ID: 965690297

View in Genome Browser
Species Human (GRCh38)
Location 3:171349153-171349175
Sequence CTGTTTTTCTTGAGAGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 501
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 451}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965690297_965690300 15 Left 965690297 3:171349153-171349175 CCTTCATCTCTCAAGAAAAACAG 0: 1
1: 0
2: 4
3: 45
4: 451
Right 965690300 3:171349191-171349213 ACTTCCACCACCAATCTACTGGG 0: 1
1: 0
2: 1
3: 14
4: 176
965690297_965690299 14 Left 965690297 3:171349153-171349175 CCTTCATCTCTCAAGAAAAACAG 0: 1
1: 0
2: 4
3: 45
4: 451
Right 965690299 3:171349190-171349212 AACTTCCACCACCAATCTACTGG 0: 1
1: 0
2: 0
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965690297 Original CRISPR CTGTTTTTCTTGAGAGATGA AGG (reversed) Intronic
900823499 1:4908342-4908364 CTGCTTTTCTTGATGTATGACGG + Intergenic
902555880 1:17246314-17246336 CTGTTGTCCCTGAGAGATGGAGG - Intergenic
904438545 1:30515055-30515077 GTGTTTTTCTTGAGAAGAGAAGG - Intergenic
905163817 1:36063918-36063940 GTTTTTTTCTTTAGAGATGGGGG + Exonic
905227745 1:36490664-36490686 CTGTTCATCTTGTGAGTTGATGG + Intergenic
905251979 1:36655136-36655158 CTGTTTTTCTGGAGAGACTTTGG - Intergenic
905638159 1:39569794-39569816 TGTTTTTTCTTAAGAGATGAGGG - Intronic
906690075 1:47786713-47786735 TTGTTTTTTTTTAGAGATGAGGG + Intronic
907099909 1:51821548-51821570 CAGTGTTTCTTGAGAGGGGAGGG + Exonic
907629324 1:56064074-56064096 CTGCTTTTCTAGAGAAATCAAGG + Intergenic
907698864 1:56763420-56763442 CAGTTTTTCTTGAGAGTTACAGG + Intronic
909139503 1:71845934-71845956 TTTTTTTTTTTAAGAGATGAGGG + Intronic
910503500 1:87922630-87922652 TAGTGTTTCTTGAGAGTTGAGGG + Intergenic
910641646 1:89470151-89470173 CTATTTATCTTTAGAGCTGATGG + Intergenic
910975940 1:92905795-92905817 TTGTTTTTGTTGAGAGATAGGGG + Intronic
911024686 1:93424338-93424360 TTTTTTTTCTTAAGAGATAAAGG - Intergenic
912516680 1:110220670-110220692 CTGTTTTTCAGGAGAGAGGGTGG + Intronic
912994984 1:114523788-114523810 TTTTTTTTTTTTAGAGATGAGGG + Intergenic
913560696 1:120015943-120015965 CTTTTTTTTTTGAGAGAAGGGGG - Intronic
913606499 1:120472031-120472053 CTGATTTTCAGTAGAGATGAGGG + Intergenic
913637430 1:120777659-120777681 CTTTTTTTTTTGAGAGAAGGGGG + Intergenic
914268853 1:146060485-146060507 CTGATTTTCAGTAGAGATGAGGG - Intergenic
914368242 1:147000384-147000406 CTGATTTTCAGTAGAGATGAGGG + Intergenic
914374212 1:147059104-147059126 CTGATTTTCAGTAGAGATGAGGG + Intergenic
914584696 1:149049808-149049830 CTGATTTTCAGTAGAGATGAGGG - Intergenic
914759871 1:150589953-150589975 ATGTTTTTCTTAAGAGTTGTTGG - Intergenic
914971992 1:152314336-152314358 CTTTTTTACTTGAGTTATGATGG + Exonic
915139611 1:153759108-153759130 CTATTTTTTTGTAGAGATGAGGG - Intronic
915451652 1:156009502-156009524 CTGGATTTCTTGGGAGAGGAGGG + Exonic
915921193 1:159976868-159976890 CTTTTTTTTTAGAGAGATGGGGG - Intergenic
916452444 1:164933978-164934000 CTGAGTTCCTTGAGAGATGGAGG - Intergenic
916798983 1:168196580-168196602 CGGTTTTTCTTGAGAATTGATGG + Exonic
917540438 1:175907676-175907698 CTTTTTTTTTTTCGAGATGAAGG - Intergenic
917560465 1:176147819-176147841 CTGCATTTCTGGAGAGATAATGG - Intronic
917755036 1:178090529-178090551 CTATTTTTTTGTAGAGATGAGGG + Intergenic
918152193 1:181807118-181807140 TTTTTTTTTTTAAGAGATGAGGG - Intronic
918860730 1:189823673-189823695 TTTTTTTTCTGCAGAGATGAGGG + Intergenic
919390982 1:196985633-196985655 CTCTTCATTTTGAGAGATGATGG + Intronic
920025354 1:202990057-202990079 TTGTTTTTCTTAAGAAAAGATGG - Intergenic
920361739 1:205422683-205422705 CAGTCTTTCTTGAAAGATGCAGG - Intronic
921322155 1:213952540-213952562 TGGTTTTTCATGAGAGAGGATGG - Intergenic
921871765 1:220148115-220148137 CTGTTTCCCTTAAGAGGTGAAGG + Intergenic
922139473 1:222868208-222868230 CTTTTTTTTTTAAGAGATGAGGG - Intergenic
922182934 1:223250169-223250191 CTATTTCTGTTGACAGATGATGG - Intronic
923751493 1:236750718-236750740 CTGGTTTTCTTTAGATATAATGG + Intronic
924067108 1:240235416-240235438 GTTTTTTTTTTCAGAGATGAGGG + Intronic
924393720 1:243593042-243593064 CAGTTTTTATTGTGGGATGACGG - Intronic
1063766328 10:9145310-9145332 CTCTTTATCTTGAGAGAAGCAGG - Intergenic
1064072232 10:12240536-12240558 CTCTTTGTCTTCAAAGATGATGG + Intronic
1064253360 10:13724040-13724062 GTGTTTTTATTGAGAGATAAAGG + Intronic
1064368323 10:14728257-14728279 CTATTTTTCAAGAGAGTTGATGG - Intronic
1064722883 10:18247545-18247567 ATTTTTTTTTTAAGAGATGATGG - Intronic
1065506157 10:26432084-26432106 CTGTTTTCCTTGTGAGAAGAAGG - Intergenic
1065545234 10:26812746-26812768 CTGGTATTCTTGAAAGAAGAGGG - Intronic
1065551901 10:26876464-26876486 CTTTCTTTTTTTAGAGATGAGGG + Intergenic
1065963029 10:30749710-30749732 CTGCTTTTCTACAGAGAAGACGG - Intergenic
1067126108 10:43516934-43516956 CTGTGTCCCTTTAGAGATGAAGG - Intergenic
1068777772 10:60886698-60886720 CTGTTTTTTTTAAGAGATGTGGG + Intronic
1069512179 10:69050778-69050800 CAGTTTTTTTTAAGAGATGGGGG - Intergenic
1069528310 10:69194332-69194354 TTTTTTTTCTTTAGAGATGAGGG - Intronic
1069842466 10:71348389-71348411 CTGCTTCTTTTTAGAGATGAAGG + Intronic
1070101360 10:73390534-73390556 CTTAGTTTCTTGAGACATGAAGG - Intronic
1070690281 10:78519517-78519539 CTGATTTTCCTAAGAGATGTTGG + Intergenic
1071701078 10:87936976-87936998 CTGTTTCTCTTCAGAGGTGAGGG + Intronic
1072119936 10:92397242-92397264 TTTTTATTTTTGAGAGATGAGGG - Intergenic
1073148225 10:101294237-101294259 TTTTTTTTTTTCAGAGATGAGGG + Intergenic
1073713896 10:106079657-106079679 ACGTTTTTGTTGAGATATGAAGG - Intergenic
1074890622 10:117733906-117733928 CTGTTTTTCCTGACTGTTGAAGG + Intergenic
1076296668 10:129391210-129391232 CTTTCTTTCTTTTGAGATGAGGG - Intergenic
1076305803 10:129465083-129465105 CTCTTTTTCTTAAGAGTTTAGGG + Intergenic
1076465745 10:130680548-130680570 CTGTTTCCATTGAGTGATGAGGG + Intergenic
1078372155 11:10757415-10757437 CTGATTTTCTGTAGAGATGGGGG - Intronic
1078424925 11:11241734-11241756 CTGATGTGCTTCAGAGATGAAGG + Intergenic
1078748515 11:14138170-14138192 ATGTCTTTCTTGAGAAAAGAGGG - Intronic
1079049564 11:17141900-17141922 ATCTTTTTCTTGAGACATCAAGG + Intronic
1079248607 11:18771403-18771425 CAGTTCTTCCTGAGAGATCAGGG - Intronic
1079751690 11:24207656-24207678 TTGTTATTCTTGACAGATTAAGG + Intergenic
1080287509 11:30632664-30632686 TTTTTTTTCTAGAGAGATGGGGG - Intergenic
1081275674 11:41146280-41146302 CTCTTAACCTTGAGAGATGATGG - Intronic
1081801712 11:45864447-45864469 TTGTTTTTATTTAGAGATGAGGG - Intronic
1082018661 11:47512463-47512485 TTTTTTTTTTTTAGAGATGAGGG + Intronic
1083237365 11:61360066-61360088 TTTTTTTTTTTAAGAGATGAGGG - Intronic
1083320248 11:61841528-61841550 TTTTTTTTTTTGAGAGATGGGGG - Intronic
1084626791 11:70313850-70313872 CTAATTTTCTGGAGAGATGGGGG - Intronic
1084865773 11:72055805-72055827 TTTTTTTTTTTGAGAGATGGGGG - Intronic
1085070060 11:73535731-73535753 TTTTTTTTTTTGAGAGATGGGGG + Intronic
1086065642 11:82741252-82741274 CTGTATCTCTTGAGAGATATTGG + Intergenic
1086086489 11:82960594-82960616 ATGTCTAGCTTGAGAGATGAGGG - Intronic
1086969724 11:93067262-93067284 CTCTGTGTCTTCAGAGATGAGGG + Intergenic
1087793776 11:102433799-102433821 CAGTTTTTCATGAGATCTGATGG + Intronic
1087937709 11:104054689-104054711 TTGTTTTGCTTCAGAGCTGAAGG + Intronic
1088015735 11:105057179-105057201 CTGTTTTTCTGAATAGAGGAAGG - Intronic
1089098845 11:115942914-115942936 CTGTTGTTTTGGAGAGCTGAAGG - Intergenic
1090048079 11:123353574-123353596 CTGTTTTTCTAGAGCAATGGTGG - Intergenic
1091180742 11:133602196-133602218 GTATTTTTCTGTAGAGATGAGGG - Intergenic
1092152824 12:6262817-6262839 CTGATGGTCTGGAGAGATGAAGG - Intergenic
1092294050 12:7184174-7184196 CTGTCTTTCTGGAGAGACTAAGG + Intergenic
1092478824 12:8841869-8841891 CTGTTTTTATTAAGTAATGAGGG - Intronic
1092787576 12:12041767-12041789 TTTTTTTTCTTTAGAGATGAGGG - Intergenic
1093001061 12:13996437-13996459 CTCTATTTCTAGAGAGATTATGG - Intergenic
1093348534 12:18069620-18069642 CTGTCTTTCTGGAGAGACAAAGG + Intergenic
1093853824 12:24074036-24074058 CTTTTTTTTTTGAGGGATGTAGG - Intergenic
1093945897 12:25109391-25109413 TTGTTTTTTTTAAGAGATGGGGG + Intronic
1094298873 12:28938754-28938776 CTGTTTTTCTTGGCAGATGTTGG - Intergenic
1095310403 12:40691924-40691946 CAGTTTTTCTTGAGAAAAGACGG - Intergenic
1096519041 12:52173877-52173899 CTGTCCCTCTGGAGAGATGATGG + Intronic
1097541133 12:60945207-60945229 ATGTTTTGCTTGAAAAATGAAGG - Intergenic
1097835946 12:64272940-64272962 CTGTTTCTCTAGAGTGATGTTGG - Intronic
1097892340 12:64790392-64790414 CTGTTTTTCCTGAAAGCAGAAGG + Intronic
1098043577 12:66377674-66377696 CTATATTTCGTGTGAGATGAAGG - Intronic
1098559599 12:71857110-71857132 TTTTTTTTCTTAAGAGATGGGGG + Intronic
1098930610 12:76408132-76408154 TTTTTTTTTTTAAGAGATGAGGG - Intronic
1100179028 12:92063625-92063647 CTTTTTTTCTTTAAAGATTAAGG - Intronic
1100317100 12:93454484-93454506 ATGTGATTTTTGAGAGATGAGGG + Intergenic
1100504120 12:95203191-95203213 CTTTCTTTCATCAGAGATGAGGG + Intronic
1100748421 12:97670799-97670821 CTCTTTTTCCTGACAGAAGAAGG + Intergenic
1101389899 12:104290979-104291001 TTTTTTTTCTTTAGAGATGGAGG + Intronic
1101695577 12:107122617-107122639 CTGTGTTTGTTGAGAGATTAGGG - Intergenic
1103591880 12:121997390-121997412 TTTTTTTTTTTGAGAGATGATGG - Intronic
1103796805 12:123508858-123508880 CTTTTTTTTTTTGGAGATGAGGG - Intronic
1104166136 12:126231432-126231454 CTCTTTTTCTTTAGAGTTGGAGG + Intergenic
1104851572 12:131877679-131877701 CTGTCTTTCTGGAGAGACTAAGG - Intergenic
1105955746 13:25281152-25281174 TTCTTTTTCTGTAGAGATGAGGG - Intronic
1106612463 13:31296656-31296678 CTATTTTTCAATAGAGATGATGG + Intronic
1106674354 13:31942144-31942166 CTTTTTTTCTGTAGAGATGGGGG - Intergenic
1106922740 13:34580978-34581000 CTATTTTTCTAGAAACATGAAGG - Intergenic
1107690393 13:42947801-42947823 CTGTTTCTCTTCTGATATGAAGG + Intronic
1108095813 13:46899583-46899605 CTGTTCTTCATGAGAAATAATGG - Intergenic
1108487051 13:50937395-50937417 CATTTTTTTTGGAGAGATGAGGG + Intronic
1108637305 13:52348357-52348379 CTGTGTTTCTGCAGGGATGAAGG - Intergenic
1108701260 13:52946231-52946253 CTGTTTTTGTGGCAAGATGAGGG + Intergenic
1109864898 13:68250465-68250487 CTTTTTTTCTTGAGTCATGCAGG + Intergenic
1110012779 13:70359022-70359044 TTGTATTTCATGAGAGATAAGGG - Intergenic
1111444288 13:88325327-88325349 CTGTTTTTCTTGAAAGTTTTTGG + Intergenic
1111699349 13:91666221-91666243 CTCATTCTCTTGAGAGATCATGG - Intronic
1114005986 14:18313695-18313717 ATGTTCTTCATGAGAGATGAAGG + Intergenic
1115181906 14:30637205-30637227 CTGTTTATCTGGATAGGTGAGGG - Intronic
1115662128 14:35507016-35507038 CTGTTCTTCCTGAGACAGGATGG - Intergenic
1116596021 14:46845922-46845944 CAGTTTCTCTTGAGAAATCAAGG + Intronic
1117077142 14:52116098-52116120 CAGTGGTTCTAGAGAGATGAGGG - Intergenic
1117903754 14:60563225-60563247 CTGTGGTTCTTGACAGATGAAGG - Intergenic
1117916200 14:60680623-60680645 TTTTTTTTTTTCAGAGATGAGGG + Intergenic
1117975035 14:61288872-61288894 TTGTTATTGTTCAGAGATGAGGG + Intronic
1118056507 14:62084696-62084718 CTCTTTTTCTTTAAAGTTGAGGG - Intronic
1118243031 14:64080144-64080166 TTGTCACTCTTGAGAGATGAGGG + Intronic
1119035591 14:71228029-71228051 CTGTTTGTCTTGAGACACAAAGG - Intergenic
1119744780 14:77036330-77036352 TTTTTTCTCTTAAGAGATGAAGG - Intergenic
1119833120 14:77721630-77721652 CTCTTACTCTTGAGAGTTGAGGG - Intronic
1119912930 14:78367578-78367600 CTGTTTGTCTTAGGAGATAATGG - Intronic
1120720385 14:87884110-87884132 TTTTTTTTCTAGAGACATGAAGG + Intronic
1121463775 14:94101420-94101442 CTGCTTTTCTGGAGAGGTGAGGG - Intronic
1121735382 14:96214354-96214376 CTGTCATTCCTGAGAGAGGACGG + Intronic
1123695459 15:22875985-22876007 CTGTTCATCTTTAGAGGTGAGGG + Intronic
1124663984 15:31575903-31575925 ATGTTTTTCTTCACAGATTAAGG - Intronic
1125473147 15:40024218-40024240 CTTTTTTTTTTAAGAGATGGGGG + Intronic
1125925249 15:43557841-43557863 TTTTTTTTCTGGAGAGATGGGGG + Intronic
1126457736 15:48882471-48882493 CTGTTTTGCCTGAAAGATTATGG + Intronic
1126743481 15:51801352-51801374 TTGCTTTACTTGAGAAATGAGGG + Intronic
1127142974 15:55995341-55995363 ATGTGTATCATGAGAGATGAGGG - Intergenic
1128121651 15:65152922-65152944 TTGTTTGTTTTGAGAGATGAGGG + Intronic
1130013586 15:80170941-80170963 CTGTTTTTCTTTAGAGGTAGTGG + Intronic
1131439092 15:92445077-92445099 CTCCATTCCTTGAGAGATGAGGG + Intronic
1132267818 15:100491896-100491918 TTTTTTTTTTTAAGAGATGAGGG + Intronic
1133931000 16:10232021-10232043 CTGCATTCCTTGAGTGATGAAGG + Intergenic
1135406689 16:22203494-22203516 TTGTTTTTTTGTAGAGATGAGGG + Intergenic
1135505927 16:23036186-23036208 CTGGATGTCTTGAGAGATGCTGG - Intergenic
1135520631 16:23174857-23174879 CTGCTTCTCTTGAGAGAAGCTGG - Intergenic
1135525119 16:23208338-23208360 CTTTTTTTTTTTAGAGATGAGGG - Intronic
1136374254 16:29856006-29856028 ATGTTTTTCTGTAGAGATGGGGG - Intergenic
1138137672 16:54537487-54537509 CAGTTTTTCCTGGGAGAGGAAGG + Intergenic
1138232751 16:55351212-55351234 CTATTATTCTTTAGAGATGGGGG - Intergenic
1140214498 16:72996546-72996568 CTCTTTTTGTAGAGAGTTGATGG - Intronic
1140275040 16:73501414-73501436 CTTTTTTTCTTGAGATGTGCTGG - Intergenic
1140379591 16:74474341-74474363 GTGTTGTTCTAGAGAAATGAGGG + Intronic
1140446024 16:75028699-75028721 CTGTTTCAATTGAGTGATGAGGG - Intronic
1140682696 16:77400772-77400794 CTGTGGTTCTTAAGAGATTATGG + Intronic
1143959124 17:10699841-10699863 ATATTTTTCTTGAGAGAAGCAGG + Intronic
1145399366 17:22518469-22518491 TTTTTTTTTTTTAGAGATGATGG - Intergenic
1146326611 17:31891715-31891737 CTGTATTTCTTTTTAGATGATGG - Intronic
1146360149 17:32168021-32168043 CTTTTTTTCCTTAGAGATGGGGG - Intronic
1146727199 17:35166076-35166098 TTTTTTTTTTTTAGAGATGAGGG - Intronic
1146742592 17:35299487-35299509 CTGTTTTTCATCAGGGGTGAGGG - Intergenic
1148924349 17:51070061-51070083 TTTTTTTTTTTAAGAGATGAGGG - Intronic
1149751364 17:59148591-59148613 CAATTTTTCTGTAGAGATGAGGG + Intronic
1149895086 17:60422813-60422835 CTGTGTTCCTGGCGAGATGATGG + Intronic
1150267391 17:63840344-63840366 TTTTTTTTTTTAAGAGATGATGG + Intronic
1151903625 17:77034012-77034034 CTTTTTTTTTTAAGAGATGGGGG + Intergenic
1153235505 18:2982787-2982809 ATGTCTTTTTTCAGAGATGAAGG + Intronic
1153323530 18:3795653-3795675 TTGTTTATTTTTAGAGATGAGGG + Intronic
1154231842 18:12563321-12563343 CTTTTTTTTTTAAGAGATGGGGG + Intronic
1154531494 18:15350499-15350521 ATGTTCTTCATGAGAGATGAAGG - Intergenic
1155090372 18:22503462-22503484 CTGTATTTCTAAGGAGATGAAGG - Intergenic
1155370275 18:25092075-25092097 GTGTTTTCCTTGACAGATGAAGG - Exonic
1156961543 18:43037839-43037861 CTGTTTTTCTGGAGATACTAAGG + Intronic
1157154118 18:45248331-45248353 CTTCTGTTCTTGAGACATGAGGG + Intronic
1158031911 18:52976218-52976240 TTGTTTTTCTTTATAGATGCTGG + Intronic
1158219149 18:55132097-55132119 CTGGTTATGTTGAGAGATAAAGG + Intergenic
1158225457 18:55196670-55196692 TTGTTTTTCTTGGGAGAGGTGGG + Intergenic
1158239366 18:55359873-55359895 ATGTTTTTCTAGACACATGATGG + Intronic
1159958721 18:74539169-74539191 CTTTTTTTTTTTTGAGATGAGGG - Intronic
1160065135 18:75567197-75567219 CTCTTCTTCATTAGAGATGATGG - Intergenic
1161268647 19:3377034-3377056 CTTTTTTTTTTAAGAGATGGGGG - Intronic
1162083329 19:8233052-8233074 TTATTTTTTTTAAGAGATGAGGG + Intronic
1162356926 19:10191820-10191842 ATTTTTTTTTTTAGAGATGAGGG - Intronic
1162928811 19:13945336-13945358 TTTTTTTTTTTTAGAGATGAGGG - Intronic
1164057328 19:21632801-21632823 CTGCCTTTCTGGAGAGATTAAGG + Intergenic
1165436629 19:35798872-35798894 TTTTTTTTTTTGAGAGATAATGG + Intergenic
1165620996 19:37247658-37247680 TTTTTTTTCTGTAGAGATGAGGG - Exonic
1167509012 19:49886298-49886320 TTGTTTTTCTTGAGTGCAGATGG + Intronic
1168389068 19:55991115-55991137 TTGTTTTTCTGGAGTGAGGAGGG + Intergenic
1168545612 19:57247386-57247408 CTGTATTTCTTGGGAGAGTAGGG + Intronic
926239937 2:11077694-11077716 CTCCTTCTCTTGACAGATGAGGG - Intergenic
927301305 2:21518963-21518985 CTGATTTACTTGAGAAATAAAGG - Intergenic
927578557 2:24220884-24220906 CTGTCTCTCATGAGAGATGGTGG - Intronic
928193966 2:29200283-29200305 CTGTTTTTCTAGATAGATATAGG + Intronic
928531452 2:32196466-32196488 CTGGCTTTTTTGAGAGTTGAGGG + Intronic
928769473 2:34689354-34689376 CTGTGTATCTTGAGAGCTGAAGG - Intergenic
929159256 2:38815234-38815256 ATTTTTTTGTAGAGAGATGAGGG + Intronic
929425181 2:41837581-41837603 TTGCTTTTCTTGAGATTTGATGG - Intergenic
929547754 2:42866730-42866752 CTGGTGTTCTTGAGCGATGATGG - Intergenic
931327808 2:61245209-61245231 ATGTTTTGGTGGAGAGATGACGG - Exonic
932220628 2:69996203-69996225 TTTTTTTTTTTGAGAGATGGGGG - Intergenic
934164224 2:89279809-89279831 CTATTCTACCTGAGAGATGAGGG + Intergenic
934203050 2:89902715-89902737 CTATTCTACCTGAGAGATGAGGG - Intergenic
935094007 2:99926557-99926579 CTGTTTTTTGTGAGAGATTTAGG + Intronic
935703452 2:105834987-105835009 AGGTTGTTATTGAGAGATGAAGG + Intronic
937712559 2:124995145-124995167 CTGTGCTTTTGGAGAGATGATGG - Intergenic
938062429 2:128263764-128263786 CTGCTTCTCTTTAGAGTTGAAGG - Intronic
938530589 2:132181769-132181791 ATGTTCTTCATGAGAGATAAAGG - Intronic
938672162 2:133596922-133596944 CTGTTTTGCATGAAAGATGGAGG - Intergenic
938719950 2:134058171-134058193 TTATTTTTCTTCATAGATGAGGG - Intergenic
938914339 2:135920136-135920158 CTGTATTTCTTGAGACATTCGGG + Intronic
939015031 2:136892668-136892690 CTGTTTTCCTGCAGAGATTAAGG + Intronic
939465742 2:142553589-142553611 CTGTTTTGCTTGCGGGATGGAGG - Intergenic
940340787 2:152578596-152578618 TTTTTTTTTTTGAGAGATGTGGG + Intronic
940396757 2:153198736-153198758 CTGTTTTTCTTGACAGATCAGGG + Intergenic
940701052 2:157043139-157043161 CTTGTTTTATTGATAGATGAAGG - Intergenic
941475638 2:165948725-165948747 CTGTTTTTTTTTAGAGATGGAGG + Intronic
942458664 2:176154633-176154655 CTGTGTCTCCTGAGAGCTGAGGG + Intronic
942680916 2:178477844-178477866 CTGTTTTTCTTGATAGAAAGTGG + Intronic
943516039 2:188888098-188888120 CTCTTTTTCTTGAACTATGAAGG - Intergenic
943731545 2:191307963-191307985 CTGTTTTTTTGGGGAGATGGAGG - Intronic
944039366 2:195336713-195336735 CTGCTTTTCTGGAGAGACTAAGG - Intergenic
945622769 2:212162396-212162418 GTGTTTATCTTGAGAAGTGAGGG + Intronic
948443827 2:238016550-238016572 TTGTGTTTTTTGATAGATGAGGG + Exonic
1170020504 20:11832132-11832154 CTGTATTTCTATAGAGAAGATGG - Intergenic
1170360535 20:15541237-15541259 CTCTCTTTTTTGAGAGATGCTGG - Intronic
1171052136 20:21869860-21869882 GTGTTTTTTTCTAGAGATGAGGG + Intergenic
1174702554 20:52623854-52623876 CCCTTTTTCTTGAGACAAGATGG - Intergenic
1175026831 20:55911314-55911336 ATGGTTTGGTTGAGAGATGATGG + Intergenic
1175394391 20:58649068-58649090 CTTTTTTTCTTAACAGATAAGGG + Intergenic
1176697813 21:10001958-10001980 CTGTTTCTGTTGAGATTTGATGG + Intergenic
1176765863 21:13017659-13017681 ATGTTCTTCATGAGAGATGAAGG + Intergenic
1177026055 21:15923113-15923135 CTGTTTTTCTGGATATAAGAAGG - Intergenic
1177240681 21:18452639-18452661 TTGTTTTTCTTGAGACAGGCTGG - Intronic
1177312802 21:19419340-19419362 CTGTTGTTCTGGAGAGTTCAAGG + Intergenic
1179147654 21:38782678-38782700 CTTTTTTTTTTGTGAGATGGAGG + Intergenic
1179943766 21:44656512-44656534 CTGTTTTTGCTGAGAAGTGAGGG + Intronic
1180430496 22:15244502-15244524 ATGTTCTTCATGAGAGATGAAGG + Intergenic
1180513049 22:16112408-16112430 ATGTTTTTCATGAGAGATGAAGG + Intergenic
1180676455 22:17589789-17589811 CTGTTTTCTTTGAGAGGTGAGGG - Intronic
1182454123 22:30438963-30438985 TGGTTTTTCTTTTGAGATGAAGG + Intergenic
1184304848 22:43590809-43590831 CTCTTTTTCTTGAGCAAAGATGG + Intronic
1184849393 22:47111551-47111573 CTGCTTTTCTCGTGAGATGGAGG + Exonic
1184992109 22:48177697-48177719 ATGTTGTTGTTGAGGGATGAAGG - Intergenic
1185394919 22:50582000-50582022 CTATTTTTATTTAGAGATGGGGG + Intronic
950016766 3:9759936-9759958 ATGTTTTTCTTAAGAGAGAAAGG - Intronic
950095685 3:10328917-10328939 TTGTTCTTGTTGAGGGATGACGG + Exonic
951202312 3:19889247-19889269 CTGATTCACTTGGGAGATGAAGG + Intronic
952464038 3:33562042-33562064 TTTTTTTTCTTTAGAAATGAAGG + Intronic
954051437 3:47981926-47981948 ATGCTTTTCTTATGAGATGATGG - Intronic
954097952 3:48346010-48346032 ATGTTTCTCTCCAGAGATGATGG - Intergenic
954607251 3:51921798-51921820 ATTTTTTTTTTAAGAGATGAGGG + Intergenic
955157731 3:56433688-56433710 CTGTTTTTCCTGTGGCATGAAGG + Intronic
955202881 3:56867095-56867117 CTGGTTTTCTTTAAAAATGAGGG + Intronic
956224309 3:66938533-66938555 CTGTTTTTATTGACAGTAGAGGG + Intergenic
956441364 3:69283513-69283535 CTGTTTGTCTTGAGAAAGCAAGG - Intronic
956824082 3:72981520-72981542 ATTTTTTTCTTGAGAGATGGGGG - Intronic
957267960 3:77991698-77991720 ATGTGTTTCTTTATAGATGAAGG + Intergenic
958019059 3:87976488-87976510 CAGTTTTTTTTAAGAGATGGGGG - Intergenic
958064992 3:88533056-88533078 CTTTTTAATTTGAGAGATGACGG - Intergenic
959551740 3:107667090-107667112 CTGTTCTTCTTGAGATAGGGTGG - Intronic
959968763 3:112384885-112384907 CTGGTGTTTTTGAGAGATGAGGG - Intergenic
960155564 3:114294311-114294333 CTGTTTTTGGTGGCAGATGAAGG + Intronic
960581132 3:119279749-119279771 CTGTATTCTGTGAGAGATGAAGG + Intergenic
960677621 3:120212005-120212027 CTTTTTTTTTTCAGAGATGGGGG + Intronic
961007865 3:123416872-123416894 CTCTTTTTCCTGTGAGATGAGGG - Intronic
961139788 3:124546279-124546301 TTTTTTTTTTTGAGAGATGGGGG - Intronic
961891322 3:130132658-130132680 GTGTTTGTCTTGAGGGATGGCGG + Intergenic
962290297 3:134130516-134130538 CTTTTTTTCTTGTGTGAGGATGG - Intronic
963423918 3:145097895-145097917 CAGTTTTTCTTGGGGAATGAAGG + Intergenic
963585985 3:147189132-147189154 GTGGTTTTCTTGAGCAATGAAGG - Intergenic
963733486 3:148993349-148993371 CTGCTTTTCTTTGGAGAAGAAGG - Intronic
963827235 3:149969808-149969830 CTGATTTTCTTGAGACTTGATGG - Intronic
963968681 3:151403911-151403933 CAGTTTTTCTTGACAGTTTATGG + Intronic
964863395 3:161227197-161227219 CTGTGTTTCCTGACAGATGTTGG + Intronic
965690297 3:171349153-171349175 CTGTTTTTCTTGAGAGATGAAGG - Intronic
965863054 3:173170232-173170254 CTATTTTTCCTGAGAGGTGCTGG - Intergenic
966307887 3:178557308-178557330 CTCTTTTTCCTCTGAGATGAGGG + Intronic
966384847 3:179385305-179385327 TTGTTCCTCTTGAGAGTTGAGGG + Intronic
966524521 3:180906577-180906599 TTTTTTTTCTGTAGAGATGAGGG + Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
969696301 4:8737028-8737050 CTGTGTTTCTGGACAGCTGATGG - Intergenic
971130198 4:23799868-23799890 CTTATTTTCTTCAGTGATGAAGG - Intronic
971397614 4:26243281-26243303 CTATTGTTATTCAGAGATGATGG + Intronic
971779463 4:31013183-31013205 CTCTTTTTCTTTAGAGAACAGGG - Intronic
973090284 4:46127071-46127093 CTGGTTATTTTGTGAGATGATGG - Intergenic
973165494 4:47071893-47071915 CTATTTTAATTGAGTGATGAGGG + Intronic
973574588 4:52273926-52273948 GTCTTTTGCTTGAGAGATGTAGG - Intergenic
973970420 4:56207990-56208012 TTTTTTTTTTTTAGAGATGAGGG + Intronic
975276332 4:72505942-72505964 CTCTTTTTGTTCAGAGATGTTGG - Intronic
976252591 4:83068210-83068232 CTGTTTTTCTTGTGAGATTTTGG - Intronic
976831962 4:89325325-89325347 CTGTTTTTCTTAACAAATAAAGG - Intergenic
977292373 4:95177876-95177898 TTTTTTTTTTTAAGAGATGATGG + Intronic
977430220 4:96922709-96922731 CTATTTGACTTGATAGATGACGG + Intergenic
977597230 4:98896475-98896497 TTTTTTTTTTTGAGAGATGCGGG - Intronic
977618031 4:99106831-99106853 CTGCTTTTCTGGAGAGACTAAGG - Intergenic
977642453 4:99372242-99372264 CTATTTTTCTGGAAACATGATGG + Intergenic
979981283 4:127258478-127258500 TTTTTTTTCTTTAGAGATGACGG + Intergenic
980124304 4:128759048-128759070 ATGTTTTTCTTGAGAAATTGTGG + Intergenic
980370360 4:131861831-131861853 CTGTTTCTGTTGAGATTTGATGG + Intergenic
981164907 4:141546192-141546214 CTGGTTTTCTTGAGAGACAAGGG + Intergenic
982556002 4:156865822-156865844 GTGGTTTTCTTGAGCGATGTAGG + Intronic
983679289 4:170333717-170333739 TTTTTTTTCTTTAGAGATGGGGG - Intergenic
983853640 4:172614734-172614756 CTGTTATTCTTAAAAGATGAGGG + Intronic
983907117 4:173195447-173195469 CAGGTTTTCTTTAGAGAAGATGG - Intronic
985749554 5:1666512-1666534 CTGGTCTTCTTGTGAGATGGGGG + Intergenic
986465591 5:8019304-8019326 ACGTTTTTCTTCAGAAATGAGGG + Intergenic
986482000 5:8198854-8198876 CTGTATTTCTACAGAGAAGATGG + Intergenic
986825933 5:11522790-11522812 GTTTTTTTCTTGAACGATGAAGG + Intronic
986870949 5:12045577-12045599 CTGTTGTCATTGAGAAATGAAGG + Intergenic
987426211 5:17776451-17776473 CTGTGTGTCATCAGAGATGATGG + Intergenic
988063570 5:26204955-26204977 CTTTCTTTTTTGAGAGATCATGG + Intergenic
988100958 5:26677301-26677323 TTGTTTTTCTATAGAGATGTAGG + Intergenic
988143192 5:27268792-27268814 CTGGCTTTCCTGAAAGATGAGGG - Intergenic
988539266 5:32094686-32094708 TTTTTTTTTTTGAGAGATGAGGG - Intronic
989094282 5:37767017-37767039 TTGTTTTTCTTGATGGATTAGGG + Intergenic
989781182 5:45266622-45266644 CCGTATTTCTTGAGAGATCTGGG - Intronic
990310390 5:54532166-54532188 CTTTTTTTCTAGAAAGATAAAGG - Intronic
990633558 5:57697329-57697351 CTTTTTTTCTTTGGAGAGGATGG + Intergenic
990772490 5:59264892-59264914 CTGTTGTTCTTTAGAAATGATGG + Intronic
990932479 5:61108632-61108654 CTGTTTATGGTGAGAGATGGGGG + Intronic
991254149 5:64596311-64596333 CTGTCTGCCTTGAGAGATCATGG + Intronic
992137495 5:73762003-73762025 TTTTTTTTTTTTAGAGATGAAGG + Intronic
992280394 5:75169442-75169464 CTGCTTTTCTGCAGAGATGAGGG + Intronic
992437052 5:76764645-76764667 ATTTTTTTTTTTAGAGATGAGGG + Intergenic
992917316 5:81470818-81470840 CTGTGTTTCTTGAGAGATAATGG - Intronic
993440595 5:87952485-87952507 TTTTTTTTTTTAAGAGATGAGGG + Intergenic
993559747 5:89391405-89391427 CTGTCTTTTTTGAAAGATGCAGG - Intergenic
993981846 5:94552031-94552053 CTGTGTGTCTTTACAGATGAGGG - Intronic
994271335 5:97781532-97781554 CAGTTTTTCTCAAGAGATGGAGG + Intergenic
994296425 5:98094417-98094439 GTGTGTCTCTTGAGATATGATGG + Intergenic
994370244 5:98959299-98959321 TTCTTTTTTTAGAGAGATGAGGG - Intergenic
994560217 5:101360023-101360045 CTGAATTACTTGACAGATGAGGG + Intergenic
995045116 5:107637364-107637386 GTGATTTTCTTGACAGATGCTGG - Intronic
995628722 5:114109719-114109741 CTGTTTCTGTTGAGACATTAAGG - Intergenic
997012862 5:129899689-129899711 CATTTTTTCTTGACAGATCAAGG - Intergenic
997978214 5:138452813-138452835 TTTTTTTTTTTGAGAGAAGATGG + Intergenic
998701452 5:144705202-144705224 CTGATAATCTTGACAGATGATGG + Intergenic
999301096 5:150490911-150490933 CAGTTCTGCTTGAGAGTTGAGGG - Intronic
1000540012 5:162527956-162527978 CTGTTATTGTGGAGAGAGGAAGG + Intergenic
1000794624 5:165649485-165649507 CTGATTTTATTTACAGATGAGGG + Intergenic
1001582073 5:172805789-172805811 CTGTTTTCCTTTAGAGATGGAGG + Intergenic
1001616546 5:173047650-173047672 GAGGTTTTATTGAGAGATGAAGG - Intergenic
1002427167 5:179183221-179183243 CAGTTTTTCTTAAGAGAGAAGGG + Intronic
1002695131 5:181082766-181082788 CCGTTTTTCTTCATAGATCATGG - Intergenic
1003310638 6:4966835-4966857 CTTTTTTTCTTTTGAGATGGGGG - Intergenic
1004073300 6:12321855-12321877 TTTTTTTTTTTGAGAGATGGTGG + Intergenic
1004161496 6:13218137-13218159 ATGTTTTTCTTTAGAAATGATGG + Intronic
1004703105 6:18097742-18097764 CTGACTTTCTTGTGAGATGCTGG + Intergenic
1004914571 6:20319919-20319941 CAGTTTTTCTCGAGAGCTCATGG - Intergenic
1005194215 6:23264142-23264164 CTGCTTTAGTGGAGAGATGAGGG + Intergenic
1006277062 6:33013576-33013598 CTGTTTTTCTTTTGAGGTGTCGG + Intergenic
1006873818 6:37277954-37277976 TTTTTTTTTTTGAGAGATAAGGG - Intronic
1007167106 6:39836419-39836441 GCGTTTTTCTTGTGAGTTGAAGG - Intronic
1007527335 6:42508023-42508045 CTGATTTACTTCACAGATGACGG - Intergenic
1007983285 6:46180826-46180848 CTGCTTTTCTTGAGGGGAGAGGG + Intergenic
1008891726 6:56500889-56500911 ATGTTTTTCTTAAAAGATTATGG - Intronic
1009167286 6:60356474-60356496 TTGTTTTGTTTTAGAGATGAGGG - Intergenic
1010497339 6:76550679-76550701 CTCTTTTTCTTAAGAGAATATGG + Intergenic
1011239579 6:85256573-85256595 ATGTTGTTCTTTTGAGATGAAGG - Intergenic
1012149894 6:95735540-95735562 CTTTTTTTTTTTAGAAATGAGGG - Intergenic
1012330816 6:97984067-97984089 CTGTATTTCATGAGGGATGTTGG - Intergenic
1013060283 6:106626983-106627005 CTATTTTATTTGAAAGATGAAGG - Intronic
1013384831 6:109616348-109616370 ATGATTTTCTTGAAAGATGCTGG + Intronic
1013394351 6:109719564-109719586 CTTTTTTTTTTTAGAGGTGATGG + Intronic
1013702176 6:112786071-112786093 CTTTTTTTTTTTTGAGATGATGG + Intergenic
1013740110 6:113273396-113273418 CTATTCCTCCTGAGAGATGATGG - Intergenic
1014642438 6:123929062-123929084 GTGGTTTCCTTGGGAGATGAAGG + Intronic
1014821048 6:125988592-125988614 AGTTATTTCTTGAGAGATGATGG + Intronic
1016277832 6:142375407-142375429 CTGTGTTTCAGGAGAAATGATGG + Intronic
1018629116 6:165806716-165806738 CTGGTTCCCTTGAGAGATTAGGG - Intronic
1018642674 6:165918905-165918927 CTGTTTTTAATGGCAGATGATGG + Intronic
1018761028 6:166894527-166894549 CTGCTTTTCTGGAGAGACTAAGG + Intronic
1019713498 7:2528014-2528036 CTGTTTTTTTTGAAAGGGGATGG + Exonic
1020052142 7:5088679-5088701 CTGTTCTTCTGGAGAGAGGCGGG - Intergenic
1020435810 7:8161246-8161268 CTGTCCTCCTTAAGAGATGAGGG - Intronic
1020451486 7:8324574-8324596 CTATTTTTCATGTGAGAGGATGG - Intergenic
1020462089 7:8437347-8437369 ATTTTTTTATTGAGAGATGGGGG + Intronic
1021250434 7:18318663-18318685 ATTCTTTTCTTGAGAGACGAAGG + Intronic
1023469377 7:40497805-40497827 CTGTGTTTTATTAGAGATGAAGG + Intronic
1023594559 7:41815302-41815324 TTGTTCTGCTTGAAAGATGAGGG + Intergenic
1023680771 7:42684999-42685021 CAGGCTTTCTAGAGAGATGAGGG + Intergenic
1024885799 7:54140683-54140705 CTGTTTTCCTTTCTAGATGATGG - Intergenic
1026392616 7:69917199-69917221 CTTTCTTTCTTTAGAGATGGAGG + Intronic
1026939480 7:74278956-74278978 CTTTTTTTTGTTAGAGATGAGGG - Intergenic
1028669025 7:93379650-93379672 CTGTTTTTTTTGATTGATAATGG + Intergenic
1029530266 7:101120862-101120884 TTTTTTTTTTTCAGAGATGAGGG - Intergenic
1029936977 7:104435586-104435608 GTGTGTTTCTTGAGTGAGGAAGG - Intronic
1031663184 7:124453005-124453027 CTATTTATGTTGAGAGATGAAGG - Intergenic
1031703268 7:124951700-124951722 CTGTTTTTCTTGAAATATTAGGG - Intergenic
1031741680 7:125440254-125440276 CTGATTTCCATAAGAGATGATGG - Intergenic
1031929270 7:127668024-127668046 TTGTTTCTATTGAAAGATGATGG - Intronic
1032134349 7:129261762-129261784 CCATTTTTCATGAGAGATCATGG + Intronic
1032410711 7:131691839-131691861 CTGTTTTTCCAGTGAGATCATGG - Intergenic
1032606467 7:133360065-133360087 CTGTCTTTCTAGAGAAATAATGG - Intronic
1034525612 7:151659014-151659036 CTGACTTTCTTGAGAAGTGAGGG + Intronic
1034674726 7:152884208-152884230 CTGGATTTTTTGATAGATGAAGG + Intergenic
1035015305 7:155760637-155760659 CTGGTTCTCATGAAAGATGAGGG + Intronic
1035403305 7:158582544-158582566 TTTTTTTTTTTGAGAGAGGACGG - Intronic
1037205361 8:16311623-16311645 CTCTTTTATTTGAGAGATAAAGG - Intronic
1037717636 8:21413228-21413250 TTTTTTTTTTTAAGAGATGAGGG - Intergenic
1038349591 8:26763775-26763797 TTGTTTTGTTTGAGAGAAGAAGG + Intronic
1038740665 8:30213789-30213811 CTGTATTTCTTTAAAGATCAAGG + Intergenic
1039291669 8:36101996-36102018 TTTTTTTTTTGGAGAGATGAGGG + Intergenic
1039825080 8:41166158-41166180 TTTTTTTTTTTTAGAGATGAGGG + Intergenic
1040598449 8:48862031-48862053 GTGTGTGTCTTGAGAGATGCTGG + Intergenic
1040941368 8:52836704-52836726 CTGTTTGTCTTTAGAGGTGCTGG - Intergenic
1041303778 8:56438992-56439014 TTTTTTTTTTTTAGAGATGAGGG - Intronic
1041677776 8:60553025-60553047 CTGTGCTTTTTGAGAGGTGATGG + Intronic
1041756472 8:61318778-61318800 TTGTTTGTTTTAAGAGATGATGG + Intronic
1041812532 8:61927561-61927583 CTTTTATTTTAGAGAGATGAAGG + Intergenic
1042163744 8:65924378-65924400 TTGTTCTTCTTGTGAGAAGAAGG + Intergenic
1042178373 8:66059959-66059981 CTGTTTACCTTGAGAGCCGAGGG + Intronic
1042506700 8:69568296-69568318 CTGTTTATCTAGAAAGATGAAGG + Intronic
1045142813 8:99305744-99305766 CTGTCTTTAATGGGAGATGATGG + Intronic
1046248045 8:111592447-111592469 CTTTTTTTTTTTTGAGATGATGG + Intergenic
1046473555 8:114711451-114711473 CTGCTTTGCATGAGATATGAGGG - Intergenic
1047463994 8:125094858-125094880 CTCTTTTTTTTGAGAAAAGAGGG + Intronic
1047990630 8:130282912-130282934 CTGTTTTACTTAAATGATGAAGG - Intronic
1048034729 8:130666639-130666661 CTGTTCTTCTTCAGATATTAAGG + Intergenic
1051307058 9:15721805-15721827 CTGTTGTCCTTGAGAGATTGAGG + Exonic
1052091242 9:24330163-24330185 CAGTTTGACTTGAGATATGAAGG - Intergenic
1052698593 9:31910358-31910380 TTGTATTTCTTGGGAGAGGAGGG + Intergenic
1052920647 9:33964702-33964724 CTTTTTTTTTTAAGAGATGGGGG - Intronic
1053186557 9:36021493-36021515 GTGTCTTTCGTGAGAGCTGATGG + Intergenic
1053634936 9:39988317-39988339 CTGTTTCTGTTGAGATTTGATGG + Intergenic
1053770989 9:41475991-41476013 CTGTTTCTGTTGAGATTTGATGG - Intergenic
1054208951 9:62262380-62262402 CTGTTTCTGTTGAGATTTGATGG - Intergenic
1054315864 9:63585760-63585782 CTGTTTCTGTTGAGATTTGATGG + Intergenic
1054549725 9:66387821-66387843 CTGTTTCTGTTGAGATTTGATGG - Intergenic
1055155104 9:73053421-73053443 CTGTTTCTCTTGAAAGATATTGG + Intronic
1055950333 9:81724287-81724309 CTGTTTTGCTTGTTAGAGGATGG - Intergenic
1056144852 9:83719350-83719372 ATGTTTTGCATGAGAGATGCAGG + Intergenic
1056145342 9:83723426-83723448 CTGGTTTACTTGGGAGATGAGGG - Intergenic
1057047140 9:91894677-91894699 TTGTTATTCTTGAGAGTGGAGGG + Intronic
1057246206 9:93456482-93456504 ATGTTTGTATTTAGAGATGATGG + Intronic
1057648104 9:96895895-96895917 CTGTTTTTCTAGATAGAGGCAGG - Intergenic
1058057808 9:100466684-100466706 ATTTTTTTTTTAAGAGATGAGGG - Intronic
1059193065 9:112345331-112345353 TTTTTTTTTTTTAGAGATGAGGG - Intergenic
1059585878 9:115605767-115605789 TTGTTTTTCTGAAGAGATGTAGG + Intergenic
1059676131 9:116541771-116541793 ATGTCTTTATTGAGAGCTGAAGG - Intronic
1060242899 9:121919837-121919859 TTTTTTTTTTTTAGAGATGAGGG - Intronic
1060426150 9:123507674-123507696 TTTTTTTTTTTAAGAGATGAGGG - Intronic
1060962607 9:127691645-127691667 CTGTTTTTCCAAAGAGATGGAGG - Exonic
1061070143 9:128304720-128304742 CTTTTTTTTTTAAGAGTTGAGGG + Intergenic
1061653140 9:132067303-132067325 CTGTTTTCCCTGCAAGATGAAGG - Intronic
1061694974 9:132366235-132366257 TTTTTTTTTTTGAGAGATGGAGG + Intergenic
1185667268 X:1775805-1775827 CTTTTTTTTTTTTGAGATGATGG + Intergenic
1185876992 X:3709958-3709980 CTATTTTTTTTAAGAGATGAGGG + Intronic
1185992768 X:4910761-4910783 CTGTTTCTCTGGAGACATCATGG + Intergenic
1186630731 X:11345970-11345992 TTTTTTTTTTTAAGAGATGAGGG + Intronic
1188297511 X:28468083-28468105 GTGATATTCTTGAGAGAAGAAGG - Intergenic
1188809067 X:34630044-34630066 TCGTTTTTCTTGACAAATGAAGG - Exonic
1189241307 X:39526649-39526671 CTGGGATCCTTGAGAGATGAGGG + Intergenic
1189378736 X:40486290-40486312 CTCTTTTTCTTCAGAGATGAAGG + Intergenic
1190311646 X:49121122-49121144 TTTTTTTTCTTTAAAGATGAAGG + Intronic
1192604067 X:72495368-72495390 CTGTTTTTCTTAAAAGAAGGGGG - Intronic
1193171987 X:78347474-78347496 CTGCCTTTCTTGAGAGACTAAGG - Intergenic
1193657182 X:84212501-84212523 GTGTTAATGTTGAGAGATGAAGG - Intergenic
1194206515 X:91017473-91017495 CTGCTTCTCTAGAGAGATTAGGG + Intergenic
1194943394 X:100040150-100040172 TTTTTTTTTTTTAGAGATGAGGG - Intergenic
1195302465 X:103544221-103544243 TTGTTTTTGTTGGGGGATGAAGG - Intergenic
1195404609 X:104499172-104499194 CTGTGTATCTTGAAAGGTGAAGG + Intergenic
1195656267 X:107334178-107334200 CTGCTTTTCAAGTGAGATGATGG + Intergenic
1196561707 X:117157166-117157188 ATGTCTTTCTTGGAAGATGAAGG + Intergenic
1196628489 X:117907107-117907129 CTGTTTTTAATCAGAGATGGAGG + Intronic
1196645453 X:118112844-118112866 CTTTATTCCTTGAGAGATTAGGG - Intronic
1198127889 X:133664649-133664671 ATGTTATGCTTGAGAAATGAGGG + Intronic
1198191171 X:134307707-134307729 ATGTTTTGCTTTAGAGTTGAAGG - Intergenic
1198624491 X:138554665-138554687 CTGATTTTTTTAACAGATGAAGG - Intergenic
1198759938 X:140021205-140021227 TTGTTATTCTAGAGAGATAAGGG + Intergenic
1198953005 X:142094304-142094326 TTGTTTTTCTTAACAAATGAGGG + Intergenic
1199153294 X:144516037-144516059 TTGTTTTTGTGGAAAGATGAAGG - Intergenic
1199335088 X:146609942-146609964 ATCATTTTCTTGAGAGTTGAAGG + Intergenic
1200367152 X:155678940-155678962 GTGTTATTCTTAAGACATGAAGG - Intergenic
1200552267 Y:4592268-4592290 CTGCTTCTCTAGAGAGATTAGGG + Intergenic
1202165410 Y:21982036-21982058 CTGTTTTTCATAGGAGATGGAGG - Intergenic
1202225947 Y:22604336-22604358 CTGTTTTTCATAGGAGATGGAGG + Intergenic
1202317166 Y:23591325-23591347 CTGTTTTTCATAGGAGATGGAGG - Intergenic
1202553599 Y:26078733-26078755 CTGTTTTTCATAGGAGATGGAGG + Intergenic