ID: 965689846

View in Genome Browser
Species Human (GRCh38)
Location 3:171344003-171344025
Sequence TTGAGCAATGGGAAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 585
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 531}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965689846 Original CRISPR TTGAGCAATGGGAAGGAGGG AGG (reversed) Intronic
900207212 1:1436647-1436669 GTGAGGAATGGGAAGGTGTGGGG + Intronic
900623260 1:3596850-3596872 TAGAGCAGAGGGAAGGTGGGAGG + Intronic
901011219 1:6203537-6203559 TTGTACAAGGGGAGGGAGGGTGG - Intronic
901651140 1:10743843-10743865 TTGAGGAAAGGGAGGGAGGGAGG + Intronic
901826414 1:11864676-11864698 CTAAGCAAGGGGAGGGAGGGAGG - Intergenic
902137493 1:14322692-14322714 TTGAGCCATGGAAGGGAGAGAGG + Intergenic
902481028 1:16711965-16711987 CTGTGCAGTGGGAGGGAGGGAGG - Intergenic
902533981 1:17108407-17108429 GAGAGCTATGGGCAGGAGGGTGG - Intronic
902578307 1:17392422-17392444 TTCTGGAATGGGAAGGAGGCTGG - Intronic
902688037 1:18091634-18091656 TTGAAAAATGGGAAGGAGGGGGG - Intergenic
902767296 1:18625855-18625877 TTGAGAAATGGAAAGGAAAGAGG + Intergenic
902770438 1:18642731-18642753 TGGAGCAGGGGGAGGGAGGGAGG + Intronic
902858098 1:19223960-19223982 TTTAGCGATGGGGAGGGGGGTGG - Intronic
903350783 1:22715403-22715425 TTGAGCTGGGGGAGGGAGGGAGG - Intronic
903375281 1:22861987-22862009 TTGTGCAATGGGTAAGTGGGTGG - Intronic
903406731 1:23103801-23103823 TTGTTTATTGGGAAGGAGGGAGG + Intronic
903441065 1:23388145-23388167 TGGTGGAAGGGGAAGGAGGGTGG + Intronic
903502936 1:23811751-23811773 TAGGGCTATGGTAAGGAGGGTGG + Intronic
903552556 1:24168132-24168154 TGGAAAAATGGGAAGGAAGGAGG - Intronic
903947397 1:26972329-26972351 TTGGGGAATAGGAAGGAGGCTGG + Intergenic
904307335 1:29598742-29598764 AGGGGCAGTGGGAAGGAGGGAGG + Intergenic
904348512 1:29889856-29889878 AGGAGAAATGGGAAGGAGGCAGG + Intergenic
904676765 1:32203697-32203719 TTGGGCACTGGGAAGGGGTGAGG - Intronic
904696537 1:32334847-32334869 AAGAGAAATCGGAAGGAGGGTGG - Exonic
904713260 1:32447765-32447787 TAGGGGAAGGGGAAGGAGGGGGG - Intergenic
905244873 1:36605818-36605840 TAGAGGAGTCGGAAGGAGGGAGG + Intergenic
905806701 1:40882423-40882445 CTGAGAGATGGGGAGGAGGGGGG + Intergenic
905866403 1:41379406-41379428 TGGAGAAATGGGGAGGTGGGAGG + Intronic
906557424 1:46724731-46724753 TGGAGGCATGGGCAGGAGGGTGG - Intergenic
907791270 1:57667005-57667027 TTGAGCAAGGAGAAGGATGGTGG - Intronic
909509060 1:76430611-76430633 TTGAGGAATTCGTAGGAGGGAGG - Intronic
909520973 1:76567035-76567057 ATGAGGACAGGGAAGGAGGGAGG + Intronic
911208947 1:95119515-95119537 TTGAGAAATGGGAAAGGGGCTGG + Intronic
911507982 1:98777365-98777387 TGGAGCAATGTGAATGAGGGAGG + Intergenic
912516641 1:110220474-110220496 GTGAGCAGAGGGAGGGAGGGAGG - Intronic
913010443 1:114677845-114677867 TTGAGGAAAGGGAAGAAGGAAGG - Intronic
913500670 1:119470042-119470064 TTGAGCAACTGGGAGGAGAGTGG - Intergenic
913515727 1:119604164-119604186 TTGGGCAATTGGGAGGAGAGTGG - Intergenic
914320502 1:146555008-146555030 TAGAGCAGTGTGAAGGAGTGAGG + Intergenic
914412475 1:147444265-147444287 GTGAGGTAGGGGAAGGAGGGAGG + Intergenic
914831229 1:151172411-151172433 TTCAGAAATAGGTAGGAGGGAGG - Intronic
914945825 1:152065229-152065251 TTGAGAAACTGGAAGGACGGTGG - Intergenic
915038396 1:152947445-152947467 CTGAGCAGGGAGAAGGAGGGGGG + Intergenic
915275224 1:154783862-154783884 TGGAGCAAGGGGAAGGGGTGAGG - Intronic
915599394 1:156913067-156913089 ATGAGGAGTGGGGAGGAGGGAGG + Intronic
915635976 1:157186849-157186871 TGGAGCAGTGGGAAGGAGCCTGG - Intergenic
915648097 1:157288209-157288231 TGGAGCAGTGGGAAGGAGCCTGG + Intergenic
915662578 1:157416297-157416319 TGGAGCAGTGGGAAGGAGCCTGG - Intergenic
915895539 1:159808632-159808654 TGTAGCCAGGGGAAGGAGGGGGG + Intronic
915920742 1:159973588-159973610 TGTAGCCAGGGGAAGGAGGGGGG - Intergenic
916874907 1:168958790-168958812 TTGAGATAGGGGAAGGAGGAGGG - Intergenic
918301919 1:183212470-183212492 ATGAGCAATGGAAGGCAGGGAGG - Intronic
919693071 1:200544735-200544757 GTGAGGAAGGGGAGGGAGGGAGG + Intergenic
919782631 1:201230707-201230729 ATGAGCAAAGGCAAGGAGGTAGG + Intergenic
920016178 1:202911285-202911307 GTGGGCAATGGGAAGCAGGAAGG - Intronic
920258384 1:204672299-204672321 TTAAGCAATGGGGAGGGGGAAGG - Intronic
920351280 1:205339592-205339614 CTGAGCCAAGGGAAGGAAGGAGG + Intronic
921080861 1:211737499-211737521 ATGAGGAATGGGAAGGAGCCAGG - Intergenic
921179652 1:212621990-212622012 TAGAGGAAAGGGAAGGTGGGGGG + Intergenic
921205336 1:212843987-212844009 TTAAGGAATGGAAAGGAGAGTGG - Intronic
921352325 1:214248925-214248947 CTGAACCATGGGAAGGAAGGAGG - Intergenic
921515324 1:216084204-216084226 TTGAGCAATGGCAGGGATGGTGG + Intronic
921732529 1:218594112-218594134 TGGAGCAAAGGGCAGGAGGACGG - Intergenic
922622480 1:227000673-227000695 ATGATCACTAGGAAGGAGGGAGG - Intronic
923141036 1:231162022-231162044 GAGAGTAATGGGGAGGAGGGGGG - Intergenic
924399846 1:243667411-243667433 TTGGGCAATTGAAAGGATGGAGG - Intronic
924945298 1:248842507-248842529 CTGAGCAATGAGTACGAGGGAGG + Intronic
1062979440 10:1709777-1709799 TTGAGGTAAGGGAAGGAGAGGGG - Intronic
1064196032 10:13244729-13244751 CTGAGCAATGGGGAGTATGGGGG - Intergenic
1064863227 10:19850115-19850137 GAGAGCAATGGTCAGGAGGGTGG + Intronic
1065229178 10:23579511-23579533 TTGAGCAAAAGGAAAGAGGAGGG + Intergenic
1065874687 10:29986861-29986883 TTAAGCAATGTGAGGGAAGGTGG - Intergenic
1066786120 10:39005709-39005731 TTGAGCAATGCCAAAGATGGGGG - Intergenic
1068076344 10:52260104-52260126 TGGGGGAATGGGAATGAGGGTGG - Intronic
1069291703 10:66788198-66788220 TTGACCCTTGGGAAGGAGGGTGG - Intronic
1070112529 10:73498881-73498903 ATGAACAATGGGAGGGTGGGAGG + Exonic
1070310941 10:75273350-75273372 TTGAGCAAAGGCCAGGAGGCTGG - Intergenic
1070864624 10:79700457-79700479 GTGAGCAAGGGAAAGGAGCGCGG + Intergenic
1070878414 10:79838587-79838609 GTGAGCAAGGGAAAGGAGCGCGG + Intergenic
1071403136 10:85298162-85298184 TGGAGCAATGGCAAGGGTGGAGG - Intergenic
1071499589 10:86193840-86193862 GTGAGCAGTGGAAGGGAGGGAGG - Intronic
1071631527 10:87222686-87222708 GTGAGCAAGGGAAAGGAGTGCGG + Intergenic
1071644969 10:87354898-87354920 GTGAGCAAGGGAAAGGAGCGTGG + Intergenic
1072170926 10:92861077-92861099 TTAAGCAATTGAAAGGAGGTTGG - Intronic
1072430023 10:95362659-95362681 GTGAGCAATGATAAGGCGGGAGG - Intronic
1073063431 10:100745351-100745373 GGGAGAAATGGGAGGGAGGGAGG - Intronic
1073523428 10:104156212-104156234 TTAAGCAATGGGGAAGAGGCTGG - Intronic
1073636738 10:105206931-105206953 TGGAGAAATGGGAATCAGGGAGG + Intronic
1073735496 10:106341230-106341252 ATGGGCAAGGGGAAGGAGAGAGG - Intergenic
1073949198 10:108786578-108786600 TTGTGCTATGGGAAGAAGGAAGG - Intergenic
1074279465 10:112037288-112037310 TTGAGCAATGGTAAGAGTGGAGG - Intergenic
1074300375 10:112227705-112227727 TTGGGCAATGGGAGGGGGTGGGG - Intergenic
1074376718 10:112946918-112946940 TTGGGAAATGGGTGGGAGGGGGG - Intergenic
1074701069 10:116093083-116093105 ATAAGCACTGGGGAGGAGGGAGG - Intronic
1075131571 10:119744312-119744334 TTTAGCAAGGGGAAGGATGGAGG - Intronic
1075301787 10:121331286-121331308 TTTTGCAATGGGAAGAATGGTGG - Intergenic
1075651122 10:124128834-124128856 AGGTGCAAAGGGAAGGAGGGAGG + Intergenic
1076535418 10:131173939-131173961 CTCAGGACTGGGAAGGAGGGAGG + Intronic
1076791358 10:132778651-132778673 GTGTGCAATCGGAAGGAGGCTGG + Intronic
1077399939 11:2349928-2349950 TGGACCCATGGGAAGGAAGGGGG + Intergenic
1077972824 11:7213097-7213119 CTGAGGAATGGTAAGGAGGATGG + Intergenic
1078060553 11:8040103-8040125 TTGGGCAATGGGAGGGCAGGGGG - Intronic
1079115876 11:17640458-17640480 TTCAGCAATGTTAAGGAGGGAGG - Intronic
1079981013 11:27151483-27151505 TTCAGCAATGGGATGGATAGTGG - Intergenic
1080634331 11:34110301-34110323 ATGAGCAAAGAAAAGGAGGGAGG - Intronic
1081250807 11:40830848-40830870 TTGATCTATGGCAAAGAGGGTGG + Intronic
1081782609 11:45723573-45723595 GTGAGCATGGGTAAGGAGGGCGG + Intergenic
1082208575 11:49469021-49469043 TGGATGAATGGGAGGGAGGGAGG - Intergenic
1083662907 11:64260058-64260080 CTGAGCAATGGGGAGGAGGTAGG + Exonic
1084184993 11:67466803-67466825 CTGAGCAATGGGTAGGAGAGGGG + Intronic
1084317343 11:68353284-68353306 TGGAGCAAAGGGAAGGTGTGGGG - Intronic
1084546433 11:69817353-69817375 CTGCGCACTGGGAAGGCGGGAGG - Intronic
1085463701 11:76710306-76710328 TGGAGGAGTGGGAAGAAGGGGGG - Intergenic
1086195506 11:84134129-84134151 TTGAGCACAGGGAAGGAATGGGG + Intronic
1086401902 11:86467831-86467853 TTGCTCCATGGGAGGGAGGGGGG - Intronic
1086641037 11:89156145-89156167 TGGATGAATGGGAGGGAGGGAGG + Intergenic
1087102904 11:94381958-94381980 AGGAGCAATGGGAAAGAGAGTGG - Intronic
1087344593 11:96955454-96955476 TTGAGCAATCAGAAGGAGTTTGG - Intergenic
1087483447 11:98731611-98731633 TTGAGAGATGGGAAGGAGTCAGG + Intergenic
1088368773 11:109066366-109066388 TTGTGAGATGGGAAGGAAGGTGG + Intergenic
1088783175 11:113155843-113155865 TGGAGGAATGGGGAGGAGAGTGG - Intronic
1089139242 11:116273089-116273111 GGGAGCAAAGGGAAGGAGGAAGG + Intergenic
1089216142 11:116835774-116835796 CTGAGCACCGGGAAGGGGGGCGG + Exonic
1090578239 11:128132262-128132284 TTGAGCAGTGGGAAGGTAGGAGG - Intergenic
1090648857 11:128789114-128789136 TGAAGCAAAGGGAAGGAGGAAGG + Intronic
1091446238 12:545701-545723 GTGAGGAATGGGGAGGAGCGAGG + Intronic
1091446331 12:546020-546042 GTGAGGAATGGGGAGGAGTGAGG + Intronic
1091693246 12:2611156-2611178 TTGATCAATGGGGAGAGGGGAGG + Intronic
1091693298 12:2611414-2611436 TTGATCAATGGGGAGAGGGGAGG + Intronic
1091799182 12:3313947-3313969 CTGAGTAATGGGAAGGGTGGAGG - Intergenic
1091874608 12:3923743-3923765 TTGGACAAAGGGAAGGAGGAGGG - Intergenic
1092337106 12:7642846-7642868 TTGTGCTATGGGAAGAGGGGAGG - Intergenic
1092493443 12:8967969-8967991 TTAAGGAAAGGGAAGGAAGGAGG + Intronic
1092881245 12:12889405-12889427 TTGAGCAATGGAAATGTGGCTGG + Intergenic
1093191365 12:16078660-16078682 ATGAGCAATGAGAAGTAGTGGGG + Intergenic
1095304042 12:40620024-40620046 ATGAGCAATTGACAGGAGGGTGG - Intergenic
1095562214 12:43579034-43579056 TGGAGAACTGGGAAGGAGGGAGG - Intergenic
1095897508 12:47294724-47294746 TTTAGCAGGGGAAAGGAGGGAGG - Intergenic
1097465358 12:59917003-59917025 TTGAGGGGTGGGAGGGAGGGTGG - Intergenic
1097991097 12:65834635-65834657 TTGAAGGAAGGGAAGGAGGGAGG - Intronic
1098129101 12:67329741-67329763 TTGAGGACTGGGAAGCAGAGTGG - Intergenic
1098163226 12:67667641-67667663 GTGCCCAATGGGAAGGATGGAGG - Intergenic
1098524033 12:71465951-71465973 TTGTGCAATGGAAAGGAGTATGG - Intronic
1099611432 12:84877302-84877324 TTTACTAATGGGATGGAGGGTGG - Intronic
1100121621 12:91375267-91375289 CTGGGCAAAGGGAAGGCGGGTGG + Intergenic
1100165717 12:91915317-91915339 TGGAGCAACAGGAAGGTGGGTGG + Intergenic
1100226679 12:92563995-92564017 GTGAGCAGTGGGATGGAGTGAGG + Intergenic
1100396761 12:94192552-94192574 GTCAGCTATGGGAAGAAGGGTGG + Intronic
1100761465 12:97811826-97811848 TGGAGGGAAGGGAAGGAGGGAGG + Intergenic
1101084902 12:101225956-101225978 CTAAGCAATGAGAAGGAGGAGGG - Intergenic
1101542613 12:105678544-105678566 GTGACCACTAGGAAGGAGGGTGG + Intergenic
1102228876 12:111248599-111248621 TTGAGAAATTTCAAGGAGGGGGG + Intronic
1102403084 12:112647790-112647812 TTGAGGAATAGCAAGGAGGGTGG + Intronic
1102623618 12:114216788-114216810 ATGAGGAATGGAAAGGAGGGAGG + Intergenic
1102704694 12:114870828-114870850 CTGAGCAATGGGAAGACAGGAGG - Intergenic
1103021918 12:117541085-117541107 TGGAGGAATGGGAGGCAGGGAGG + Intronic
1103021932 12:117541134-117541156 TGGAGGAATGGGAGGCAGGGAGG + Intronic
1103021978 12:117541318-117541340 TGGAGGCATGGGAGGGAGGGAGG + Intronic
1103027271 12:117583686-117583708 GTGGGCAATGGGCAGTAGGGCGG - Intronic
1103815305 12:123650284-123650306 TCGAGCCATGAGAAGCAGGGAGG - Intronic
1104498122 12:129259863-129259885 TTGAGCAATGGGGCTGAGGTTGG + Intronic
1106114690 13:26807062-26807084 TTGGGCCATGACAAGGAGGGAGG + Intergenic
1106456159 13:29929190-29929212 ATGGGAAATGGGGAGGAGGGAGG + Intergenic
1108065537 13:46573741-46573763 TGGAGGGATGGGAAGGAGGTGGG + Intronic
1108420859 13:50248153-50248175 GTGAGCAAGGGGGAAGAGGGTGG - Intronic
1108613234 13:52104848-52104870 TTGAGCAATTTGGAGGAGGCAGG + Intronic
1111306209 13:86416102-86416124 TTGAACAATGTGATGGAGCGTGG + Intergenic
1111359245 13:87153001-87153023 GTGGGGAATGGGAAGGGGGGAGG + Intergenic
1111662315 13:91226433-91226455 ATGATCTAGGGGAAGGAGGGAGG + Intergenic
1111829915 13:93315074-93315096 TTGATGGATGAGAAGGAGGGAGG + Intronic
1113402481 13:110006662-110006684 TTGAGCAATGGGAGGGAAGGAGG - Intergenic
1114170029 14:20262884-20262906 AAGGGCAAAGGGAAGGAGGGAGG + Intronic
1115199836 14:30841091-30841113 GTGAGCAACGGGAAGGTTGGTGG - Intergenic
1115979694 14:39036626-39036648 TTAAGCATTGGTAAGGAGGCAGG - Intronic
1116830049 14:49710703-49710725 TGAAGGAATGGGAAGGAGAGAGG - Intronic
1117041858 14:51775278-51775300 CTGAGCAATGAGGAGGATGGAGG + Intergenic
1117405005 14:55393483-55393505 CTGAGAAATGGGAAGGAGTCAGG - Intronic
1118075274 14:62291436-62291458 TTGAGAAATGGTAAAGAGGGTGG + Intergenic
1118333332 14:64831227-64831249 TTGAGGAATGGGCAGCAGGAAGG - Intronic
1119071103 14:71585136-71585158 ATGAGAAAAGGGAGGGAGGGAGG + Intronic
1119557790 14:75566912-75566934 CTGAGCAGAGGGAAGGAGGAAGG + Intergenic
1120649094 14:87109593-87109615 TTGAGCACTGGGAAGCAGATGGG - Intergenic
1121016336 14:90551580-90551602 TTGATCAGAGGGAAGCAGGGTGG + Intronic
1121100849 14:91249109-91249131 CTGAGCAAGGGGATGCAGGGTGG + Intronic
1121482622 14:94290722-94290744 TTGAGCCACAGGAAGGAGGCAGG - Intronic
1123062370 14:105600033-105600055 TGGAGCCCTGGGAGGGAGGGAGG + Intergenic
1123797412 15:23785920-23785942 TTCAGAAAGGGGAAGGAAGGCGG + Intergenic
1124939296 15:34203195-34203217 TTGAGAAATTGGAAGGAGGATGG - Intronic
1125546199 15:40507358-40507380 GTGAGCAATGGGAAGCCAGGGGG + Intergenic
1126315455 15:47364758-47364780 TTGGGGGATGGGGAGGAGGGTGG - Intronic
1127337527 15:58004091-58004113 TTGAGCAATGAAAAAGTGGGTGG - Intronic
1128233324 15:66050488-66050510 ATGTGCAAGGGGCAGGAGGGAGG + Intronic
1128250895 15:66163707-66163729 CTGAGTTATGGGAAGGCGGGCGG + Intronic
1128637069 15:69309430-69309452 TTGAGGAATGGGCAGCAGGTGGG + Intronic
1128714228 15:69895455-69895477 CTGAGCAAGAGGAAGGATGGAGG - Intergenic
1129915287 15:79264790-79264812 TTGAAAAAAGGAAAGGAGGGGGG + Intergenic
1130193212 15:81755700-81755722 TTGGGCATTGAGAGGGAGGGAGG + Intergenic
1130541187 15:84821853-84821875 TTGAGCAGTAGGAGGGAGGAAGG + Intronic
1130602484 15:85285828-85285850 TTCAGCAATGGGGAGGAAGTCGG + Intergenic
1130893733 15:88154310-88154332 TGAAGCAGTGGGAAGGAAGGAGG + Intronic
1130925336 15:88381448-88381470 TTGAGGAGTGGGAAGGAGATGGG - Intergenic
1130990720 15:88874126-88874148 TTGAGCAAGGGAAGGGAGGTCGG + Intronic
1131341170 15:91602531-91602553 TATAGGAATGGGAAGGAGGTAGG - Intergenic
1131760792 15:95620457-95620479 TCGGTCAATGGGAAGGTGGGTGG - Intergenic
1132550959 16:553672-553694 TTCAGGGAGGGGAAGGAGGGGGG - Exonic
1132894289 16:2220693-2220715 TTGAGCAGAGGGAATGATGGTGG - Intergenic
1133087433 16:3375854-3375876 AGGAGGAAAGGGAAGGAGGGAGG - Intronic
1133410933 16:5568265-5568287 TTGGGCAAAGGCAAGGAGGTGGG - Intergenic
1133418014 16:5621514-5621536 TTGAGGAAATGGAGGGAGGGAGG + Intergenic
1133720206 16:8487732-8487754 ATGAGAAATGGGAAGGAGAATGG + Intergenic
1134556702 16:15171895-15171917 TTGAGAAGTGGCAAGGAGGTTGG - Intergenic
1134917283 16:18083608-18083630 TTGAGAAGTGGCAAGGAGGTTGG - Intergenic
1135607205 16:23835580-23835602 ATGACCAATGGGATGGATGGGGG + Intergenic
1136028919 16:27488772-27488794 ATGAGCAATGGTAAAGCGGGTGG - Intronic
1136052197 16:27659766-27659788 CTGAGGAATGGGAGGGAGTGTGG + Intronic
1137237913 16:46630356-46630378 TTGGGGAAGGGGAAGGAGGGGGG - Intergenic
1137640257 16:50022814-50022836 CTGACAAATGGGAAGGAGGAAGG + Intergenic
1137774383 16:51043235-51043257 TTGAGACAGGGGAAGGTGGGTGG - Intergenic
1137922380 16:52503526-52503548 ATGAGCAAATGAAAGGAGGGAGG + Intronic
1138183965 16:54962447-54962469 TTGAAGAAAGGGAGGGAGGGAGG - Intergenic
1140013032 16:71155098-71155120 TAGAGCAGTGTGAAGGAGTGAGG - Intronic
1140225220 16:73071403-73071425 TTGAGCGGAGGGAGGGAGGGAGG + Intergenic
1140314275 16:73879509-73879531 ATGAGAAATGGGAAGGAGGTAGG + Intergenic
1140441841 16:74993877-74993899 GTGAGCCATGGCAAGGAGCGTGG - Intronic
1140531543 16:75671023-75671045 TTGAACAAAGGCATGGAGGGAGG - Intronic
1141359951 16:83386388-83386410 TTGAGCCATGGGAAGAAAGCTGG - Intronic
1141690966 16:85595952-85595974 TAGAGGAATGGGTGGGAGGGCGG - Intergenic
1141847096 16:86618296-86618318 TTGAACAAAGGCATGGAGGGAGG - Intergenic
1142218480 16:88841465-88841487 TTGAGGAAAGGGAAGGACGGGGG - Intronic
1142284779 16:89167315-89167337 CTGAGCACTGGGAAGGTGGGGGG - Intergenic
1142959136 17:3541712-3541734 TTGAGCAATGAAAAGAAGGCTGG - Intronic
1143278348 17:5731288-5731310 TCCAGCAGGGGGAAGGAGGGAGG - Intergenic
1143432767 17:6899186-6899208 TTGAGCTATGGGGAGAGGGGAGG - Intronic
1143538398 17:7555507-7555529 GTGAGCCATCGGAAGGAGGAAGG + Intronic
1143621272 17:8081374-8081396 TAGAGCAAGAGGAAAGAGGGTGG - Exonic
1145818175 17:27810612-27810634 TGGGGCAGTGGAAAGGAGGGGGG + Intronic
1146693250 17:34891036-34891058 TGGAGCAAGGGGAGGGTGGGGGG - Intergenic
1147251969 17:39158094-39158116 TCGAAGAAAGGGAAGGAGGGAGG + Intronic
1147550791 17:41440101-41440123 TTGGGCATTGGGATGGAGGGTGG + Intronic
1148671558 17:49414521-49414543 TTGAGGTCTGGGAAGTAGGGAGG - Intronic
1148795066 17:50192951-50192973 GGCAGCAATGGGAAGGAGGTAGG + Intronic
1149330434 17:55575943-55575965 TTGATCAATTGGAGGGACGGTGG - Intergenic
1149728822 17:58924277-58924299 AGGAACAAAGGGAAGGAGGGAGG + Intronic
1151397840 17:73836353-73836375 TAGAGCGATGGGGAGGCGGGGGG - Intergenic
1151624373 17:75267533-75267555 TTGAGCAAGGAGGAGGAGGTGGG - Exonic
1151696862 17:75722274-75722296 CTGAGCCATGGGAAAGAGGGCGG - Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1152016072 17:77751022-77751044 CAGAGCAATGGGAACGAGAGGGG + Intergenic
1152601792 17:81266180-81266202 TGCAGCAATTGGAAAGAGGGAGG + Intronic
1156484048 18:37453621-37453643 AGGAGCAATGGCAAGGAGGTGGG + Intronic
1156596864 18:38557505-38557527 TTGACTAATGGCAAGGAGGAGGG + Intergenic
1156944957 18:42817650-42817672 TTGGTCCAGGGGAAGGAGGGAGG + Intronic
1157357588 18:46949628-46949650 TTGAGCAATCGGATGAATGGTGG - Intronic
1157482271 18:48063068-48063090 TTGGGTGGTGGGAAGGAGGGAGG - Intronic
1157602451 18:48902324-48902346 TGGAGAAAGGGGAAGGAGGGCGG - Intergenic
1157616446 18:48990395-48990417 TACAGCAATGGGCAGGAAGGAGG + Intergenic
1157630534 18:49091156-49091178 TTGCTGAATGGGAGGGAGGGAGG - Intronic
1157634766 18:49141110-49141132 ATGAACAATGGGAAGGAAAGAGG - Intronic
1157777835 18:50410160-50410182 TGGAGCCATGGGCAGGTGGGAGG - Intergenic
1157920966 18:51712194-51712216 TTTAGCAATAGGAGGGAAGGAGG + Intergenic
1159179957 18:64890059-64890081 TTAAGGAAGGGGAAGGAGGAGGG + Intergenic
1160298609 18:77658909-77658931 TTGAGCCATCTGGAGGAGGGAGG - Intergenic
1160298617 18:77658956-77658978 TTGAGCCATCTGGAGGAGGGAGG - Intergenic
1161151666 19:2713282-2713304 GTGAGGAATGGGATGAAGGGTGG - Intergenic
1161151755 19:2713634-2713656 GTGAGGAATGGGATGAAGGGTGG - Intergenic
1161151829 19:2713898-2713920 GTGAGGAATGGGATGAAGGGTGG - Intergenic
1161151841 19:2713942-2713964 GTGAGGAATGGGATGAAGGGTGG - Intergenic
1161496735 19:4590701-4590723 GTGAGGAATGGGAGGAAGGGAGG + Intergenic
1161575078 19:5050585-5050607 TTGATCTATGGCAAGGAGTGTGG - Intronic
1161653141 19:5497528-5497550 GTGAGCAATGGGAGAGAAGGAGG + Intergenic
1162743941 19:12788877-12788899 TCAAGCAAGGGGAAGAAGGGAGG + Intronic
1163123761 19:15233172-15233194 ATGGGCAATGAGACGGAGGGCGG + Intronic
1163785791 19:19274291-19274313 CTGAGCAGTGGAAAGGAGGTCGG + Intergenic
1165258108 19:34592192-34592214 TTGGGCAGTGGGAGTGAGGGAGG + Intergenic
1165637573 19:37355102-37355124 CTGAGAAAGGGGAAGGAAGGAGG - Intronic
1166392877 19:42419661-42419683 CTGAGCAGGGGTAAGGAGGGCGG + Intronic
1166438697 19:42791583-42791605 TTGTGCTATGGGAAGAGGGGAGG + Intronic
1166487656 19:43227437-43227459 TTGTGCTATGGGAAGAGGGGAGG + Intronic
1166494491 19:43289309-43289331 TTGTGCTATGGGAAGAGGGGAGG + Intergenic
1166515131 19:43440806-43440828 GTGAGCAATGGAAAGAAGGCTGG + Intergenic
1166658414 19:44628898-44628920 TTGAACAAAGGGAGGGAGTGGGG + Intronic
1167103603 19:47418599-47418621 TAGAGCGAAGGGAAGGACGGAGG + Intronic
1167324909 19:48818451-48818473 GTGGGCACTGGGAGGGAGGGAGG - Intronic
1167525800 19:49983132-49983154 GGGAGCCATGGGAGGGAGGGTGG - Intronic
1167717207 19:51151276-51151298 CTGAGCAGTGGGAAGAATGGAGG + Intronic
1168095055 19:54109808-54109830 CTGAGCACTGGGACTGAGGGAGG - Intronic
1168095067 19:54109846-54109868 CTGAGCACTGGGACTGAGGGAGG - Intronic
925239675 2:2312839-2312861 TGGAGAAATGGGAAGAAAGGGGG + Intronic
925525055 2:4790688-4790710 GTGAGCAATGCGAAGGAGATGGG - Intergenic
926036346 2:9638728-9638750 ATGACTAAGGGGAAGGAGGGCGG - Intergenic
926753434 2:16217743-16217765 TTGGTCAAGGGGAGGGAGGGAGG + Intergenic
927499765 2:23574943-23574965 CTGAGGAATGGGTGGGAGGGTGG + Intronic
927552561 2:24011979-24012001 TTGAGGAATAGGAAGGAGCCCGG + Intronic
927735188 2:25514356-25514378 TAGAGCAATGGGAAAGTGGCAGG + Intronic
927962942 2:27251855-27251877 TCGAGGAGAGGGAAGGAGGGTGG - Intergenic
928326923 2:30326623-30326645 TGGGGCAGTGGGAAGGTGGGTGG - Intergenic
928572943 2:32627123-32627145 CTGGGCAATAGGAAAGAGGGAGG - Intergenic
928884358 2:36131150-36131172 TGTTGCAATGGGAAGGAGGGAGG - Intergenic
929891703 2:45923797-45923819 AGGAGCAGAGGGAAGGAGGGAGG + Intronic
930607160 2:53504612-53504634 GTGAGGAATGGGAGGGAGGCAGG + Intergenic
930762512 2:55050834-55050856 TAGAGCACTGGGAAAGGGGGCGG + Intronic
932197311 2:69795916-69795938 TTGTGCTATGGGAAGAGGGGAGG + Intronic
933084070 2:78032784-78032806 TGGAGAAGTGGTAAGGAGGGAGG - Intergenic
933835264 2:86240710-86240732 GTGAGCAGTGTGAAGGAGGCAGG + Intronic
934712053 2:96522747-96522769 CTGAGCAAAGGGCAGGAGGCAGG + Intergenic
934751752 2:96798296-96798318 TTGTGGAATGGGAAGGAGAAGGG + Intronic
934874912 2:97908571-97908593 ATGAGCAAGGGGAAAGAGGAGGG + Intronic
935593017 2:104857724-104857746 CTCTGAAATGGGAAGGAGGGGGG + Exonic
935715037 2:105932184-105932206 ATGGGCAATGGGAAGGAGGTGGG - Intergenic
936242658 2:110801222-110801244 GAGAGCACTGGGAAGGAGGAGGG + Intronic
936284711 2:111173234-111173256 TGGGGCAGTGGGCAGGAGGGGGG - Intergenic
937118685 2:119427323-119427345 TTGAGGAGTTGGAAGGTGGGAGG - Intergenic
937415791 2:121713510-121713532 CTGAGCAACTGGAAGAAGGGAGG - Intergenic
937705682 2:124918181-124918203 CTGAGAAAAGGGAAGGAGAGGGG - Intergenic
937815935 2:126251065-126251087 GTGAGCTTTGGGAAGTAGGGAGG - Intergenic
937871987 2:126792575-126792597 TAGAGCAAGGGAAAGGAGGAAGG - Intergenic
939119869 2:138103464-138103486 TTGATCAATGGCAAGGTTGGAGG + Intergenic
939434259 2:142153453-142153475 TTAAGCAATGGAAAGGAAGGAGG - Intergenic
939802426 2:146726630-146726652 TTAAGCAGGGGGAATGAGGGAGG + Intergenic
939806956 2:146785615-146785637 GTGAGCAATGGGAAAGACTGAGG - Intergenic
940261582 2:151785428-151785450 TTGAGAAATGGGAAAGAAGGAGG + Intergenic
940989844 2:160086050-160086072 TTGTGCTATGGGAAGAGGGGAGG + Intergenic
941696451 2:168557705-168557727 TTGAACATTGGGAATGAGGGAGG + Intronic
942216183 2:173720985-173721007 TTCAGGAAAGGAAAGGAGGGGGG + Intergenic
942243879 2:173989813-173989835 CAGAGCACTGGGAGGGAGGGGGG - Intergenic
942729135 2:179044462-179044484 TTGAGCACAGGGTAGGAGGCAGG + Intronic
944827586 2:203501027-203501049 TAGAGAAAGGGGCAGGAGGGAGG + Intronic
945417880 2:209597804-209597826 GTAAGCAAAGGGGAGGAGGGTGG - Intronic
945435552 2:209813319-209813341 TTGAGGTTTGGGCAGGAGGGAGG - Intronic
945969548 2:216222409-216222431 TTGAGCTATGGGAATGAGATAGG - Intergenic
946896375 2:224328394-224328416 TTGAGAAATGGGAGTGTGGGAGG - Intergenic
947293437 2:228603280-228603302 GTGAGCATTGGGAAGTTGGGGGG + Intergenic
947331670 2:229035451-229035473 GTGAGTAGAGGGAAGGAGGGGGG - Intronic
947403639 2:229752725-229752747 TTGAAGAATGGGGAGCAGGGTGG + Intergenic
948676268 2:239598661-239598683 GAGAACACTGGGAAGGAGGGAGG - Intergenic
1168901494 20:1368893-1368915 TTGGGCAGGGTGAAGGAGGGTGG - Intronic
1168904341 20:1391807-1391829 TTGAGAAAGGGGAAGGAGGAGGG + Intronic
1168961878 20:1875645-1875667 ATGAGCAAAGGTAAGGAGGGAGG - Intergenic
1169115973 20:3066155-3066177 TTGAGCAATGGGAAGGATGAAGG - Intergenic
1169218068 20:3804735-3804757 TGGAGCCATGGGATGGGGGGTGG + Intronic
1169278909 20:4250762-4250784 CTGGGCAATGGGGAGGAGGGAGG - Intergenic
1169292412 20:4364137-4364159 TTGAGGGATGGGAAGAAGGATGG + Intergenic
1169421944 20:5467441-5467463 ATAAGAAATGGGAGGGAGGGAGG - Intergenic
1170296535 20:14832378-14832400 GAGAGGGATGGGAAGGAGGGAGG + Intronic
1170930568 20:20766602-20766624 GTGAGCACTGGGTAGGTGGGTGG + Intergenic
1171388012 20:24783159-24783181 CTGGGCAGGGGGAAGGAGGGAGG - Intergenic
1172479142 20:35260739-35260761 TTGAGCAACGGAAAGGAAGGGGG - Intronic
1172581891 20:36054908-36054930 TTGAGCACTTGGAATGAGGGTGG - Intergenic
1172874205 20:38154488-38154510 TTGAGCAAGGGGGAGGAGGCAGG - Intronic
1173659312 20:44722397-44722419 CTGAGCCATGAGAAGGATGGAGG - Intronic
1174349397 20:49956221-49956243 TTGAGCAATTAGAAGGATGGTGG - Intergenic
1174389024 20:50205931-50205953 TTAAGCAATGAGAAGGAGAGAGG + Intergenic
1174412759 20:50346552-50346574 TTGAGCAAGGGTAAGGAGGTGGG - Intergenic
1174818529 20:53707847-53707869 CTGACCAGTGGGAAGGAAGGTGG + Intergenic
1175924983 20:62467131-62467153 GAGAGCCACGGGAAGGAGGGAGG - Intronic
1176112838 20:63418353-63418375 TTCACCATTGGGAGGGAGGGTGG - Intronic
1176368801 21:6050164-6050186 TTCGGCCATGGAAAGGAGGGAGG - Intergenic
1179031809 21:37727154-37727176 TTGAGCTTTTGGAGGGAGGGTGG + Intronic
1179107047 21:38410575-38410597 ATAAGCAGTGGGAGGGAGGGAGG + Intronic
1179456483 21:41504505-41504527 CTGAGCAATGGTCAGGAGAGAGG - Intronic
1179754718 21:43488378-43488400 TTCGGCCATGGAAAGGAGGGAGG + Intergenic
1179793505 21:43768957-43768979 TTCAGATGTGGGAAGGAGGGAGG + Intergenic
1180164514 21:46017031-46017053 TCTAGCAAAGGGAGGGAGGGAGG + Intergenic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1181309441 22:21936631-21936653 TTGAGCGATGAGAGGGAGGGAGG - Intronic
1183102569 22:35592987-35593009 ATCAGAAATGGGAAAGAGGGAGG + Intergenic
1183228007 22:36563482-36563504 TTGAGGAAAGGGAAGGAGAGGGG - Intergenic
1183618519 22:38959428-38959450 CGGAGCAGGGGGAAGGAGGGTGG + Intronic
1183891048 22:40929000-40929022 TTGAGAAATTGGAGGGAGGTGGG - Exonic
1184468731 22:44683747-44683769 ATGAGCCATGGGGAGGAGAGAGG - Intronic
1184897837 22:47422402-47422424 TTGTGCGATTGGAATGAGGGTGG - Intergenic
1185081658 22:48712788-48712810 CACAGGAATGGGAAGGAGGGCGG - Intronic
1185208051 22:49551523-49551545 CTGGGCACTGGCAAGGAGGGAGG - Intronic
949241707 3:1880512-1880534 ATGAGGAGTGGGGAGGAGGGTGG - Intergenic
949847228 3:8384038-8384060 TGGAGCACTGGGAAGGAGTAAGG - Intergenic
950156272 3:10723765-10723787 CTGAGTGTTGGGAAGGAGGGTGG + Intergenic
950182229 3:10922595-10922617 GGGAGGAATGGGAATGAGGGAGG + Intronic
950480844 3:13242837-13242859 TGGAGCAAAGGGAGAGAGGGAGG + Intergenic
950522432 3:13505101-13505123 ATGACCAAGGGGAGGGAGGGAGG - Exonic
951044844 3:18026568-18026590 AAGAGAAATAGGAAGGAGGGGGG - Intronic
951858870 3:27228325-27228347 CTGAGCAATGGGAGGGAAAGTGG - Intronic
952496367 3:33919383-33919405 TGGAGGAATGGGATGGAGGAGGG + Intergenic
952955998 3:38557586-38557608 TTTAGAAATGGAAATGAGGGTGG - Intronic
953079068 3:39598455-39598477 TGGAGCTCTGGGAAAGAGGGTGG - Intergenic
954391024 3:50267947-50267969 CTGACCCCTGGGAAGGAGGGTGG + Intronic
954584588 3:51722257-51722279 CTCAACAATGGGAAGGAGGCAGG + Intergenic
954922087 3:54200010-54200032 TTGAGCAGTGGGATGGAGATTGG + Intronic
955796703 3:62644733-62644755 TTGAGCAATGGGAGTGGGGATGG - Intronic
955867925 3:63405132-63405154 TTGAGAAAGGGGAAGGACAGAGG - Intronic
955896440 3:63705697-63705719 GTGAGCAAAGGCAAGGAGGAAGG + Intergenic
956491560 3:69777851-69777873 TTAAGCCATGGTAAGAAGGGTGG + Intronic
957136979 3:76300945-76300967 CTAAGCAATGGGAAGGAGATGGG + Intronic
958119416 3:89264454-89264476 CTGAGCAAGGGGTACGAGGGAGG - Intronic
958833545 3:99117654-99117676 TTGGGCAATAGGAAGGAAGAAGG + Intergenic
958921831 3:100115216-100115238 TTGAGCACTGGGCAGGTGGTAGG - Intronic
959311695 3:104745955-104745977 GAGAGTAATGGGAAGGAAGGGGG + Intergenic
960012580 3:112849552-112849574 TTCAGCAAAGGGTAGGAGCGGGG - Intergenic
960556741 3:119038408-119038430 TTGGGCTATGGGGAGGAGGATGG - Intronic
960581259 3:119281046-119281068 TGGAGCAATGGGAAGTCAGGTGG + Intergenic
961237657 3:125381462-125381484 TTGAGCAATTGAAAGAAGTGAGG - Intergenic
962410855 3:135140734-135140756 TTGAGCAATTGCAGGGAGGGTGG + Intronic
963300464 3:143591865-143591887 ATAGGCATTGGGAAGGAGGGAGG + Intronic
963726286 3:148925602-148925624 TTTAGCCATGGGAATGAAGGAGG - Intergenic
963863623 3:150336219-150336241 TAGAGAAAGGGGAAGGAGAGTGG - Intergenic
964132807 3:153310083-153310105 TTGAGAAATGGGCTGGAGTGTGG + Intergenic
964958165 3:162388441-162388463 TTGTGAAATTGGGAGGAGGGAGG - Intergenic
965689846 3:171344003-171344025 TTGAGCAATGGGAAGGAGGGAGG - Intronic
966497084 3:180593332-180593354 TTGAGAAATAGCAAGGAAGGCGG - Intergenic
966518541 3:180847041-180847063 TTGACCCTTGGGAAAGAGGGAGG - Intronic
966688669 3:182722793-182722815 TTGTGCTATGGGAAGAGGGGAGG + Intergenic
968633548 4:1665820-1665842 ATGAAGAATGGGAGGGAGGGAGG + Intronic
968718500 4:2179921-2179943 TCGAGCAAAAGGAAGAAGGGCGG + Intronic
969294880 4:6263933-6263955 GGGAACACTGGGAAGGAGGGAGG + Intergenic
969561334 4:7950249-7950271 GTGAGCAAGGGGATGGATGGTGG - Intergenic
970413982 4:15838461-15838483 GTGAGCAATGGGTAGGGTGGAGG - Intronic
972335283 4:38102458-38102480 TTGAGAAGTGAGAAGAAGGGAGG + Intronic
972469503 4:39390162-39390184 CTGAGCAAATGGAAGGATGGAGG - Intergenic
973104372 4:46315513-46315535 TTGAGGAATGTCAAGGAGTGGGG - Intronic
973151806 4:46897664-46897686 TTGAGCAGTGGAGAGGAAGGAGG - Intronic
973343215 4:49027329-49027351 TTGAGCAACTGGATGAAGGGAGG + Intronic
973602899 4:52559636-52559658 TTGAGGAAGGGGAAGGGAGGTGG + Intergenic
973798020 4:54448811-54448833 TTGGTCAATGGGCAGGAGGAGGG - Intergenic
974707546 4:65541046-65541068 ATGAGAAAGGGGAAGGAGGGAGG - Intronic
975338737 4:73212131-73212153 TTGGGCAGAGGGAAAGAGGGTGG + Intronic
975912686 4:79286347-79286369 TTGAGCAATGAGGATGAGGTGGG + Intronic
977338343 4:95726285-95726307 TTGAAGTATGTGAAGGAGGGAGG + Intergenic
977763603 4:100771190-100771212 GGAAGGAATGGGAAGGAGGGAGG + Intronic
978184752 4:105843919-105843941 TTTGGCAATGGGAAGAACGGGGG + Intronic
981046667 4:140271108-140271130 TGAAGCAATGAGAAGGAGGAGGG + Intronic
981790208 4:148527512-148527534 TTTAGCAATGGGAAGGGCAGAGG - Intergenic
981955606 4:150469714-150469736 TAGAGAAATGGGAAAGAGTGAGG - Intronic
982694137 4:158580469-158580491 TTGAGAAGTGGGAGGCAGGGAGG - Intronic
983062467 4:163174893-163174915 TTGTGCTATGGGAAGAGGGGAGG - Intergenic
984759803 4:183353824-183353846 CTGAGCCATAGGAAAGAGGGTGG - Intergenic
985159631 4:187031132-187031154 TTGTGGGATGGGAGGGAGGGGGG - Intergenic
985309248 4:188579179-188579201 TTGAGCAATGGGACTTGGGGTGG - Intergenic
986519365 5:8597523-8597545 ATGAACATTGGGAAGGAGGATGG + Intergenic
987483422 5:18490748-18490770 GTGAGCAATGGGACGGAAGTCGG + Intergenic
990852943 5:60227609-60227631 GGGAGGAAAGGGAAGGAGGGAGG + Intronic
992207872 5:74448596-74448618 TTGTGCTATGGGAAGGAGAAAGG + Intergenic
992729121 5:79640317-79640339 TAGAAGAATGGGATGGAGGGTGG + Intronic
993857719 5:93096736-93096758 TTGGGAAATGGCCAGGAGGGAGG + Intergenic
994090299 5:95803858-95803880 TTGGGCAATGTGAGGGAGGCTGG + Intronic
994388678 5:99163531-99163553 CTCAGAAATGGGAAGGTGGGAGG + Intergenic
995242185 5:109898089-109898111 CTGAGAGATGGGAAAGAGGGAGG + Intergenic
995865708 5:116688274-116688296 GGGAGGAATGGGAGGGAGGGAGG - Intergenic
996993608 5:129667596-129667618 GGGAGCAAGGGGCAGGAGGGTGG - Intronic
997475066 5:134138036-134138058 CTGAAAAATGAGAAGGAGGGTGG - Intronic
997702994 5:135917897-135917919 TAGGGCAGAGGGAAGGAGGGAGG + Intergenic
997803463 5:136889773-136889795 TTGAGCAATTGGTAGAAGAGAGG + Intergenic
998679916 5:144455560-144455582 TTAAGCAATGGGATGAAGGCAGG + Intronic
999042361 5:148428094-148428116 TTCAGCAATGGTTTGGAGGGTGG + Intronic
999977938 5:156930347-156930369 TTGAGCAATGTGATGGAGGTTGG + Intronic
1000062962 5:157672317-157672339 TTGTGGAATGGAAAGGAGCGCGG - Intronic
1000104319 5:158044415-158044437 TTGGGGAAAGGGCAGGAGGGGGG + Intergenic
1000234190 5:159342397-159342419 TGGAGGAATGGAAAGGAGGTTGG + Intergenic
1000934615 5:167292876-167292898 TTGAGGGATGGGGAGGAGGTTGG + Intronic
1001129930 5:169055443-169055465 TTGAGCAAAGGGCCGGAGGCAGG + Intronic
1002095741 5:176829663-176829685 TGGATCAATGGGAGGGAAGGTGG + Intronic
1003731369 6:8828267-8828289 TTTAGCTAGGTGAAGGAGGGTGG - Intergenic
1004702332 6:18091045-18091067 GTGAGCAATGGCAAGGAGGGAGG - Intergenic
1005143612 6:22662711-22662733 TAGACCAATGGGAATGTGGGTGG + Intergenic
1005420259 6:25641268-25641290 TTCACCAGTGGGAAGGAGAGAGG - Intergenic
1006750270 6:36372660-36372682 CTGAGCAATTGGAAGGGTGGAGG + Intronic
1006812337 6:36827987-36828009 TTCCGCAAGGGGAAGCAGGGAGG - Intronic
1007933443 6:45712749-45712771 TTGAGTAATGGGTAGGGGGTGGG + Intergenic
1008474993 6:51927140-51927162 TTTAGGACTGGGAAGGAAGGAGG - Intronic
1008957654 6:57233613-57233635 GGGAGGAAAGGGAAGGAGGGAGG - Intergenic
1009428730 6:63542784-63542806 TAGAGCAATGGAAAGGATGTAGG - Intronic
1009809050 6:68637281-68637303 TTATGCAATGGGAAGGAAGAGGG + Intronic
1010389670 6:75322389-75322411 TTGAAGAATGGGAAGGTGAGCGG - Intronic
1011898571 6:92262873-92262895 TTGAGGAATAGCAAGGAGGCTGG + Intergenic
1011970207 6:93212806-93212828 TTGAGAAAAGGGCAGGAGGTAGG + Intergenic
1012572341 6:100744267-100744289 TAGAGCACTGGGAAGGAGAATGG + Intronic
1013589317 6:111606821-111606843 TTAAACAATGGGAAGGAAAGGGG - Intergenic
1014307897 6:119765394-119765416 TTGGATAAGGGGAAGGAGGGTGG + Intergenic
1014459060 6:121673565-121673587 GGGAGCAAGGGGAAGGAAGGCGG - Intergenic
1014488295 6:122028959-122028981 GTGTGCCATGGGAAGGAGAGAGG + Intergenic
1015185986 6:130416474-130416496 TTGAGCAATTGGATGGATGATGG - Intronic
1015579048 6:134703525-134703547 GTGAGTGGTGGGAAGGAGGGAGG + Intergenic
1015935345 6:138402831-138402853 AAGAGAAATGGGAAGGAGGGTGG - Intergenic
1016360356 6:143260909-143260931 ATGAGCAAAGGGATGGCGGGGGG - Intronic
1017757620 6:157542838-157542860 CTGAGCGCTGGGAAGGAAGGAGG + Intronic
1018305207 6:162447815-162447837 TTGACCAATGACAAGGAGGATGG - Intronic
1018390980 6:163341785-163341807 TTGAGCAATTCTAATGAGGGAGG + Intergenic
1019845351 7:3494129-3494151 TGGGGCAGTGGGGAGGAGGGAGG - Intronic
1020140264 7:5607878-5607900 TTGAGACCTGGGGAGGAGGGTGG + Intergenic
1021266048 7:18523913-18523935 ACAAGCAATGGGAAGCAGGGCGG - Intronic
1021329922 7:19323918-19323940 TGGAACAAAGGGAGGGAGGGAGG + Intergenic
1022389227 7:29928955-29928977 TGGAGCAGTGGGGAGGAGGAGGG + Intronic
1023119989 7:36899452-36899474 ATGAGCAAAGGCAAGGAGGTAGG + Intronic
1023457390 7:40355179-40355201 TTGAGCCATGGGAAGGACACTGG + Intronic
1023516214 7:41004410-41004432 TTGAGCAATCCTAAGCAGGGTGG + Intergenic
1024742777 7:52372843-52372865 TGAAGCAATGGGAAGTAAGGGGG - Intergenic
1024877034 7:54037570-54037592 TAGAGCTGTGGGAAGGAAGGAGG - Intergenic
1026153698 7:67809598-67809620 TTGAGCAATTGGGTGGATGGTGG - Intergenic
1026502866 7:70957768-70957790 TTGAGCAATGTGGAGGAGAGAGG + Intergenic
1026789476 7:73322450-73322472 TTAGTTAATGGGAAGGAGGGAGG - Intronic
1027136616 7:75628984-75629006 TTGAGCTAGGGGGAGTAGGGAGG + Intronic
1027354597 7:77342976-77342998 TTAAGGAATGGAAAGGAGAGTGG - Intronic
1027867231 7:83663302-83663324 TTGCGCTCTGGGAAGGAAGGTGG - Intergenic
1028547328 7:92017985-92018007 TTGAGTAATGGAAAGGGAGGAGG + Intronic
1029971612 7:104795306-104795328 TCCGGCAATGGGAAGGAGGATGG - Intronic
1030333143 7:108294640-108294662 TTGTGCAATGGGAAGGAAAATGG + Intronic
1031077055 7:117223039-117223061 TTGAGCAACGGGGTGGATGGCGG - Exonic
1031446123 7:121857020-121857042 TTGAAGAATGGGAGGGAGGGAGG + Intergenic
1031989250 7:128186354-128186376 GGGAGGAAAGGGAAGGAGGGAGG - Intergenic
1032436789 7:131907339-131907361 GAGGGCAAAGGGAAGGAGGGAGG + Intergenic
1033419331 7:141192450-141192472 TTGAGAGATGGGAAGGAATGGGG + Intronic
1033589549 7:142797804-142797826 TTGGGGAATGGGTAGGAGTGGGG + Intergenic
1034339358 7:150341793-150341815 TGGATCGAGGGGAAGGAGGGGGG - Intergenic
1034525241 7:151655487-151655509 TTTAGCAATGGTAAGGAGTATGG + Intronic
1035415773 7:158684340-158684362 TTAAGAAAAGGAAAGGAGGGAGG + Intronic
1036102925 8:5807122-5807144 TTGAGGTGTGGGAAGGAGGCGGG + Intergenic
1036236712 8:7045144-7045166 TGGAACAATGGGAAGGAAGTAGG + Intergenic
1036978763 8:13445030-13445052 TTGAGAGAAGGGAAGGAGAGAGG + Intronic
1037116534 8:15236100-15236122 CTGGGCAAAGGGAAGTAGGGAGG - Intronic
1037225170 8:16578833-16578855 TTGAGCAATAGATAGGAGGTAGG - Intergenic
1037234326 8:16699179-16699201 TTCAGCAATGAAAAGGAGTGAGG - Intergenic
1037776240 8:21837806-21837828 GTGGGCAGAGGGAAGGAGGGAGG - Intergenic
1037989639 8:23311678-23311700 TCGAGCCATGGGTAGGTGGGAGG - Intronic
1038338405 8:26663538-26663560 TTTAGCCATGGCCAGGAGGGAGG - Intergenic
1038546044 8:28426519-28426541 TTGAGCAATGGGAAAGGGCGTGG - Intronic
1038695097 8:29799420-29799442 TTGAGCAATGGGTGGGAGTAGGG + Intergenic
1039971271 8:42323559-42323581 AAGAGCAAAGGGAAGGAGAGAGG + Intronic
1039990231 8:42481503-42481525 GAGAGACATGGGAAGGAGGGAGG + Intronic
1040369905 8:46759296-46759318 TTGAGGGATTGAAAGGAGGGAGG - Intergenic
1041321243 8:56615138-56615160 AAGAGGAAGGGGAAGGAGGGAGG - Intergenic
1041785660 8:61630313-61630335 TTGAAAAATGGCAAGGAGGTAGG + Intronic
1041847858 8:62352222-62352244 CTCAGCAATGGGAAGGAGTCAGG - Intronic
1042408102 8:68429410-68429432 TAGAGAAATGGGAATGCGGGTGG + Intronic
1043049446 8:75366647-75366669 TTAAGCAATGGCAAGGAATGTGG + Intergenic
1046534844 8:115496034-115496056 TTGAGCCATGAGAAGCAGAGGGG - Intronic
1046802844 8:118448081-118448103 TTGAGCAATAGGAAGAAGACTGG - Intronic
1048869347 8:138784296-138784318 TTGTTCAATGGGAAGGATAGGGG + Intronic
1050669322 9:7978593-7978615 ATGGGCAATGGCAAGGAGTGAGG + Intergenic
1051893455 9:21965851-21965873 TTGAGGAAGGGTAAGGAGGAAGG + Intronic
1052177587 9:25482813-25482835 TAGAGCAATGGGGAGGTGAGAGG + Intergenic
1053462661 9:38282509-38282531 ATGAGGCATAGGAAGGAGGGTGG + Intergenic
1055588477 9:77783610-77783632 CTGAGCAGTGGGAAGGTAGGTGG - Intronic
1055766614 9:79670499-79670521 TTGAGCAGTGGGAAAGGAGGGGG - Intronic
1055937057 9:81613242-81613264 TTCAGAGATAGGAAGGAGGGTGG + Intronic
1056326689 9:85485876-85485898 TTAGCCAATGGGAAGGAGGGAGG - Intergenic
1057519705 9:95751534-95751556 CTGAGCTGTGGGAGGGAGGGAGG + Intergenic
1057521315 9:95762738-95762760 GTGAGCCATGGAAAGGGGGGAGG + Intergenic
1057651614 9:96924856-96924878 GTGAGCAAGGGAAAGGAGCGCGG + Intronic
1057851815 9:98571946-98571968 TGGGGCACTGGGGAGGAGGGAGG - Intronic
1059835757 9:118150240-118150262 CTGAGCAATGGGAGGGAAAGTGG + Intergenic
1060120275 9:120982347-120982369 TTGAGAAATGGGAAGCAGGAAGG - Intronic
1060226897 9:121797312-121797334 TGGAGCAACGGGGAGGAGAGTGG - Intergenic
1060453902 9:123771853-123771875 TTAAGCAATAGGATGGGGGGAGG + Intronic
1060892597 9:127198278-127198300 CTGAGCACTGGGAAAGGGGGAGG - Intronic
1061039682 9:128132779-128132801 TTGGTCAAGGGAAAGGAGGGGGG - Intergenic
1061045248 9:128161431-128161453 TAGAACAGTGGGGAGGAGGGTGG + Intronic
1061890780 9:133618002-133618024 ATGGCCAATGGGAGGGAGGGAGG + Intergenic
1203446636 Un_GL000219v1:63216-63238 GTAAGGAAAGGGAAGGAGGGAGG - Intergenic
1203343889 Un_KI270442v1:17810-17832 TTGAGCAATGTGGAGTAGAGTGG + Intergenic
1187141915 X:16602041-16602063 ATGAGCAATGGGGATGAGGGAGG + Intronic
1187215012 X:17267662-17267684 TAGAGGAGTGGGAAGGAGGGGGG + Intergenic
1187415564 X:19090339-19090361 AGGAGCAATGGGTAGAAGGGAGG - Intronic
1189457650 X:41207846-41207868 ATGAGAGATGGGAGGGAGGGTGG - Intronic
1189584435 X:42443688-42443710 GGGAGCAATGGGATGGAGGTTGG - Intergenic
1189860523 X:45266496-45266518 CTGAGCAAGGGGCAGGAGTGGGG - Intergenic
1189932768 X:46032678-46032700 ATGAGCAAAGGGAAAGATGGGGG + Intergenic
1190616140 X:52234546-52234568 TTGAAGGATGGGAAGGTGGGAGG - Intergenic
1191811487 X:65193996-65194018 TGGAGCAAGAGGAAGAAGGGTGG + Intergenic
1192238876 X:69314119-69314141 ATCAGCAATGGGAGGGATGGGGG - Intergenic
1193348198 X:80428920-80428942 TTGTGCAGTGGGAGGAAGGGAGG + Intronic
1193743959 X:85252644-85252666 TTCAGAAATGGGGAGGAGGTGGG - Intronic
1193954011 X:87835838-87835860 TTGCCCAATGGCAAGAAGGGTGG + Intergenic
1194544625 X:95217934-95217956 GTGGGCAGTGGGCAGGAGGGAGG + Intergenic
1195684837 X:107576268-107576290 TGAAGACATGGGAAGGAGGGAGG - Intronic
1195954622 X:110317036-110317058 TTGTGCCCTGGGAAGGGGGGAGG - Intronic
1196179312 X:112672601-112672623 TAGAGGACTGGGAAGGAGGTTGG + Intronic
1196824660 X:119731636-119731658 GTGAGCCATGGCAAGGAGTGGGG + Intergenic
1197325043 X:125082455-125082477 TTTAGCAATAGGAGGGAGGCAGG - Intergenic
1197407585 X:126071145-126071167 CTGAGGAGTGGGAAGAAGGGAGG + Intergenic
1197592316 X:128423521-128423543 ATGAGCAATGGGAAGAATAGTGG - Intergenic
1198575729 X:138008519-138008541 TTGAGTGATGGGGAAGAGGGGGG - Intergenic
1199418404 X:147614301-147614323 TTGAGCAATGTGAAGGTTAGGGG - Intergenic
1201341104 Y:12935510-12935532 AGGAGGAAAGGGAAGGAGGGAGG - Intergenic
1201341119 Y:12935552-12935574 GGGAGGAAAGGGAAGGAGGGAGG - Intergenic
1201702555 Y:16900472-16900494 GAGGGAAATGGGAAGGAGGGAGG - Intergenic