ID: 965693854

View in Genome Browser
Species Human (GRCh38)
Location 3:171386044-171386066
Sequence CTCCTTCCAAAGCTGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 230}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
965693849_965693854 -2 Left 965693849 3:171386023-171386045 CCCCACTCAGCTATGCTCCTGCT 0: 1
1: 0
2: 1
3: 35
4: 318
Right 965693854 3:171386044-171386066 CTCCTTCCAAAGCTGAAGCTGGG 0: 1
1: 0
2: 2
3: 18
4: 230
965693850_965693854 -3 Left 965693850 3:171386024-171386046 CCCACTCAGCTATGCTCCTGCTC 0: 1
1: 0
2: 5
3: 25
4: 246
Right 965693854 3:171386044-171386066 CTCCTTCCAAAGCTGAAGCTGGG 0: 1
1: 0
2: 2
3: 18
4: 230
965693848_965693854 5 Left 965693848 3:171386016-171386038 CCGTATTCCCCACTCAGCTATGC 0: 1
1: 0
2: 2
3: 14
4: 166
Right 965693854 3:171386044-171386066 CTCCTTCCAAAGCTGAAGCTGGG 0: 1
1: 0
2: 2
3: 18
4: 230
965693851_965693854 -4 Left 965693851 3:171386025-171386047 CCACTCAGCTATGCTCCTGCTCC 0: 1
1: 0
2: 3
3: 34
4: 332
Right 965693854 3:171386044-171386066 CTCCTTCCAAAGCTGAAGCTGGG 0: 1
1: 0
2: 2
3: 18
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
965693854 Original CRISPR CTCCTTCCAAAGCTGAAGCT GGG Intronic
900399024 1:2465380-2465402 CTCCGGCCAAGGCAGAAGCTGGG + Intronic
900504563 1:3022856-3022878 ATCCTCCCAAAGCTGGGGCTAGG - Exonic
900563352 1:3319587-3319609 CTCCTTCCATCCCTGAAGCCAGG - Intronic
900804716 1:4759877-4759899 CTCCATCCACAGCTGGAGCCTGG - Intronic
901660237 1:10794590-10794612 CGGCTTTCCAAGCTGAAGCTGGG + Intronic
902183018 1:14704026-14704048 CTCCTCCAAGAGCTGACGCTGGG - Intronic
902914297 1:19627053-19627075 CGCCCTCCAGAGCTGAAGCTTGG - Exonic
903518012 1:23925442-23925464 CTCCTACAAAAGCAGAAGATGGG + Intergenic
904538350 1:31216070-31216092 CTCCTCCCAAAGCTGCAGTGGGG - Intronic
905276856 1:36824121-36824143 CTCCTTCCCAAGGTTAGGCTGGG - Intronic
906180048 1:43810361-43810383 CTCCTGCCACAGCTGAAGCCTGG - Intronic
907383742 1:54111875-54111897 ATCCAGCCAAAGCTGAAGCCAGG - Intronic
907391433 1:54160816-54160838 CTGCTTCCAAAGCTGGGGCAGGG + Intronic
910238647 1:85062409-85062431 CTCCTTCGAGAGCTGGAGGTGGG - Exonic
918180989 1:182085991-182086013 CTCATGCCAAAGCTGAAGATAGG - Intergenic
919791298 1:201292550-201292572 CTCATTCCAAAGCTGCCCCTTGG + Intronic
920207827 1:204306018-204306040 CACATTCCAAAGCTGCAGCCAGG - Intronic
922183026 1:223250945-223250967 CTTCTTCCAAAGCTAAGGCAGGG + Intronic
922763745 1:228147291-228147313 CTCCTCCCACAGCTGAGCCTAGG - Intronic
923331856 1:232932785-232932807 CTCCCTCCAAAGCAAAAGTTAGG + Intergenic
1063216113 10:3927084-3927106 CACCTGGCAAAGCTGCAGCTGGG + Intergenic
1066366449 10:34781452-34781474 CTCCTTTCACAGATGAGGCTTGG + Intronic
1067054653 10:43043638-43043660 CTCCTTCCCAAGGTGAAAGTGGG - Intergenic
1067269362 10:44775868-44775890 ATTCTTCCAAAGCTGGAGGTTGG - Intergenic
1068781585 10:60924563-60924585 ATCTTTCCAATGCTGAAGGTGGG - Intronic
1068823221 10:61402403-61402425 CTCCATCCAGAGTTGATGCTAGG - Intergenic
1070843111 10:79501853-79501875 CCCCTTCCAATGCTGAAAGTAGG + Intergenic
1070930566 10:80257785-80257807 CCCCTTCCAATGCTGAAAGTAGG - Intergenic
1070996723 10:80790132-80790154 CTGCTTCCAAAGGTTAATCTGGG - Intergenic
1071379891 10:85048021-85048043 CTCTGTATAAAGCTGAAGCTAGG + Intergenic
1072333805 10:94379508-94379530 CTCTTTCCAAGGCTGACGCAGGG + Intergenic
1074702541 10:116105077-116105099 GTACTACCAAAGCTAAAGCTAGG - Intronic
1075750006 10:124760452-124760474 CTGCCTCCAAAGCTGAACTTGGG + Exonic
1077806812 11:5598322-5598344 CTCTTGTCAAAGCTGAGGCTTGG - Intronic
1078854146 11:15192658-15192680 CCCCTACCAAAGTTGAAGGTCGG - Intronic
1080768134 11:35315872-35315894 CTCCTTGCCCAGCTCAAGCTTGG + Intronic
1080880774 11:36318431-36318453 TTCCTTCCAACCCTGAAACTTGG + Intronic
1081092998 11:38896160-38896182 CACCTTCCCCAGCTGAAACTCGG - Intergenic
1081866030 11:46361310-46361332 CTCGTTCCCAAGCTGAGGCATGG + Intronic
1084906167 11:72349575-72349597 CCCCTTCCAAGGCTGAGACTGGG - Intronic
1087056921 11:93945772-93945794 CTGCTTCCAAAGCAAAATCTAGG - Intergenic
1089356194 11:117855559-117855581 CTCCTTCCAGAGAGGAAGCTGGG + Intronic
1090611241 11:128472793-128472815 CTCCTTCCAGACCTGCAGCATGG + Intronic
1091352361 11:134907530-134907552 CTCCCTGCAAGGCTGAAGGTAGG - Intergenic
1091471368 12:730949-730971 CTCCTTCCATATCTCCAGCTTGG - Intergenic
1091710657 12:2737873-2737895 CTCTTCACCAAGCTGAAGCTTGG - Intergenic
1092458495 12:8666088-8666110 GTCCTTAGAAAACTGAAGCTAGG + Intergenic
1094526601 12:31235258-31235280 CGCCTTCCAAAGCTGGGGGTGGG - Intergenic
1096431373 12:51546312-51546334 CTGATTCCAGAGCTGAAGCAGGG - Intergenic
1102184219 12:110935071-110935093 CTACGTTCAAAGCAGAAGCTGGG + Intergenic
1102515284 12:113442002-113442024 CTCCTGCCAAGGCTGAGGATGGG - Intergenic
1103480582 12:121247676-121247698 CTCCTCCCAAAGCTGAGCCCTGG - Intronic
1104282632 12:127391860-127391882 CTGCTGGCAAAGCTGATGCTTGG + Intergenic
1104919999 12:132285738-132285760 CTCCTGCCATAGCTGCATCTGGG - Intronic
1106160854 13:27200158-27200180 CTCCTTCTAAAGGGGAAGATTGG + Intergenic
1106953903 13:34914496-34914518 ATGGTCCCAAAGCTGAAGCTTGG + Intergenic
1109808108 13:67470786-67470808 CTCCTTCCAGGGTTTAAGCTTGG - Intergenic
1110598336 13:77342783-77342805 CTACTCCCAAGGCTGAAGGTGGG - Intergenic
1110879218 13:80550497-80550519 CTCCTTCAAGAGCTCAAACTTGG + Intergenic
1111989521 13:95102964-95102986 CACCTTTAAAACCTGAAGCTGGG + Intronic
1112200453 13:97269135-97269157 CTCCTTCCAGTGCAGAACCTAGG - Intronic
1112400436 13:99072885-99072907 CTACTTGCAAGGCTGAAGATGGG + Intronic
1113594672 13:111522463-111522485 CTCCTTCTGTAGCTGAAGCAGGG + Intergenic
1114906983 14:27141602-27141624 CTACTTCCAGAGCTGTAACTAGG + Intergenic
1115387448 14:32814011-32814033 CTCCTTCCAAGACTGGTGCTGGG + Intronic
1115562644 14:34596986-34597008 CTAACTCCAAAGCTGAACCTAGG + Intronic
1115907284 14:38214004-38214026 CTCCTTCCAATGCATTAGCTGGG + Intergenic
1117407646 14:55419979-55420001 CTCCTCCCTAAACTGAAGCTTGG - Intronic
1117412997 14:55467811-55467833 CTCCATGCAAGGCTGCAGCTGGG + Intergenic
1122343591 14:101044579-101044601 CCCCTTCTAAGGCTGATGCTGGG - Intergenic
1124027609 15:25981479-25981501 CCCTTTACAAAACTGAAGCTAGG - Intergenic
1124689178 15:31807553-31807575 ATCCTGCCAAAACTGGAGCTGGG - Intronic
1125711736 15:41792457-41792479 CACCTGCCAAAGCAAAAGCTGGG + Intronic
1127250647 15:57233586-57233608 CTACTTGGGAAGCTGAAGCTGGG - Intronic
1128944843 15:71813165-71813187 TTCCATCCAGAGCTGCAGCTGGG - Intronic
1130460419 15:84155570-84155592 TTCCTCCCAGAGCTGGAGCTGGG + Intergenic
1130813999 15:87411377-87411399 CTACTTCCAGAGCTGATTCTTGG + Intergenic
1132662772 16:1069001-1069023 GCCCTGCCAAAGCTGAGGCTGGG + Intergenic
1136522525 16:30806020-30806042 CTCCTTCCCAGGCTGGTGCTCGG - Intergenic
1139224279 16:65218916-65218938 TTCCTGCCCAAGCTGGAGCTGGG + Intergenic
1140056679 16:71531571-71531593 TTCCTCCCCAAGCTGGAGCTGGG - Intronic
1140162421 16:72511785-72511807 CTCCTGCCTCAGCTGTAGCTTGG - Intergenic
1140931459 16:79632058-79632080 CTCTTGCCAAACCTGAAACTTGG - Intergenic
1142012145 16:87720975-87720997 CTGCTTCCATACCTGAAGCTGGG + Intronic
1144148975 17:12424881-12424903 GTCCTTCCAAAGCTAAAGGATGG - Intergenic
1144669951 17:17127211-17127233 CTCCTTCCAGGGCTGGTGCTGGG + Intronic
1144872178 17:18378166-18378188 CTCCTGCCAGGGCTGAAGTTCGG - Intronic
1144947718 17:18978274-18978296 CTGCTTCCACAGCTGGTGCTGGG + Exonic
1146916336 17:36680602-36680624 TTCCTTCTAAGGCTGAAGCCTGG - Intergenic
1148865704 17:50627209-50627231 CTTCTTGCAAAGCACAAGCTGGG + Exonic
1151749103 17:76026890-76026912 CTCCTGCCAGGGCTGAAGTTCGG + Intronic
1151865151 17:76796867-76796889 CTACTTGGAAAGCTGAGGCTCGG + Intergenic
1152160285 17:78664522-78664544 CTCCATCCTAAGCTGGGGCTGGG - Intergenic
1153227073 18:2907202-2907224 ATCCTTCCAAAGCTGCATTTCGG - Intronic
1153778978 18:8477939-8477961 CTGCTTCCACTGCTGAACCTGGG - Intergenic
1153823963 18:8857217-8857239 CTCCTCCCAGCGCTGCAGCTCGG + Intergenic
1157471650 18:47993488-47993510 TTCCTTCCAAAGCTGAGGTATGG - Intergenic
1159874030 18:73790380-73790402 ATGTTTCCAAAGCTCAAGCTTGG - Intergenic
1164779621 19:30881998-30882020 CACCTTCCACAGCTAATGCTGGG + Intergenic
1167584452 19:50365698-50365720 CTCCTTCTAAACCTGGAGGTGGG - Exonic
1168245936 19:55113234-55113256 GTCCTTCCAAGGGTCAAGCTCGG + Intronic
925179457 2:1807473-1807495 CACCCTACAAAGCTGAACCTGGG - Intronic
926742256 2:16122055-16122077 CTACTTGCAAAGCTGAGGGTGGG - Intergenic
928337101 2:30407550-30407572 CTCCTTCCAGAGAAGCAGCTGGG - Intergenic
929322753 2:40565242-40565264 TTCCTTCCAAAGCTCAAACTTGG + Intronic
929460739 2:42100939-42100961 GACTTTCCAAAGCTGAAACTGGG + Intergenic
931177066 2:59864852-59864874 CTCCTTCCACATCTGAAGCTTGG + Intergenic
931379390 2:61738118-61738140 CTCCTTCCAAAGCTTGAGAGTGG - Intergenic
932112393 2:69013185-69013207 CTCCTTCCATTGCAAAAGCTCGG + Exonic
932211039 2:69930775-69930797 CTCCTTCTACAGAGGAAGCTAGG + Intronic
932477149 2:72013446-72013468 CTCCTTCCTGATCTGAGGCTAGG + Intergenic
933292972 2:80458001-80458023 TTCCTTCTAGAGCTGAAGTTAGG + Intronic
935493169 2:103745938-103745960 CTCTTTCCAAGAGTGAAGCTGGG + Intergenic
937436014 2:121881840-121881862 ATCCTTCCAAAGCTAAAGAAAGG - Intergenic
939508848 2:143081957-143081979 CTCCTTACATATCTTAAGCTTGG + Intergenic
940020939 2:149155358-149155380 TTCCTTCCACTGCTGAAACTTGG + Intronic
944012076 2:194984329-194984351 CTCCTTCCAAGGATTAAGGTTGG + Intergenic
947140613 2:227016551-227016573 CTGGCTCCAAAGCTGAAGCAGGG + Intronic
947889031 2:233600241-233600263 CATCTTCCCAAACTGAAGCTTGG + Intergenic
947895014 2:233663091-233663113 CATCTTCCCAAACTGAAGCTTGG + Intronic
947954991 2:234181419-234181441 CTCCTTCAAAATCACAAGCTAGG - Intergenic
948250867 2:236527807-236527829 CTCCCCGCAAAGCTGAACCTGGG + Intergenic
948987129 2:241532632-241532654 CTCCTGCAGAAGCTGCAGCTTGG + Intergenic
1168962591 20:1879445-1879467 CTCCTTCCAGGGCTCGAGCTAGG + Intergenic
1172706660 20:36887169-36887191 CTGCTTCCAAAGCTGGAGGGAGG - Intronic
1173217123 20:41095515-41095537 TTTCTTCCAAAGCAGAAGCTTGG + Intronic
1173269691 20:41521732-41521754 CTGATTCCAAAGCTAAAGCAGGG + Intronic
1175539565 20:59739856-59739878 CACCTTCCAAAGCTGCATCGAGG - Intronic
1177155402 21:17496339-17496361 CTCCTGCCATATCTGAAGTTTGG + Intergenic
1178724486 21:35038797-35038819 CTCCTTCCAGAGCTGAAGCCTGG + Intronic
1179311543 21:40200255-40200277 CTTCTTCCCAACCTGAAACTTGG + Intronic
1179606229 21:42517292-42517314 CTCCTTCCAAGGCTGACCCTGGG - Intronic
1179941447 21:44641061-44641083 CTGCATCCAGAGCTGATGCTGGG - Intronic
1180854848 22:19039265-19039287 CTCCTTCAAAATCTGAGGCCCGG - Intronic
1182082315 22:27538217-27538239 CTCCTTACAGAGCTGAATGTTGG - Intergenic
1182245077 22:28950839-28950861 CTCCATCTAAAGCCGTAGCTGGG + Intronic
1183044980 22:35212269-35212291 CTCCTGCCAAAGCTGCCTCTAGG + Intergenic
1183508138 22:38220612-38220634 CTCCTTCCCAGGCTGATGCTGGG - Exonic
949221167 3:1635798-1635820 CTCCTCCCTCATCTGAAGCTTGG - Intergenic
950329368 3:12144306-12144328 ATTCTTCCAAAGCGGAGGCTAGG - Intronic
952416299 3:33093935-33093957 CACCTTCCAAAGCTGAAAACAGG + Exonic
953385765 3:42504860-42504882 CTCCTTCCCAGGCTGAAGTCAGG - Intronic
954576846 3:51681009-51681031 CCCCATGCAAAGTTGAAGCTGGG - Intronic
955508664 3:59657770-59657792 CTCCTTCCACTGCTGAACCAAGG - Intergenic
956609814 3:71111250-71111272 CTACTTTCATAGCTGAAGGTGGG - Intronic
956685446 3:71823076-71823098 AGCTTTCCAAAGCTGCAGCTTGG - Intergenic
960070647 3:113426242-113426264 CTTCTTCCACAGCTGGAGCAGGG + Exonic
962270725 3:133976207-133976229 CTCCTGCCAAAGGTGGATCTAGG + Intronic
962921928 3:139958098-139958120 CTCCTTCAAAAGGAGAAACTAGG + Intronic
965693854 3:171386044-171386066 CTCCTTCCAAAGCTGAAGCTGGG + Intronic
967943120 3:194781469-194781491 ATCCTTCTCTAGCTGAAGCTTGG - Intergenic
968468699 4:766316-766338 CTCCCTGCAAGGCTGAAGCACGG - Exonic
969441682 4:7220773-7220795 CTCCTTCCCAAGGCCAAGCTTGG + Intronic
969861274 4:10037480-10037502 CTCCTCCCAGAGCTGAGACTGGG + Intronic
972359467 4:38314155-38314177 ATCCTTCCAAAGATGAACCTGGG + Intergenic
973263979 4:48192845-48192867 CTCCTACCAAGGCTGCTGCTTGG + Intronic
973609687 4:52623808-52623830 CTCCTGCCTAAGCAGGAGCTGGG - Intronic
974974263 4:68870652-68870674 CATCTTCAAAAGCTGCAGCTGGG + Intergenic
975376994 4:73657675-73657697 CTACTTCCAAATATGTAGCTGGG + Intergenic
975514949 4:75236727-75236749 CTGCTTCCAGAGCTGGAGCAAGG + Intergenic
976109768 4:81659340-81659362 GTCTGTCCAAAGCTGAAACTAGG + Intronic
977350471 4:95878782-95878804 CTGCTTCCAAAGCTGGGGCAGGG + Intergenic
979743033 4:124175236-124175258 CCTCTTCAAAAGCTGAAGCTAGG - Intergenic
981982910 4:150817133-150817155 CTCCTCCCATATCTGAGGCTTGG + Exonic
983117407 4:163835377-163835399 CTCCTTCCAAATTTTAAGTTTGG + Intronic
984715768 4:182923447-182923469 CTCCTTCCAAAACAGAAACTGGG - Intergenic
985644372 5:1078113-1078135 CTCCTTGGAAAGCTGAGGCCCGG + Intronic
988064164 5:26213770-26213792 CTGGTTTCAAAGCTGAAGCACGG + Intergenic
988236665 5:28554601-28554623 ATCTTTCCAATGCTGAAACTGGG + Intergenic
989788467 5:45361426-45361448 CTCCTGCCTCAGCTGTAGCTGGG + Intronic
990275118 5:54187318-54187340 CTCCTTCCATTGCTGATGGTAGG - Intronic
990570655 5:57075169-57075191 CTGCTTCCAAGGCTGTGGCTTGG + Intergenic
991266376 5:64723981-64724003 CACCTTCCAATGATGAAGCAAGG - Exonic
991484081 5:67115754-67115776 CTGCTTCAAAAGCTGACTCTTGG + Intronic
992477936 5:77121804-77121826 TTCCTTCAAAAAGTGAAGCTAGG - Intergenic
993511923 5:88781432-88781454 CTGCTTCAGAAGCTGAAGCTTGG + Intronic
994402649 5:99300878-99300900 CTACTTCAAAGGCTGAGGCTGGG - Intergenic
995231211 5:109765919-109765941 CTTATTCCAAGGCTGAAGCCAGG - Intronic
995610160 5:113900983-113901005 CACCTGACAAAGCTGAAGCCTGG + Intergenic
996805232 5:127447128-127447150 CTCCTTCCATATCACAAGCTGGG - Intronic
997980779 5:138466272-138466294 CTCCATCCAAAACAAAAGCTCGG - Intronic
998388818 5:141773944-141773966 GCCCTCCCAAAGCTGTAGCTTGG - Intergenic
999596583 5:153211709-153211731 GACCTTCCAAATCTGCAGCTTGG - Intergenic
999711655 5:154323488-154323510 CTCCTTCCCCAGCTGTAGGTAGG - Intronic
999806521 5:155086452-155086474 CTCCTTCTAAGTCAGAAGCTGGG - Intergenic
1004137745 6:12984420-12984442 CTCCTTCCAGAACTGATGTTTGG + Intronic
1004274833 6:14226518-14226540 CTCCTTGCCAAGATGAGGCTTGG - Intergenic
1005434961 6:25799632-25799654 CTCCTTTTAAAGCTGAGGCAGGG + Intronic
1010665514 6:78625404-78625426 CTCCTTCCAAATCTTGAGCAAGG - Intergenic
1012568077 6:100685258-100685280 CTCTTGCAAAAGCTGAGGCTTGG + Intronic
1012976261 6:105784153-105784175 CCCTTTCCAAAGCTGACGGTTGG - Intergenic
1013643577 6:112112591-112112613 ATCCTTTCAAAGCTGAAGTCAGG + Intronic
1016409826 6:143771340-143771362 ATCCTTCCCAGGCTCAAGCTGGG + Intronic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1017950348 6:159130569-159130591 CACCCTCCAAAGCGGAGGCTGGG + Intergenic
1018221434 6:161584118-161584140 TTCCTTCCTGAGATGAAGCTTGG + Intronic
1018963574 6:168466217-168466239 CTGCTTTGAAAGCTGAAACTGGG + Intronic
1022902620 7:34825712-34825734 CTGCATCCAAAGCTGATTCTTGG - Intronic
1022949933 7:35328479-35328501 CTGCCTCACAAGCTGAAGCTTGG + Intergenic
1023522218 7:41060018-41060040 CTCCTGCCACACCTGAAGCTGGG - Intergenic
1024085909 7:45891203-45891225 CATCTTCCCAAACTGAAGCTCGG + Intronic
1026489776 7:70852698-70852720 CTTCTTCCAAAGTTGGAGCCAGG + Intergenic
1027241594 7:76333659-76333681 CTCCTTCCAAAGCCAAGTCTGGG - Intronic
1027366093 7:77459938-77459960 ATCCTTCCTAAGCTGGAACTTGG - Intergenic
1028230813 7:88304601-88304623 GTCCTTCAAAACCTGAAGATTGG - Intronic
1028554568 7:92108349-92108371 CAAGCTCCAAAGCTGAAGCTTGG + Intronic
1028606662 7:92663009-92663031 CTCCTTTCAAATCTGACTCTTGG - Intronic
1029382285 7:100221876-100221898 CTCCTTCCACAGCTGGCGTTAGG + Intronic
1029814537 7:103079307-103079329 TTCTTTCCATAGCTGAAGCTCGG + Intronic
1032083858 7:128873483-128873505 CTCCCTCCAGGGCTGCAGCTGGG - Intronic
1033463883 7:141573018-141573040 CTTCATCCACAGCTGAAGGTAGG + Intronic
1034217676 7:149420878-149420900 CTGCATCCAATGCTGAAGCCAGG + Intergenic
1035529920 8:343057-343079 CTCTTTCCAAAACTAAAGTTAGG + Intergenic
1036125782 8:6061012-6061034 CTCCCATCAAGGCTGAAGCTGGG + Intergenic
1037275375 8:17172782-17172804 CTCCATCCAAAGCAGAAGAAAGG - Intronic
1038765634 8:30425280-30425302 TTCCTTCAAAAGCTAAGGCTAGG + Intronic
1041163604 8:55070042-55070064 CTCCTTCCACTTCTCAAGCTAGG + Intergenic
1042302077 8:67294909-67294931 TTGATTCCAAGGCTGAAGCTGGG + Intronic
1042772781 8:72397554-72397576 CCCTTTCCAGAGCAGAAGCTAGG - Intergenic
1042964400 8:74335062-74335084 CTCCTCCCATAGCTGAGGTTGGG + Intronic
1043135510 8:76519050-76519072 CTCCTTCCAGAGCTGACTGTGGG - Intergenic
1047691380 8:127358170-127358192 CTCCTTCCAAATCTGTGACTTGG + Intergenic
1047881233 8:129196000-129196022 CTCCTTCAAAGGTTGAAACTGGG + Intergenic
1048008524 8:130438438-130438460 CTTGTTCCAAAGCTGCAGCCAGG - Intronic
1049011316 8:139889521-139889543 CACCTTCCCAAACTGAAACTGGG - Intronic
1050642844 9:7686780-7686802 CTCCTGGCAAGGCTGAAACTTGG - Intergenic
1051462832 9:17342741-17342763 CTCATTCCAAAAATGAAGCACGG - Intronic
1052152727 9:25139026-25139048 CTCCTTCCATAAATGAAGCAAGG + Intergenic
1053130213 9:35610250-35610272 CTCCTTCCTAACCTGAGGCCTGG - Exonic
1054729751 9:68689230-68689252 ATCAGTCCTAAGCTGAAGCTTGG + Intergenic
1055527378 9:77148564-77148586 ATCTTTCCAAAGGTGAAGCTGGG + Intergenic
1056665984 9:88581201-88581223 CTCCTTCCAAGGCAGTGGCTGGG - Intronic
1057085643 9:92207388-92207410 CTGCTTCTAGAGCTGGAGCTGGG - Intergenic
1060069702 9:120535206-120535228 CACCTCCAAATGCTGAAGCTAGG + Intronic
1060246696 9:121952527-121952549 CTCCTCCCCAAACAGAAGCTGGG - Intronic
1060889509 9:127179182-127179204 CTGCTTCCAGGGCTGAAGCCAGG - Intronic
1186008755 X:5105740-5105762 TTCCTTCTAGAGCTGGAGCTGGG + Intergenic
1186269479 X:7869758-7869780 CTCCTTTCAAAGCAGATTCTTGG + Intergenic
1187332818 X:18355613-18355635 CTCTTTCCAAAGCTGGATGTAGG + Intergenic
1188578237 X:31679423-31679445 CTCCTTCCATGACTCAAGCTTGG + Exonic
1188756621 X:33970136-33970158 CAGCTTCCAAAGCTGATGGTGGG - Intergenic
1189643974 X:43106401-43106423 TTGCTTTCACAGCTGAAGCTGGG - Intergenic
1192522741 X:71815994-71816016 CTCTTTCCAGAGCTGGAGTTTGG - Intergenic
1192529117 X:71871079-71871101 CTCCTTCCAGAGCTGGAGTGTGG + Intergenic
1193064013 X:77238167-77238189 ATCTTTCCAATGCTGAAGGTGGG - Intergenic
1194933415 X:99917093-99917115 CTCCTTCCAACACTGAAGCATGG - Intergenic
1198300574 X:135330722-135330744 CTATTTCAATAGCTGAAGCTAGG - Intronic
1199209982 X:145196516-145196538 CTCCATCCTAACCTGAAACTAGG + Intergenic
1199493929 X:148432019-148432041 CTCCTTTCAAAGCTCTAGGTAGG - Intergenic
1202378833 Y:24259610-24259632 TTCCTCCCAGAGCTGGAGCTGGG - Intergenic
1202491949 Y:25410511-25410533 TTCCTCCCAGAGCTGGAGCTGGG + Intergenic