ID: 965686493

View in Genome Browser
Species Human (GRCh38)
Location 3:171308669-171308691
Sequence CCTAATATCCAGACTCCATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7166
Summary {0: 6, 1: 10, 2: 164, 3: 1368, 4: 5618}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965686493 Original CRISPR CCTAATATCCAGACTCCATA GGG Intronic
Too many off-targets to display for this crispr