGCCCCTGG - Intergenic
1155776481 18:29768176-29768198 TGGCGGGTGCCTGTAGCCCCAGG - Intergenic
1157256371 18:46143296-46143318 TGGTGGGTGCCTGTAGTCCCAGG - Intergenic
1157551912 18:48588126-48588148 AGGAGGGTCCCAGTAATTCCCGG - Intronic
1158452919 18:57582788-57582810 TGGCGGGTGCCTGTAGTTCCAGG + Intronic
1158667832 18:59448941-59448963 AGGTGGGTACCTGTGGCCCTGGG + Intronic
1159050948 18:63420903-63420925 TGGTGGGTGCCTGTAGTCCCAGG + Intronic
1159069903 18:63612025-63612047 AGGTGGGTGCCTACGGCTCCAGG + Intergenic
1159285507 18:66344364-66344386 TGGTGCGTGCCTGTAGTTCCAGG - Intergenic
1160850318 19:1188172-1188194 TGGTGGGCGCCTGTAGTTCCAGG - Intronic
1160862872 19:1245082-1245104 AGGGGTGTCCCTGCTGCTCCTGG + Intergenic
1161777127 19:6269706-6269728 ACGGGGGTCCCGGGAGCTCCAGG - Intronic
1162750288 19:12825560-12825582 GGGTGGGTCTCTGGAGCTCCAGG + Exonic
1162989834 19:14294777-14294799 TGGTGGGCGCCTGTAGTTCCAGG + Intergenic
1163380885 19:16967674-16967696 TGGTGGGTGCCTGTAGTCCCAGG + Intronic
1163697448 19:18771247-18771269 AGGTGGGTACCTGAGCCTCCGGG - Intronic
1164875678 19:31685124-31685146 AGGAGGATCCCTGTGGCTGCTGG - Intergenic
1165012438 19:32858625-32858647 AGGTGGGTCCCTGGGTCCCCTGG - Intronic
1165527195 19:36366133-36366155 TGGTGGGCGCCTGTAACTCCAGG + Intronic
1165697976 19:37915512-37915534 CGGTGGGCGCCTGTAACTCCAGG - Intronic
1166760574 19:45221778-45221800 TGGTGGGTGCCTGTAGTCCCAGG - Intronic
1167409211 19:49335179-49335201 AGGTGGGTTCCAGTAGATCAGGG + Intronic
1168061593 19:53895925-53895947 TGGTGGGTGCCTGTAGTCCCAGG + Intronic
1168212628 19:54901592-54901614 AGGCGGATCACTGGAGCTCCTGG + Intergenic
1168599039 19:57703351-57703373 TGGTGGGTGCCTGTAGTCCCAGG + Intronic
926035407 2:9631687-9631709 AGGTAGGTCCCAGAAGATCCAGG + Intergenic
926148821 2:10413215-10413237 AGGAAGGTCCCTGGGGCTCCTGG + Intronic
926277626 2:11416729-11416751 TGGTGGGTGCCTGTAGTCCCAGG - Intergenic
927217557 2:20676660-20676682 AGGTGGGTACCTGCAGGTCATGG - Intergenic
927591424 2:24360766-24360788 AGGTGGGTCTGTGCAACTCCAGG - Intergenic
927949939 2:27160568-27160590 GGCTGGGCCCCTGGAGCTCCGGG + Intergenic
928981663 2:37142261-37142283 TGGTGTGTGCCTGTAGTTCCAGG - Intronic
929828009 2:45325078-45325100 TGGTGGGTTCCTGTATCTTCTGG - Intergenic
929964811 2:46526340-46526362 AGGTGGATCACTGAAGGTCCAGG - Intronic
931724305 2:65094100-65094122 TGGTGTGTCCCTGTAGTTCAAGG - Intronic
932838094 2:75056212-75056234 ATCTGGGTCCCTGCAGCTCAGGG + Intronic
933806444 2:86001383-86001405 AGGGGAGACCCTGTGGCTCCAGG + Intergenic
935870962 2:107449410-107449432 AGGTGGGACCCTCTAGTTGCAGG - Intergenic
936947298 2:117942101-117942123 AACTGGGTCTCTGCAGCTCCAGG + Intronic
937323777 2:120976756-120976778 AGGTGGCCACCTATAGCTCCAGG - Intronic
938600554 2:132834475-132834497 TGGTGGGTGCCTGTAGTCCCAGG - Intronic
938912558 2:135898776-135898798 AGCTGGGGCCCTATGGCTCCTGG - Intergenic
938989833 2:136616446-136616468 GAGTTGGTCCCTGTAGTTCCAGG + Intergenic
945964026 2:216166252-216166274 TAGTGTGTGCCTGTAGCTCCAGG - Intronic
948019694 2:234720320-234720342 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
948613762 2:239185300-239185322 AGGGGGTGCCCTGTATCTCCTGG + Intronic
948641681 2:239379265-239379287 AGGTGGGTCCCTGCAAGTGCTGG + Intronic
948966741 2:241387658-241387680 TGGTGGGTGCCTGTAGTCCCAGG + Intronic
1170625406 20:18026512-18026534 TGGCGGGTGCCTGTAGTTCCAGG - Intronic
1172084910 20:32373732-32373754 TGGTGGGTGCCTGTAATTCCAGG + Intronic
1175177351 20:57120257-57120279 AGGGGGCTCCCTGGAGATCCTGG + Intergenic
1175234915 20:57503157-57503179 AGGACAGTCCCTGTAGCTGCAGG + Intronic
1175577831 20:60075800-60075822 AGGTGAGTCACTTTAGCTCATGG - Intergenic
1176201477 20:63862782-63862804 AGGCGGGTCCGTGTGGCCCCAGG - Exonic
1177612193 21:23466134-23466156 TGGTGTGTGCCTGTAGTTCCAGG + Intergenic
1177742840 21:25174679-25174701 TGGTGGGCACCTGTAGTTCCAGG - Intergenic
1177792030 21:25732511-25732533 TGGTGGGTGCCTGTAGTCCCAGG + Intronic
1181452206 22:23030995-23031017 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
1181672516 22:24432367-24432389 AGGTGGGTGCTGGTAGTTCCTGG + Exonic
1182103088 22:27671076-27671098 AGGTGAGTCTCTGAATCTCCAGG + Intergenic
1183101303 22:35585754-35585776 AGGTAGCTCCATGTAGTTCCAGG - Intergenic
1184613235 22:45619456-45619478 TGGTGGGTGCCTGTAGTCCCAGG - Intergenic
1184729656 22:46365587-46365609 AGGGGGATCCTTGCAGCTCCTGG + Exonic
1185382705 22:50517525-50517547 AGGGAGGCCCCTGCAGCTCCTGG + Intronic
950436721 3:12984614-12984636 AGGTGGTTCCATGTGGCTACAGG - Intronic
952978124 3:38713612-38713634 AGGTGGGGCCCCGGAGCTCAGGG + Intronic
953007936 3:38995251-38995273 TGGTGGGTGCCTGTAGTCCCAGG - Intergenic
953363375 3:42321056-42321078 GGGTGGGTCACTGGAGCACCCGG - Intergenic
953887902 3:46728172-46728194 TGGTGGGCCCCTGTAGTCCCAGG - Intronic
954363722 3:50135520-50135542 AGCAGGGTCCCTGGGGCTCCAGG + Intergenic
954393928 3:50282515-50282537 AGGTGGGTATCTGGAGCTCTTGG + Intronic
955084402 3:55688623-55688645 AGTTGGGTCCCTCTGGCTCTTGG + Intronic
955270749 3:57496227-57496249 AGCTGAGTCCCTGTGGCTCAAGG - Intronic
955659823 3:61286146-61286168 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
956380606 3:68660861-68660883 AGATGGGACCCTGTAGTTGCAGG - Intergenic
957352655 3:79046383-79046405 AGCTGGGTGCCTTTAACTCCGGG - Intronic
957409765 3:79824479-79824501 GGCTGGATCCCTGAAGCTCCTGG - Intergenic
960955376 3:123027443-123027465 AGGTGAGTCCCGGGAGCCCCGGG - Intronic
961416876 3:126765708-126765730 AGGTGGTTCCCTGTGGAGCCAGG - Intronic
962555976 3:136551734-136551756 AGGTGTGTGCCTGTAGTCCCAGG - Intronic
962592849 3:136908250-136908272 ATATGGGTCCCTGCAGCTACTGG - Intronic
962744862 3:138389689-138389711 TAGTGGGTCCCTTTAACTCCTGG + Intronic
964765574 3:160175665-160175687 TGGCGGGTGCCTGTAGTTCCAGG + Intergenic
964798773 3:160530000-160530022 TGGTGGGCGCCTGTAGCCCCAGG + Intronic
964861361 3:161205529-161205551 TGGTGGGTGCCTGTAGTCCCAGG + Intronic
965177238 3:165351109-165351131 TGGTGGGTGCCTGTAATTCCAGG - Intergenic
965683189 3:171273225-171273247 AGGTGGGTCCCTGTAGCTCCAGG - Intronic
967876977 3:194274071-194274093 AGGTGGGTCCCAGAAGCAGCAGG - Intergenic
968552588 4:1231325-1231347 AGGTGTGTCCCTTTAGATCGGGG + Intronic
969305669 4:6325028-6325050 AGGTGGATCCCTGGGTCTCCAGG + Intronic
969588958 4:8110414-8110436 AGGTGAGGCCCTGAAACTCCTGG + Intronic
970381411 4:15511576-15511598 ACATGGCTCCCTGTAGCTCTGGG + Intronic
972540446 4:40034687-40034709 TGGTGGGTGCCTGTAACCCCAGG + Intergenic
973140804 4:46765836-46765858 AGGTGTGTCCCTGCAGATCAAGG + Intronic
973685581 4:53366164-53366186 GGGTGGGGCTCTGTGGCTCCGGG + Intergenic
973814833 4:54610163-54610185 TGGTGGGTGCCTGTAGACCCAGG - Intergenic
976850721 4:89541984-89542006 AGGTTGGCCTCTGTAGCTGCAGG + Intergenic
977850982 4:101828993-101829015 TGGTGGGTGCCTGTAGTCCCAGG - Intronic
979072399 4:116224583-116224605 TGGTGTGTGCCTGTAGTTCCAGG - Intergenic
982707508 4:158726040-158726062 TGGTGGTTCCCTGAAGATCCAGG + Intergenic
983227611 4:165099731-165099753 AGGTTGGTCACTGGAACTCCTGG - Intronic
984782538 4:183538843-183538865 TGGTGTGTACCTGTAGTTCCAGG + Intergenic
984926893 4:184815097-184815119 AGGTAGGGCCCTGGTGCTCCAGG + Exonic
985201009 4:187485616-187485638 AGATTGTTCCTTGTAGCTCCTGG + Intergenic
985312412 4:188616705-188616727 TGGTGGGCACCTGTAGCCCCAGG - Intergenic
985757807 5:1729727-1729749 GGGTGGGTGGCTGGAGCTCCCGG + Intergenic
988421730 5:31014000-31014022 TGGTGGGCCCCTGTAGTCCCAGG - Intergenic
988476569 5:31591216-31591238 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
990478460 5:56184763-56184785 TGGTGGGTACCTGTAGTCCCAGG + Intronic
993334266 5:86637712-86637734 TGGTGCGTGCCTGTAGCCCCAGG + Intergenic
995249826 5:109980205-109980227 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
996755701 5:126932752-126932774 AGGTGGGCCACTATAGCTCTAGG + Intronic
998221822 5:140288851-140288873 TGGCGGGTACCTGTAGTTCCAGG + Intronic
998472688 5:142395631-142395653 AGGTGGGACCCTGAAGCACAGGG + Intergenic
1000324157 5:160159374-160159396 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
1001528606 5:172446414-172446436 CTGTGGGTCCCTGCAGCTGCAGG - Intronic
1001585055 5:172828155-172828177 AAATGTGTGCCTGTAGCTCCAGG - Intergenic
1001939319 5:175729489-175729511 ACGAGGGTCCCTGAAGCTTCGGG + Intergenic
1002528345 5:179828007-179828029 AGGAGGGGCCCTGTGGCTTCGGG - Intronic
1002931647 6:1639106-1639128 AGGTGGGTGCCTGTGGATACGGG + Intronic
1004608553 6:17216876-17216898 TGGGGGGTGCCTGTAGTTCCTGG + Intergenic
1005570527 6:27141023-27141045 AGATTGATGCCTGTAGCTCCTGG - Intergenic
1006170305 6:32088220-32088242 GGGTGGGGCCCTGTAGCTGAAGG + Intronic
1006201929 6:32301253-32301275 AGGTGGATCGCTGGAGCTCAGGG - Intronic
1006204432 6:32327922-32327944 TGGCGGGTGCCTGTAGTTCCAGG - Intronic
1006517123 6:34551287-34551309 CGGTGGGCCTCTGTACCTCCAGG - Intronic
1006760286 6:36454768-36454790 AGGTGGGTGCCTGTAGTCCCAGG - Intronic
1008945276 6:57090145-57090167 GGGCGGGTCCCGGTAGCGCCAGG + Exonic
1010391196 6:75339813-75339835 TGGTGGGCACCTGTAGTTCCAGG + Intronic
1011399884 6:86948859-86948881 TGTTGGGTCCCTGCAGTTCCTGG - Intronic
1012551634 6:100469026-100469048 AGGTGGGTGCCTGCCGCTCCAGG + Intergenic
1013944306 6:115704050-115704072 AGGTTGGCGCCTGTAGCCCCAGG - Intergenic
1014977928 6:127912081-127912103 AGGTGGGTTCCTGTAGCCTTGGG - Intronic
1016563592 6:145425399-145425421 AGGTGGGTCCCTTGAGGTCAGGG - Intergenic
1016719321 6:147275688-147275710 TGGTGGGTACCTGTAGTCCCAGG - Intronic
1019355833 7:578332-578354 AGGTGGCTCCGTGGAGCTCCCGG - Intronic
1019412546 7:912531-912553 AGGTGCGTCGCTGTGGCCCCAGG - Intronic
1021131855 7:16921331-16921353 AGGTGGGGCCCTGTAGTCACAGG - Intergenic
1023343958 7:39252175-39252197 GGGTCTGTCCCTGCAGCTCCAGG + Intronic
1023962029 7:44935219-44935241 TGGTGGCTCCCAGTAGGTCCTGG - Intergenic
1024067311 7:45751146-45751168 TAGTGGGTGCCTGTAGTTCCAGG + Intergenic
1025096236 7:56097484-56097506 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
1026350327 7:69509931-69509953 AGGTGGGTCACTGGAGGTCAAGG + Intergenic
1026737423 7:72957841-72957863 AAGTGGGTCCTGGAAGCTCCGGG - Intergenic
1027106310 7:75407227-75407249 AAGTGGGTCCTGGAAGCTCCGGG + Intronic
1031605894 7:123767499-123767521 TGCTGGCTCCCTGCAGCTCCAGG + Intergenic
1033177353 7:139136868-139136890 ATGTGCTTTCCTGTAGCTCCAGG + Intronic
1035362508 7:158322758-158322780 AGGTGGCCTCCTCTAGCTCCTGG - Intronic
1035897218 8:3416612-3416634 ACGTGTTTCCATGTAGCTCCTGG - Intronic
1036522801 8:9507623-9507645 TGGTGTGTGCCTGTAGTTCCAGG + Intergenic
1037788770 8:21919219-21919241 TGGGGGGTCCCCGTAGCTGCAGG + Intergenic
1037879622 8:22566356-22566378 ATGTGGGTAGCTGGAGCTCCAGG - Exonic
1038335383 8:26641650-26641672 AGGAGGGTCCCCTTGGCTCCTGG - Intronic
1038665551 8:29534448-29534470 TGGTGTGTGCCTGTAGCCCCAGG + Intergenic
1040097747 8:43463536-43463558 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
1040410691 8:47151604-47151626 GGGTGCGTGCCTGTAGTTCCAGG - Intergenic
1043680413 8:83018358-83018380 TGGTGGGTGCCTGTATTTCCAGG - Intergenic
1047876969 8:129149324-129149346 AGGTGGGACAATGTAGCTTCTGG - Intergenic
1048376991 8:133831531-133831553 TGGTTGGTTCCTGGAGCTCCGGG + Intergenic
1049985732 9:948958-948980 TGGTGGGTGCCTGTACTTCCAGG + Intronic
1052029332 9:23610596-23610618 AGGTGGGGGCATGTAGCTGCTGG - Intergenic
1052870755 9:33504141-33504163 TGGTGCGTGCCTGTAGCCCCAGG - Intergenic
1052907824 9:33852350-33852372 AGCTGGATTCCTGTAACTCCGGG - Intronic
1053808973 9:41832918-41832940 AGGATGGCCCCTGCAGCTCCAGG + Intergenic
1054621619 9:67354510-67354532 AGGATGGCCCCTGCAGCTCCAGG - Intergenic
1054943844 9:70773193-70773215 AGGTGGGACCCAGTAACTGCAGG - Intronic
1055615711 9:78070129-78070151 TGGTGGGTGCCTGTAGTCCCAGG - Intergenic
1056855658 9:90127389-90127411 TGGTGGGTGCCTGTAGTCCCAGG - Intergenic
1056944734 9:90984622-90984644 AAGTGGCTCCCTGCAGCTCATGG + Intergenic
1057687762 9:97251220-97251242 TGGTGCGTGCCTGTAGCCCCAGG + Intergenic
1060913895 9:127372898-127372920 AGGTAGGCCCCTGTATCTTCTGG - Intronic
1062213678 9:135377885-135377907 AGGTGGGTTCCTGCAGCTGAAGG + Intergenic
1185685433 X:1924647-1924669 TGGTGGGTGCCTGTAACCCCAGG - Intergenic
1186470362 X:9816692-9816714 AGCGGGGTCCCTGTAGCCCAAGG + Intronic
1188283350 X:28297850-28297872 AGGTGGGTGCCTGTAATCCCAGG - Intergenic
1190335274 X:49258232-49258254 AGGTCGGCACCTGTAGGTCCAGG + Intronic
1191858311 X:65645213-65645235 AGGAGGGTCCTGATAGCTCCAGG - Intronic
1195618582 X:106931692-106931714 TGGTGGGGCCCTCTAGATCCAGG - Intronic
1195885665 X:109635068-109635090 TGCTGAGTCCCTGCAGCTCCAGG + Intronic
1196082526 X:111648948-111648970 AGGTTAGCCCCTGTGGCTCCAGG - Intergenic
1196082748 X:111649965-111649987 AGGTGGGCCCCAGCAGCTCCAGG - Intergenic
1196260593 X:113575829-113575851 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
1196707423 X:118727927-118727949 AGGTGGGACCCGGGAGCTGCGGG + Intronic
1196773151 X:119315833-119315855 TGGTGGGTGCCTGTAGTCCCAGG - Intergenic
1197293125 X:124684621-124684643 TGGCTGGTCCCTGTGGCTCCAGG + Intronic
1199850562 X:151722657-151722679 AGGTGGCGCCCTGTTCCTCCAGG - Exonic
1200685210 Y:6251941-6251963 ATGTGGGTCCATGTTGCCCCAGG + Intergenic
1200773926 Y:7152674-7152696 TGGTGGGTGCCTGTAATTCCAGG + Intergenic
1200990736 Y:9343211-9343233 ATGTGGGTCCATGTTGCCCCAGG + Intergenic
1200993396 Y:9363525-9363547 ATGTGGGTCCATGTTGCCCCAGG + Intronic
1200996058 Y:9383799-9383821 ATGTGGGTCCATGTTGCCCCAGG + Intergenic
1201001229 Y:9472678-9472700 ATGTGGGTCCATGTTGCCCCAGG + Intronic
1201003893 Y:9493009-9493031 ATGTGGGTCCATGTTGCCCCAGG + Intergenic
1201006547 Y:9513290-9513312 ATGTGGGTCCATGTTGCCCCAGG + Intergenic
1201009203 Y:9533596-9533618 ATGTGGGTCCATGTTGCCCCAGG + Intergenic
1201062824 Y:10063114-10063136 AGGTGGGCCCATGTTGCCCCAGG - Intergenic
1201284523 Y:12367908-12367930 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic