ID: 965686060

View in Genome Browser
Species Human (GRCh38)
Location 3:171304023-171304045
Sequence CTCCTCTCATGGTTCAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965686060_965686071 11 Left 965686060 3:171304023-171304045 CCTGAGTTGAACCATGAGAGGAG 0: 1
1: 0
2: 0
3: 9
4: 136
Right 965686071 3:171304057-171304079 AGGAATATGTGAAGGAACAGAGG 0: 1
1: 0
2: 4
3: 36
4: 470
965686060_965686072 18 Left 965686060 3:171304023-171304045 CCTGAGTTGAACCATGAGAGGAG 0: 1
1: 0
2: 0
3: 9
4: 136
Right 965686072 3:171304064-171304086 TGTGAAGGAACAGAGGTGAGAGG 0: 1
1: 0
2: 4
3: 44
4: 522
965686060_965686070 3 Left 965686060 3:171304023-171304045 CCTGAGTTGAACCATGAGAGGAG 0: 1
1: 0
2: 0
3: 9
4: 136
Right 965686070 3:171304049-171304071 GGGGTGGGAGGAATATGTGAAGG 0: 1
1: 0
2: 3
3: 37
4: 460
965686060_965686069 -9 Left 965686060 3:171304023-171304045 CCTGAGTTGAACCATGAGAGGAG 0: 1
1: 0
2: 0
3: 9
4: 136
Right 965686069 3:171304037-171304059 TGAGAGGAGGTGGGGGTGGGAGG 0: 1
1: 3
2: 37
3: 368
4: 2713

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965686060 Original CRISPR CTCCTCTCATGGTTCAACTC AGG (reversed) Intronic
902107955 1:14053305-14053327 CTCCTCTGATGGTTCAACCTGGG - Intergenic
902158135 1:14506445-14506467 CTGTTCTCATGGTTCTGCTCTGG - Intergenic
902738711 1:18419184-18419206 CTCCTCTCATTGTCCTAATCTGG + Intergenic
902840383 1:19070492-19070514 CTCCTGTCATAGATCACCTCAGG - Intergenic
903033325 1:20478559-20478581 TTTTTCTCATGGTTCAACTGTGG - Intergenic
903436429 1:23353391-23353413 CTCCTCTCCTGGTTCTTCTCCGG + Intergenic
903767647 1:25744935-25744957 CTCCTCTTAGGGTTACACTCTGG + Intronic
908652440 1:66350421-66350443 TTCCTCTCATGGATAACCTCAGG - Intronic
910774122 1:90857931-90857953 CTCCTGTCATGGTCCTTCTCTGG + Intergenic
916696643 1:167244290-167244312 CTCATCTGAAGGTTCAACTGGGG + Intronic
917488736 1:175479248-175479270 CTCCACTGATGGTCTAACTCTGG + Intronic
917497639 1:175555814-175555836 CTCCTATCAAGGCTGAACTCAGG - Intronic
917593151 1:176498279-176498301 CTCCTCTCCAGGTCCCACTCTGG + Intronic
918346375 1:183610730-183610752 CTCATCTCAAGGTTCAACAAAGG - Intergenic
1065814450 10:29471412-29471434 CTCCTCTCAGGGTGTTACTCAGG + Intronic
1070698306 10:78579530-78579552 CTCATCTCGTGCTCCAACTCAGG - Intergenic
1076224610 10:128764288-128764310 CTCCTCTGAGGATTCTACTCTGG - Intergenic
1076246354 10:128950330-128950352 CTCCTCTCTTGGTGACACTCAGG - Intergenic
1080108845 11:28542778-28542800 CTCCTCTCATGGTCTCTCTCTGG + Intergenic
1080140375 11:28911371-28911393 ATCCTCTCATGTTTCGATTCAGG + Intergenic
1080691357 11:34561311-34561333 CTCTTCTGATGGTTCAGTTCCGG + Intergenic
1088990738 11:114951240-114951262 CTCATCTCAAGGCTCAACTGGGG + Intergenic
1091696399 12:2630907-2630929 CTCCTCCCATGGCTCCACGCTGG - Intronic
1092223997 12:6734615-6734637 GTCCTCTCAGGGTTCAACTGGGG + Intergenic
1096738746 12:53676631-53676653 CTTCTCTCATGGTTTATCACCGG - Intronic
1102635256 12:114317786-114317808 CTCTTCTCATGGTTCAGGGCAGG + Intergenic
1102928075 12:116842068-116842090 GTCCTCTCCTGGCTCAACTTGGG + Intronic
1110730568 13:78875474-78875496 CTCATCTCAAGGCTCAACTGGGG + Intergenic
1112433672 13:99375255-99375277 CACATCTCTTGGTTGAACTCAGG - Intronic
1115622598 14:35154799-35154821 TTCCTCTGATTGTTCAAATCAGG - Intronic
1119738062 14:76996568-76996590 CACCTCTCCTGGTTCAGCACAGG - Intergenic
1125458815 15:39888705-39888727 CTACTCTGATGGTAGAACTCTGG - Intronic
1127378718 15:58409153-58409175 CTGCTCACATGGTCCATCTCAGG - Intronic
1131466273 15:92656876-92656898 CTCCTCTGAAGGCTCAACTGGGG + Intronic
1133463952 16:6011906-6011928 CTCCTCTCATGCTTCATATTGGG - Intergenic
1133648962 16:7791461-7791483 CTCCTTTCAAGGTTCAACTGGGG - Intergenic
1135653379 16:24226411-24226433 ATCATCTCATGGCTCAAATCTGG + Intergenic
1139216741 16:65132996-65133018 GTCCTCTCATGTTGCCACTCAGG + Intergenic
1144314929 17:14050632-14050654 CTCCTCTAATGGGTCATCTTTGG - Intergenic
1144364196 17:14526250-14526272 CTCCTCCTATGGTTCCACCCAGG + Intergenic
1144573485 17:16415314-16415336 CCCCTGCCATGGGTCAACTCAGG + Intergenic
1148900087 17:50868707-50868729 CTGCTCTCATATTTCAAATCTGG - Intergenic
1150716265 17:67575070-67575092 CTCCTCACAGTGTTCCACTCTGG + Intronic
1151579280 17:74968999-74969021 CTCCTCTCCTGGTCCCACTGTGG + Intronic
1152769927 17:82161346-82161368 CTCCTCAAAGGGTTCAACACAGG + Intronic
1153355590 18:4131574-4131596 CTCATCTCGTGGATCAAATCTGG - Intronic
1156510099 18:37629077-37629099 GTCATCTCATGGTTCAAATGAGG - Intergenic
1157805747 18:50656323-50656345 GTCCACTCAGGGCTCAACTCAGG + Intronic
1158442655 18:57490823-57490845 CACCTCTCATGTTTAAAATCAGG + Exonic
1159716656 18:71832552-71832574 CTTCACTGATGTTTCAACTCAGG - Intergenic
1161330075 19:3682750-3682772 CTCCTCTGAAGGCTCAACTGGGG - Intronic
927415344 2:22873565-22873587 CTCCTCTCCTGCTTCAACCCTGG + Intergenic
929446906 2:42009111-42009133 CTCCTCTCTTGATTCATCCCAGG - Intergenic
930810133 2:55531595-55531617 CTTCTCTCATGATTGTACTCTGG + Intronic
932937457 2:76121352-76121374 CTCTTCTCACTGTTCAAATCAGG - Intergenic
933409299 2:81904847-81904869 CCTTTCTCATGGTTAAACTCTGG - Intergenic
934087849 2:88525232-88525254 CTCCTATCATGGCTCATTTCAGG - Intronic
934704296 2:96465799-96465821 CTCTTCATATGGTTCAGCTCAGG + Intergenic
937472931 2:122189161-122189183 TTTCTATCATGATTCAACTCTGG + Intergenic
937542964 2:122981819-122981841 CTTCTCTCATGGTTAGACTGGGG - Intergenic
937924085 2:127154295-127154317 CTCCACTCTTGCTTAAACTCAGG - Intergenic
939275806 2:139994211-139994233 GTCCTCTCAAGGCTCAACTTGGG + Intergenic
940492432 2:154380812-154380834 CTCATCTCATGGCTCAACTGGGG + Intronic
944246474 2:197535421-197535443 CTGCTCTTGTGGTTCAACTTGGG - Intronic
944590225 2:201210000-201210022 CTCCTCTGATCCTTCAAATCTGG - Intronic
945645951 2:212494607-212494629 CAACTCTCATGGTTCCATTCGGG - Intronic
946105840 2:217368622-217368644 CTTCTCCCCTGGTTCACCTCTGG + Intronic
947535757 2:230939738-230939760 CTCCTCACCTGGTTCTACCCGGG - Intronic
947812629 2:233014175-233014197 CTCATCTCATGGCTCCACTAGGG + Intronic
948321177 2:237071060-237071082 CTCATCTCAAGGCTCAACTGGGG - Intergenic
1171030666 20:21673702-21673724 CTCATCTCATGGTTCACATGTGG + Intergenic
1174962633 20:55175576-55175598 CCCCTCTCAAGGTTAAACTTGGG - Intergenic
1175703102 20:61154741-61154763 CTTCCCTCAGGGTTCAACACAGG + Intergenic
1176371644 21:6065950-6065972 CACCTCTCATGGTACAAAGCTGG + Intergenic
1177375487 21:20264858-20264880 CTCCTGTCCTGCTTAAACTCTGG - Intergenic
1179089222 21:38248670-38248692 CTCCTCTCATGTTTGAATTGTGG - Intronic
1179751875 21:43472589-43472611 CACCTCTCATGGTACAAAGCTGG - Intergenic
1181159744 22:20952083-20952105 CTCCACTCATGGCTCAACATGGG - Exonic
1181402628 22:22660702-22660724 TTCCTCTCCTGGTTCTATTCTGG - Intergenic
1181841453 22:25666080-25666102 CTCATCTCACTGTTGAACTCTGG + Intronic
1183228439 22:36565920-36565942 CTCCCCTCACTGTTCTACTCAGG - Intronic
1183461308 22:37952683-37952705 CTTCTCTCATCCTTTAACTCAGG + Intronic
1184492755 22:44819833-44819855 CCCCTCTCATGGTGCGACTTGGG - Intronic
1184976948 22:48069094-48069116 CTCCTCTCAGAATCCAACTCGGG - Intergenic
949710755 3:6868151-6868173 CTCATCCCATTGTTCAGCTCAGG + Intronic
949922747 3:9015731-9015753 CTCGTCTCTTGTTTCCACTCAGG - Exonic
952317206 3:32241330-32241352 CACTTCTGATGGTTCAACTTAGG + Intronic
955592224 3:60550111-60550133 TTCCTCTCAAGGTTCATCTTGGG - Intronic
961991381 3:131195679-131195701 ATCAACTCATGGTACAACTCCGG - Intronic
962889292 3:139657464-139657486 CTCCACTCAAGGTTCAACAGAGG + Intronic
965686060 3:171304023-171304045 CTCCTCTCATGGTTCAACTCAGG - Intronic
972118050 4:35663233-35663255 CTCCTCACATTATTCACCTCAGG - Intergenic
981800991 4:148655185-148655207 ATCCTCTCATTTTTCAACTCTGG - Intergenic
982277442 4:153651105-153651127 CTCATCTCAAGGCTCAACTAGGG + Intergenic
982509288 4:156261287-156261309 TTTTTCTCATGGTTAAACTCAGG + Intergenic
984027398 4:174559610-174559632 CTAATTTCATCGTTCAACTCAGG + Intergenic
984364119 4:178776139-178776161 CTCCACTCATGATCCAACTGTGG + Intergenic
985191451 4:187378440-187378462 ATCCTCTCATGTTTCTAATCGGG - Intergenic
987966288 5:24880189-24880211 CTCATCTCAATGTTCAACTGTGG - Intergenic
989323659 5:40165453-40165475 CTCCTTTCCTGCTTGAACTCAGG - Intergenic
991040964 5:62175032-62175054 CTCGTCTAAAGGTTCAACTGGGG - Intergenic
997151823 5:131504640-131504662 GTCCTTTCCTGGTTCCACTCCGG + Exonic
997440869 5:133907776-133907798 CTCCCATTTTGGTTCAACTCAGG + Intergenic
999124685 5:149238460-149238482 CTCCTCTCCTGGTGCATTTCAGG - Intronic
1000073605 5:157764074-157764096 CTCTTCTCATGGCTAAACTATGG + Intergenic
1000073835 5:157766150-157766172 CTCCTGGCAGGGTTCATCTCTGG - Intergenic
1002076828 5:176713251-176713273 CTGCTCTCAAATTTCAACTCTGG + Intergenic
1003514968 6:6810281-6810303 CACCTCTCTTGGTTGATCTCAGG + Intergenic
1004182561 6:13393572-13393594 CTCCTCTCATTTCTCAAGTCTGG + Intronic
1007264228 6:40585285-40585307 CTCCTCACATGCTTCTGCTCAGG - Intronic
1007685900 6:43667294-43667316 CTCCTCTCCTTGCTCCACTCTGG + Intronic
1012780638 6:103552579-103552601 CTCCTTTCATCTTCCAACTCAGG - Intergenic
1016006210 6:139091618-139091640 CTTCTCTGATTGTTCAAGTCTGG + Intergenic
1016943463 6:149504353-149504375 CTCCTCTCATGCTTCTCCTGGGG - Intergenic
1018378358 6:163234381-163234403 CTCCTCTCTTGCTTCCTCTCTGG + Intronic
1020265338 7:6556644-6556666 CTCCTCTCATGGTTGACTTGAGG - Intergenic
1020542439 7:9475673-9475695 CTCCCCTTGTGTTTCAACTCAGG + Intergenic
1021738335 7:23660712-23660734 CTCCTCTCATCCTTCTAATCTGG - Intergenic
1022214845 7:28248671-28248693 CTCCTCTCATGGTGATACTGGGG + Intergenic
1025033184 7:55573210-55573232 CTCCTCTCAGCCTCCAACTCAGG - Intergenic
1025482901 7:61006696-61006718 CTGTTCTCAGGGTTCACCTCAGG + Intergenic
1026297956 7:69072290-69072312 CTCCTCTTTTGGCTCAACACTGG - Intergenic
1026615436 7:71898530-71898552 CTCCTCTCCTTGTGAAACTCTGG - Intronic
1027744545 7:82057002-82057024 CTCCTCTAAAGGTACAACTAAGG + Intronic
1028148570 7:87345792-87345814 CTCCCCTAATCCTTCAACTCGGG + Intronic
1028215111 7:88122090-88122112 CTCATCTCAAGGCTCAACTGTGG + Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1033529603 7:142248695-142248717 CTCTTCTCTTGGCTCAGCTCTGG - Intergenic
1039115538 8:34088058-34088080 CTCCTTTGATAGTTCCACTCTGG - Intergenic
1039207145 8:35169766-35169788 CTCCCTTCAAGGTTCAGCTCAGG + Intergenic
1040037254 8:42882703-42882725 CAACTCCCATGGTTCAGCTCTGG - Intronic
1041652518 8:60314857-60314879 CTGCTCTCCTGGTTACACTCTGG + Intergenic
1041669673 8:60479733-60479755 CTCCTCTCTTGCTCCAACTTGGG - Intergenic
1048152861 8:131910743-131910765 CTCATTACATGGCTCAACTCTGG + Intronic
1048863152 8:138738817-138738839 CTCCTCTCATTCAGCAACTCTGG + Intronic
1050336885 9:4597898-4597920 CTCCTTTGATGGACCAACTCAGG + Intronic
1053184779 9:36006344-36006366 CTCATCTGAAGGTTCAACTGGGG - Intergenic
1056018917 9:82421763-82421785 CTCTTCTCACTGTTTAACTCAGG - Intergenic
1056034573 9:82590194-82590216 CTCATCCCATGACTCAACTCTGG + Intergenic
1058011833 9:99986830-99986852 CTCCTCTCAATGTTTATCTCTGG - Intronic
1058818687 9:108709286-108709308 GTCATCTCAAGGTTCAACTCAGG + Intergenic
1059392284 9:114006739-114006761 CTCATCTCAAGGCTCAACTGGGG + Intronic
1196699776 X:118655412-118655434 CTCTTCTCAAGGCTCAAGTCGGG + Intronic
1196910282 X:120477879-120477901 CTCCTCTCATGGTTCCAAGATGG - Intergenic
1196941671 X:120782814-120782836 CTCATCTCAAGGTTCAACTGAGG - Intergenic
1198823981 X:140679848-140679870 CTGATATCATGGTGCAACTCAGG + Intergenic