ID: 965691897

View in Genome Browser
Species Human (GRCh38)
Location 3:171366137-171366159
Sequence ATGGGTATGTGGCCTTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 186}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965691891_965691897 4 Left 965691891 3:171366110-171366132 CCAATAAACAGCCAAGACCTTTA 0: 1
1: 0
2: 0
3: 6
4: 130
Right 965691897 3:171366137-171366159 ATGGGTATGTGGCCTTTTGTTGG 0: 1
1: 0
2: 1
3: 9
4: 186
965691894_965691897 -7 Left 965691894 3:171366121-171366143 CCAAGACCTTTAGTAAATGGGTA 0: 1
1: 0
2: 0
3: 7
4: 105
Right 965691897 3:171366137-171366159 ATGGGTATGTGGCCTTTTGTTGG 0: 1
1: 0
2: 1
3: 9
4: 186
965691890_965691897 19 Left 965691890 3:171366095-171366117 CCAATAGATGGCATGCCAATAAA 0: 1
1: 0
2: 1
3: 11
4: 96
Right 965691897 3:171366137-171366159 ATGGGTATGTGGCCTTTTGTTGG 0: 1
1: 0
2: 1
3: 9
4: 186
965691889_965691897 20 Left 965691889 3:171366094-171366116 CCCAATAGATGGCATGCCAATAA 0: 1
1: 0
2: 0
3: 8
4: 103
Right 965691897 3:171366137-171366159 ATGGGTATGTGGCCTTTTGTTGG 0: 1
1: 0
2: 1
3: 9
4: 186
965691888_965691897 30 Left 965691888 3:171366084-171366106 CCATTAGGTTCCCAATAGATGGC 0: 1
1: 0
2: 1
3: 5
4: 67
Right 965691897 3:171366137-171366159 ATGGGTATGTGGCCTTTTGTTGG 0: 1
1: 0
2: 1
3: 9
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965691897 Original CRISPR ATGGGTATGTGGCCTTTTGT TGG Intronic
901357147 1:8661028-8661050 TTAGGTATGGTGCCTTTTGTTGG - Intronic
901766791 1:11505290-11505312 ATGGGTAACTGGCCTTGTGCTGG - Intronic
902800591 1:18827165-18827187 ATGGGAATGTGGTATTTAGTGGG - Intergenic
903184159 1:21619986-21620008 ATGGCTCTGTGGCCTGTTCTGGG - Intronic
905174417 1:36126850-36126872 GTGGCTATGTGGCTTTGTGTGGG + Intergenic
905603224 1:39271982-39272004 ATTGGTGTGTGGCATTTTCTGGG + Intronic
906791638 1:48663420-48663442 AAGGGAATGTAGTCTTTTGTTGG - Intronic
909941908 1:81621074-81621096 ATGTGGCTGTGTCCTTTTGTAGG + Intronic
911462165 1:98204618-98204640 ATTGGTTTGTGGCTATTTGTTGG - Intergenic
911926391 1:103837465-103837487 TTGGCTATGTGGGCTTTTTTTGG - Intergenic
911963841 1:104340541-104340563 TTGGCTATGTGGGCTTTTTTTGG + Intergenic
913937261 1:125066028-125066050 ATGGGGATTTGGCCCTTTGATGG + Intergenic
917487677 1:175469593-175469615 AGGGTTTTGTGGCCTCTTGTTGG + Intronic
917866487 1:179200588-179200610 ATGGGTAGGTAGCATTTTTTGGG - Intronic
919355243 1:196514178-196514200 ATGTGTATCTGGCCCTGTGTTGG - Intronic
920012522 1:202879536-202879558 ATGGACATGTGACCGTTTGTCGG + Exonic
920041813 1:203102916-203102938 ATGGATATGAGGCCTTAGGTTGG + Intronic
921631688 1:217441025-217441047 TTGGATATGTGGGCTTTTTTTGG - Intronic
924911627 1:248519803-248519825 TTGGCTATATGGCCTTTTTTTGG + Intergenic
1062798469 10:361839-361861 GTGGGTGCGTGGCCTTCTGTTGG - Intronic
1064306278 10:14169629-14169651 TTGTGTATGTGGCCCTTTCTTGG + Intronic
1066170721 10:32841632-32841654 TTGGCTATGTGGGCTTTTTTTGG - Intronic
1067527502 10:47047355-47047377 CTGGGTATGTGTCCTGTTGGGGG + Intergenic
1068603435 10:58979292-58979314 ATGGGTTTTTGGCCACTTGTAGG + Intergenic
1068726370 10:60307734-60307756 ATGGGTAAGTGGACTCTTCTGGG - Intronic
1069493364 10:68880629-68880651 AGAGGTATGTGCTCTTTTGTGGG + Intronic
1069518406 10:69098449-69098471 ATGGGTATGAGGGTTTTTTTTGG + Intronic
1070667497 10:78355774-78355796 ATGTGCATGTGACCTTATGTGGG - Intergenic
1073851689 10:107627424-107627446 ATGGGTATGGGGTCTCTTTTGGG + Intergenic
1075580311 10:123612433-123612455 ATGGGTATATGGCATCTTTTTGG + Intergenic
1075890133 10:125941630-125941652 ATGGGCATGTGGTCATTTCTAGG - Intronic
1075944742 10:126422887-126422909 AAGGGTATGAGGCTCTTTGTGGG + Intergenic
1076088389 10:127656546-127656568 ATGGAGTTGTGGCCTGTTGTGGG - Intergenic
1076242909 10:128923301-128923323 CTGGGTATGTGGCCTTGGGCAGG + Intergenic
1080869707 11:36226654-36226676 ATGGGTATGAGGAATCTTGTTGG - Intronic
1082231466 11:49773162-49773184 ATAGGTATATTGCCCTTTGTTGG + Intergenic
1083062040 11:59883823-59883845 ATGGCTGTATGACCTTTTGTAGG - Intergenic
1084894442 11:72255289-72255311 ATGGTTGTGTGGCCTGTTGGGGG + Intergenic
1086618511 11:88854723-88854745 ATGGGTATATTGCCCTTTGTTGG - Intronic
1086852156 11:91822574-91822596 ATGGTTATGTGGCCTTTGGCAGG + Intergenic
1087331705 11:96788969-96788991 TTGGCTATGTGGGCTTTTTTTGG + Intergenic
1089974909 11:122723978-122724000 ATGCTTATGTGGACTTTGGTGGG + Intronic
1091356011 11:134938337-134938359 ATAGGTAAATGTCCTTTTGTGGG - Intergenic
1095575104 12:43727777-43727799 ATGGGTAAATTGCATTTTGTGGG - Intergenic
1095989381 12:48023998-48024020 TTGGGTCTGGAGCCTTTTGTAGG - Intronic
1096806217 12:54142818-54142840 CTGGGTAAGTGGGCTTTTTTTGG + Intergenic
1097311676 12:58125790-58125812 TTGGCTATGTGGACTTTTTTTGG + Intergenic
1097833294 12:64248300-64248322 TTGGCTATGTGGGCTTTTTTTGG + Intergenic
1099462127 12:82936445-82936467 TTGTGTAACTGGCCTTTTGTGGG - Intronic
1100561979 12:95756430-95756452 ATTGGTGTGTCGCTTTTTGTTGG + Intronic
1100580028 12:95930077-95930099 CTGGGAATGTGGCCTTATTTGGG - Intronic
1100915390 12:99414826-99414848 ATGGGTATATGCCCTTTTCAGGG + Intronic
1101208626 12:102513824-102513846 AAGGGGATGGGGCCTTTTATGGG + Intergenic
1101871843 12:108572038-108572060 CTGGGGAGGTGGCCTTTTGAGGG - Intergenic
1102843388 12:116150826-116150848 AGGGGTGTGTGGCCTTAGGTAGG + Intronic
1102959998 12:117086161-117086183 ATGGGTATGAGGTTTTTTGGAGG + Intronic
1103545672 12:121699426-121699448 ATGGGTATGAGGTTTTTTGGGGG + Intergenic
1104149289 12:126066966-126066988 ATGAGTAAGTGGCCTTTTACTGG - Intergenic
1108115852 13:47127302-47127324 TTGGGCATGAGGCATTTTGTGGG - Intergenic
1113411010 13:110089885-110089907 ATGGCTATGTTGGCATTTGTGGG + Intergenic
1115404385 14:32998400-32998422 ATGGGTATGGGGTTTTTTTTTGG + Intronic
1116252849 14:42508821-42508843 ATAGGTGTGTGGCCTTATTTTGG - Intergenic
1116578744 14:46610361-46610383 ATAGGTGTGTGGCCTTATTTTGG - Intergenic
1118587557 14:67369499-67369521 ATGTGTATTTTGCCTTTTCTGGG - Intronic
1120668696 14:87338236-87338258 ATGGGAATGTGGCCTAATCTTGG + Intergenic
1120974414 14:90236099-90236121 ATGGGTAAGGGGCTTTTTGGAGG - Intergenic
1126409841 15:48361915-48361937 ATGTTTATGTAACCTTTTGTGGG + Intergenic
1133175237 16:4009611-4009633 ATTGGGATGTGGGTTTTTGTTGG - Intronic
1135021558 16:18967225-18967247 ATGGGTATGAGGTCTTCTTTGGG - Intergenic
1135378250 16:21969787-21969809 ATGGGTATGGGGCTTTTGGGGGG - Intronic
1141907984 16:87040367-87040389 GTGGGAATGTGGCTTTTTGGAGG - Intergenic
1144369068 17:14572803-14572825 ATGGGTATGGGTCCTTCTTTTGG - Intergenic
1144372194 17:14602447-14602469 TTGGCTATGTGGACTTTTTTTGG - Intergenic
1146113179 17:30110550-30110572 ATGGGTATGTGGTTTCTTATTGG - Intergenic
1146759806 17:35467280-35467302 ATGGAGATGGGGCCATTTGTTGG - Intronic
1147428043 17:40355636-40355658 GTGGGTGTGTGTCCTTGTGTGGG + Intronic
1149433935 17:56617497-56617519 ATTGGTATGTGGCCTTGTCAGGG - Intergenic
1150909913 17:69376878-69376900 ATCTGTATGTGGCCATTTGTGGG - Intergenic
1151661955 17:75523914-75523936 CTGGCTGTGTGGCCTTGTGTAGG - Intronic
1151882077 17:76902064-76902086 ATGGGTATGTGTGCAGTTGTGGG + Intronic
1152334707 17:79694052-79694074 ATGAGGATGTGGCCATCTGTGGG - Intergenic
1154396719 18:13997615-13997637 ATGTGTATGCTGCCTTGTGTTGG + Intergenic
1154498601 18:14980967-14980989 ATAGGTAAATGTCCTTTTGTGGG + Intergenic
1156288625 18:35723995-35724017 TTGGCAATGTGGCCTTTTTTTGG + Intergenic
1158588994 18:58763861-58763883 ATGGGTATGGGGACTCTTTTAGG + Intergenic
1159055136 18:63455789-63455811 ATGGGTATGGGGCTTCTTTTAGG - Intergenic
1163544882 19:17935324-17935346 ATGGTGATGTGGCCTCTTTTGGG + Intronic
1164018786 19:21277640-21277662 TTGGCTATGTGGGCTTTTTTTGG + Intronic
1167757189 19:51420175-51420197 ATGGTTATGTTGGCTTTTGTTGG - Intergenic
926312837 2:11686805-11686827 ATCGATATGGGTCCTTTTGTGGG + Intronic
927312477 2:21646808-21646830 ATGGGTTTGTGGCTCTCTGTGGG + Intergenic
928041448 2:27881751-27881773 GTAGGTATGTGGCCTTATTTTGG - Intronic
928711809 2:34015682-34015704 TTGGCTATGTGGCCTCTTTTAGG - Intergenic
942228157 2:173834873-173834895 ATGAGTCTTTGGTCTTTTGTTGG - Intergenic
944349571 2:198710838-198710860 ATGAGAATGGGGACTTTTGTTGG - Intergenic
944774439 2:202948324-202948346 TTGGCTATTTGGCCTTTTTTTGG + Intronic
947086445 2:226458377-226458399 TTGGCTATGTGGCCCTTTTTTGG - Intergenic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
1170737046 20:19021616-19021638 ATGAGCATCTGGCCTTGTGTTGG + Intergenic
1171086070 20:22239400-22239422 ATGGGTAGGTGGCCTCTTCTGGG - Intergenic
1173223425 20:41147196-41147218 CTGGGACTGTGGCCTTTTCTTGG + Intronic
1179059457 21:37966009-37966031 ATTGGCCTGTGACCTTTTGTGGG - Intronic
1179662176 21:42883485-42883507 CTGGGGATGTGACCTTTTTTGGG + Intronic
1180056736 21:45362818-45362840 ATGAGAGAGTGGCCTTTTGTGGG - Intergenic
1180925318 22:19549736-19549758 ATGCGTATGTGACCCTATGTGGG + Intergenic
950075374 3:10183204-10183226 ATGTGACTGTGGCCTTTTGAAGG + Intronic
951284957 3:20799471-20799493 ATAGGTATGTGGCTTTATTTCGG + Intergenic
952058385 3:29476805-29476827 TTGTGTATTTTGCCTTTTGTGGG + Intronic
952472114 3:33666317-33666339 ATGGGTATGTGGTTATTTTTTGG - Intronic
952518991 3:34136072-34136094 ATGGGTATGTGGCTTTATTTTGG - Intergenic
954047321 3:47943616-47943638 ATGGGTTTGAAGCCTTTTTTGGG - Intronic
955289878 3:57681858-57681880 ATGGGTATGTGGTTTCTTTTTGG + Intronic
956589902 3:70903699-70903721 CTGGGGATATGGCCTTTTGCAGG - Intergenic
956748375 3:72327441-72327463 ATGGGTATGTGGCATATAGATGG - Intergenic
958221073 3:90680516-90680538 GTGAGTATTTGGCCTTTTTTGGG - Intergenic
961210060 3:125118686-125118708 AGGGGAAGGTGGCCATTTGTTGG + Intronic
962098043 3:132312641-132312663 AGGGGTATGTGGTCTCTTTTTGG - Intergenic
964416016 3:156448543-156448565 ATGGGTAAGTGGCCCAGTGTAGG - Intronic
964703193 3:159591598-159591620 ATGGGTTTGTGTCCTTTTCCGGG + Intronic
965691897 3:171366137-171366159 ATGGGTATGTGGCCTTTTGTTGG + Intronic
967315786 3:188151086-188151108 ATGGGAATGAGGCTTTTGGTAGG + Intergenic
975569566 4:75800401-75800423 AGGCTTATGTGCCCTTTTGTTGG + Exonic
975973608 4:80072114-80072136 ATGGGAGTGTGGCCTCTTGCGGG - Intronic
977273832 4:94950762-94950784 TTGGCTATATGGCCTTTTTTTGG + Intronic
977934787 4:102789146-102789168 ATGGGTATGTAGTCTCTTGTGGG - Intergenic
978368109 4:108003759-108003781 AAGGGTCTGAGGCCTATTGTTGG - Intronic
978677023 4:111330762-111330784 ATGGGTAAATTGCCTGTTGTGGG - Intergenic
979497617 4:121401660-121401682 ATGGGCCTGTTGCTTTTTGTAGG + Intergenic
980767540 4:137327199-137327221 GTAGGTATGTGGCTTTTTCTAGG + Intergenic
981466675 4:145080287-145080309 ATGGGTAAGTTGCCTTTCGCTGG - Intronic
982034399 4:151331447-151331469 ATGTGTCTGTGGTCATTTGTTGG - Intergenic
982818066 4:159910947-159910969 AGTGGTGTGTGGCTTTTTGTAGG + Intergenic
986521646 5:8625586-8625608 GTGGGTATGTGGCTTTATTTTGG - Intergenic
986645327 5:9911147-9911169 ATGGATATGTTGCCCTATGTGGG - Intergenic
987671754 5:21018865-21018887 ATAGGTATGTGGCTTTATATTGG - Intergenic
988721369 5:33882432-33882454 ATGTGTATGTGTTCTTGTGTGGG - Intronic
991971767 5:72148349-72148371 CTGGGTATGGGCCCTTCTGTGGG - Intronic
992466017 5:77005639-77005661 ATTAGTATGTGGACTTTTTTTGG - Intergenic
994430566 5:99654256-99654278 ATTTGTATATTGCCTTTTGTGGG + Intergenic
996033077 5:118728332-118728354 ATGTGTTTGTGGCCTTCTGCAGG - Intergenic
997591145 5:135073017-135073039 ATGGTGGTATGGCCTTTTGTTGG + Intronic
997593504 5:135090992-135091014 ATAGGCATGTGGCATTTTGTGGG + Intronic
1001077343 5:168640034-168640056 ATGGGCATGAGGCCTTTTTGGGG - Intergenic
1001416598 5:171549142-171549164 ATGGGTATGGGGCTTCTTTTTGG + Intergenic
1003878636 6:10460722-10460744 AAGGGTATGTGGGTGTTTGTTGG + Intergenic
1005918116 6:30372339-30372361 ATGGGTATGGGGTTTTTTGTGGG - Intergenic
1007744565 6:44035407-44035429 ATGGGTATGTGGCCTAATGTTGG + Intergenic
1008979852 6:57470663-57470685 AATTGTATGTAGCCTTTTGTTGG + Intronic
1009491888 6:64301825-64301847 ATGGGAAAGTGGCCATTTGGTGG + Intronic
1011186474 6:84682180-84682202 ATTGGTATCTGGCCTTCTCTAGG - Intergenic
1014108779 6:117596858-117596880 TTGGCTATGTGGGCTTTTTTTGG + Intronic
1014749609 6:125240295-125240317 TTGGCTATGTGGGCTTTTTTGGG + Intronic
1014942175 6:127455338-127455360 TTGGGTATGTGGCCTTAATTCGG - Intronic
1015084376 6:129271067-129271089 ATGGGTATGTGTCTGTGTGTAGG - Intronic
1016515494 6:144888787-144888809 GTGTGTGTGTGGCTTTTTGTTGG - Intergenic
1017463208 6:154670851-154670873 ATGGGTATGCAGCCTTTACTGGG + Intergenic
1018039279 6:159907405-159907427 ATTGGTCTGTGCCCTTCTGTGGG + Exonic
1018607829 6:165617237-165617259 TTGGGTATGTGGCCTTTGCAAGG - Intronic
1020441449 7:8221256-8221278 AAAGGTGTGTGGCCTTTAGTGGG - Exonic
1022995183 7:35748035-35748057 ATTGGCATGTTGCTTTTTGTAGG - Intergenic
1023887057 7:44366326-44366348 ATTAGGATGTGGACTTTTGTGGG + Intergenic
1027442772 7:78238102-78238124 ATGTGTTTTTGGCCTTTTGCTGG + Intronic
1029954426 7:104622567-104622589 ATGGGTATGAGGATTTTTGGGGG - Intronic
1030276444 7:107726679-107726701 TTGGGTATGGGGCCTTTGGGAGG - Intergenic
1030304036 7:108002108-108002130 GTGGGTGTGTGGCCCTTTGGGGG - Intronic
1032474117 7:132200655-132200677 ATTTGTGTGTGGGCTTTTGTGGG - Intronic
1034294001 7:149955732-149955754 ATGGGTGTGTGGGCTACTGTTGG - Intergenic
1034661028 7:152769525-152769547 ATGAAAATGTTGCCTTTTGTTGG + Intronic
1034812068 7:154141136-154141158 ATGGGTGTGTGGGCTACTGTTGG + Intronic
1035074791 7:156170162-156170184 GTGGGAATGTGTCCTTTTTTAGG - Intergenic
1035545636 8:480255-480277 ATGGGTATGTTGCATGGTGTGGG + Intergenic
1036248779 8:7143717-7143739 ATGGGCATGTGGCCTTCCATGGG + Intergenic
1038493405 8:27985636-27985658 CTGGGTATGTGACCCTCTGTGGG - Intronic
1041336669 8:56793141-56793163 GTGGGTATGAGGTCTTTTATGGG + Intergenic
1042319263 8:67457812-67457834 ATGGGGCTGTGGCTGTTTGTGGG - Intronic
1043506154 8:80905134-80905156 ATGAACATGTGTCCTTTTGTAGG - Intergenic
1044041051 8:87368714-87368736 AGGGGTATTTGGTATTTTGTAGG + Intronic
1044132428 8:88541185-88541207 ATGAGTATGTAGCATTTTGAAGG - Intergenic
1044175055 8:89109654-89109676 ATGGGCAAGTGTACTTTTGTGGG + Intergenic
1045944255 8:107777602-107777624 ATGGGTATGAGGTTTTTTGCGGG - Intergenic
1046330741 8:112711983-112712005 GGCGGTATGTGGACTTTTGTTGG + Intronic
1048782735 8:138019922-138019944 ATGGGAATTTGGGGTTTTGTGGG + Intergenic
1051786341 9:20748394-20748416 ACTGGTATGTAGCCTTTTTTGGG + Intronic
1057841356 9:98487792-98487814 ATTAGGATGTGGCCTTTTTTGGG - Intronic
1058532695 9:105922415-105922437 ATGTGTATGTGTAGTTTTGTGGG + Intergenic
1185833126 X:3320360-3320382 ATGGGAATGTATCCTGTTGTAGG + Exonic
1186592694 X:10947960-10947982 ATGGGTATGTGACCTTATTCTGG + Intergenic
1188164650 X:26846965-26846987 ATGGGTATGTGGTTTCTTTTTGG - Intergenic
1190946286 X:55097137-55097159 ATGGGTATGTGACCCAGTGTTGG + Intronic
1194246320 X:91516248-91516270 ATGGGTATGTGGTTTATTTTTGG + Intergenic
1195332654 X:103817260-103817282 ATGAGTTTGTGTCCTCTTGTGGG + Intergenic
1197426268 X:126300089-126300111 ATGGGTATGTGATATTTTGGGGG + Intergenic
1198100510 X:133417947-133417969 ATGGGTATGTGGTCTCCTTTTGG - Intergenic
1199179057 X:144831318-144831340 ATGGGTATATGGCTTTTCTTTGG + Intergenic
1200565285 Y:4757497-4757519 ATGGGTATGTGGTTTATTTTTGG + Intergenic
1201336321 Y:12884242-12884264 ATGGGTAAATTGCCTGTTGTTGG + Intergenic
1201935052 Y:19401486-19401508 TTGGGTAGTTGGCCTTTTTTTGG - Intergenic