ID: 965686966

View in Genome Browser
Species Human (GRCh38)
Location 3:171314413-171314435
Sequence GATCAGCCATAGGCTCTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 61}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965686966 Original CRISPR GATCAGCCATAGGCTCTACA TGG (reversed) Intronic
903262002 1:22136532-22136554 GTTCAGCCACAGGCTCTCCTAGG - Intronic
921064032 1:211610052-211610074 GGCCAGCCATAGGCTACACAGGG - Intergenic
923993404 1:239464976-239464998 GATGAGCCAAAGTCTCTCCATGG + Intronic
1064305971 10:14166865-14166887 GAGCACCCATAGGCTCTCTAAGG - Intronic
1064341634 10:14490938-14490960 GCTCAGCCATAGCCTCTAGCAGG - Intergenic
1065182738 10:23143345-23143367 GAACAGCCATAGCCTCTGGATGG + Intergenic
1069268583 10:66494453-66494475 GATAAGCCATAGCTTCTACAAGG - Intronic
1071325267 10:84509505-84509527 TGTCAGCAATAGGCACTACAGGG - Intronic
1075261604 10:120968040-120968062 AATCAGCCACAGCTTCTACAAGG - Intergenic
1077944810 11:6884741-6884763 AATCATCCAGAGCCTCTACAGGG + Intergenic
1084113937 11:67030993-67031015 GATCAGCCCTGGGCTCCCCAGGG - Intronic
1094690804 12:32766997-32767019 GCTAAGCTATAAGCTCTACAAGG - Intergenic
1097905545 12:64915483-64915505 AATCAGCCATAGGATCTGCTTGG + Intergenic
1105724947 13:23154326-23154348 GATCAGCCAGACGCTTAACAGGG - Intergenic
1114489362 14:23088516-23088538 GAGCAGCGATAGACTCTTCATGG - Intronic
1124695598 15:31861978-31862000 GAGCAGCTCTAGGCTCTGCAAGG + Intronic
1130586573 15:85188250-85188272 GATAAGCCAGAGGCTCTGCGGGG + Intergenic
1130930293 15:88421692-88421714 GGCTGGCCATAGGCTCTACATGG - Intergenic
1135864130 16:26084985-26085007 GTTCAGCCACAGTCTCTTCAGGG - Intronic
1137948329 16:52757307-52757329 GAGCAGCCATAGGCCATAAATGG - Intergenic
1139602340 16:67994161-67994183 GATCAGCCAGAAGCTCTAGGAGG - Intronic
1143329659 17:6124017-6124039 GATCTGCCAGAGCCTCTCCAGGG + Exonic
1143615519 17:8047089-8047111 GACCAGCCCTCGGCTCTCCAGGG - Intronic
1147156693 17:38547762-38547784 GCTCAGCCCCAGGCCCTACACGG - Intronic
1149224950 17:54459007-54459029 GATCAGCCTTATGATCTAAAAGG + Intergenic
1151719660 17:75847891-75847913 GAGTAGCCATAGGCTCCACTGGG + Exonic
1163692503 19:18745291-18745313 GAGCAGCCCTGGGCTCCACAAGG + Intronic
1168313483 19:55473352-55473374 GATCAGCCGAAGGCTTTAGAAGG - Intergenic
938938505 2:136148321-136148343 GGTCCGCCATAAACTCTACAAGG - Intergenic
940394578 2:153173320-153173342 TCTCACCCATAGGCTCAACAAGG - Intergenic
946005598 2:216522007-216522029 GGTCAGCTGTAGGCTCTACTAGG + Intronic
1169021837 20:2336200-2336222 GATCAGGCACAGGGGCTACAGGG - Intronic
1171129632 20:22639364-22639386 GTTCAGCCCTAAGCTGTACATGG + Intergenic
1179251698 21:39675989-39676011 CATCAGCCATTCCCTCTACATGG + Intergenic
1183213988 22:36467543-36467565 GAACTGCCATAGGCCCTAGAAGG + Exonic
953391851 3:42538502-42538524 GGTCAGCCATAGGATCGAGAAGG + Intergenic
959996662 3:112687920-112687942 GACCAGCCCTAGGCTCCAAATGG + Intergenic
961320478 3:126069845-126069867 GATCAGCCATTTGCTCTTCTAGG - Intronic
964981959 3:162694975-162694997 AATCATCAATATGCTCTACATGG + Intergenic
965686966 3:171314413-171314435 GATCAGCCATAGGCTCTACATGG - Intronic
967838394 3:193983489-193983511 TATCTCTCATAGGCTCTACAGGG - Intergenic
970256848 4:14177197-14177219 GATCAGCCATTGAATCCACATGG - Intergenic
971677328 4:29649128-29649150 GAGAAGCCATAGGCTGTTCATGG + Intergenic
981422961 4:144572235-144572257 TCTCATCCATGGGCTCTACAAGG + Intergenic
993012267 5:82496550-82496572 GATCAGCCATAGGCTGGAATAGG - Intergenic
995060338 5:107806359-107806381 GCTCACCCACAGGCTCTTCAGGG + Intergenic
996998910 5:129734731-129734753 GATCAGCCAGAGGTTCTCAAAGG + Intronic
997667690 5:135645033-135645055 AAACAGCCAAAGGCTCCACAAGG + Intergenic
998718522 5:144914137-144914159 GGTCAGCCATAGCCTGTATAAGG + Intergenic
1003071645 6:2949717-2949739 GATCTGCCTTAGGTTCTACCGGG - Intronic
1013918746 6:115373983-115374005 GTTCAGCCATAGGGATTACAGGG + Intergenic
1029111099 7:98213380-98213402 GAGCAGCCTTAGGCTCTGCCGGG - Intergenic
1033670585 7:143488977-143488999 GATGAGCCCAAGGCTCTGCATGG - Intergenic
1036149805 8:6286740-6286762 GAGCTGCCAGGGGCTCTACATGG + Intergenic
1036684809 8:10902621-10902643 GCCCAGCCATTGGCTCTTCAGGG + Intronic
1041310862 8:56515193-56515215 CATCTGCCATAGGCTAAACAGGG - Intergenic
1049063783 8:140296892-140296914 GAGCAGCCAGAGACTCTAGAAGG + Intronic
1058668166 9:107339043-107339065 GCTGAGCAATAGGCACTACAGGG + Intergenic
1062032199 9:134366729-134366751 GAAAAGCCATAGACTCTCCACGG + Intronic
1188169524 X:26906613-26906635 CATCAACCATAGGCTCAAGAAGG + Intergenic
1188476742 X:30600506-30600528 GATCAGCCAGAAGCTCTAGGAGG - Intergenic
1202370941 Y:24195023-24195045 GATAAGCCAGAGGCTCTGCGGGG - Intergenic
1202499843 Y:25475094-25475116 GATAAGCCAGAGGCTCTGCGGGG + Intergenic